|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for MYBBP1A |
 Gene summary |
| Gene information | Gene symbol | MYBBP1A | Gene ID | 10514 |
| Gene name | MYB binding protein 1a | |
| Synonyms | P160|PAP2|Pol5 | |
| Cytomap | 17p13.2 | |
| Type of gene | protein-coding | |
| Description | myb-binding protein 1AMYB binding protein (P160) 1ap53-activated protein-2 | |
| Modification date | 20180523 | |
| UniProtAcc | Q9BQG0 | |
| Context | PubMed: MYBBP1A [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| MYBBP1A | GO:0042149 | cellular response to glucose starvation | 21471221 |
Top |
Exon skipping events across known transcript of Ensembl for MYBBP1A from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for MYBBP1A |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for MYBBP1A |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_285701 | 17 | 4442916:4443262:4443642:4443779:4444757:4444859 | 4443642:4443779 | ENSG00000132382.10 | ENST00000574934.1,ENST00000574547.1,ENST00000573116.1,ENST00000571368.1,ENST00000381556.2,ENST00000254718.4 |
| exon_skip_285704 | 17 | 4445078:4445186:4445758:4445827:4445910:4446036 | 4445758:4445827 | ENSG00000132382.10 | ENST00000574547.1,ENST00000573116.1,ENST00000571368.1,ENST00000381556.2,ENST00000254718.4 |
| exon_skip_285706 | 17 | 4448320:4448470:4448553:4448640:4448904:4449056 | 4448553:4448640 | ENSG00000132382.10 | ENST00000573116.1,ENST00000381556.2,ENST00000254718.4 |
| exon_skip_285708 | 17 | 4451818:4451944:4452626:4452737:4453352:4453356 | 4452626:4452737 | ENSG00000132382.10 | ENST00000573175.1,ENST00000573116.1,ENST00000573723.1,ENST00000381556.2,ENST00000254718.4 |
| exon_skip_285711 | 17 | 4452626:4452737:4453352:4453648:4455174:4455292 | 4453352:4453648 | ENSG00000132382.10 | ENST00000573116.1,ENST00000381556.2,ENST00000254718.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for MYBBP1A |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_285701 | 17 | 4442916:4443262:4443642:4443779:4444757:4444859 | 4443642:4443779 | ENSG00000132382.10 | ENST00000381556.2,ENST00000571368.1,ENST00000573116.1,ENST00000254718.4,ENST00000574934.1,ENST00000574547.1 |
| exon_skip_285704 | 17 | 4445078:4445186:4445758:4445827:4445910:4446036 | 4445758:4445827 | ENSG00000132382.10 | ENST00000381556.2,ENST00000571368.1,ENST00000573116.1,ENST00000254718.4,ENST00000574547.1 |
| exon_skip_285706 | 17 | 4448320:4448470:4448553:4448640:4448904:4449056 | 4448553:4448640 | ENSG00000132382.10 | ENST00000381556.2,ENST00000573116.1,ENST00000254718.4 |
| exon_skip_285708 | 17 | 4451818:4451944:4452626:4452737:4453352:4453356 | 4452626:4452737 | ENSG00000132382.10 | ENST00000381556.2,ENST00000573116.1,ENST00000254718.4,ENST00000573723.1,ENST00000573175.1 |
| exon_skip_285711 | 17 | 4452626:4452737:4453352:4453648:4455174:4455292 | 4453352:4453648 | ENSG00000132382.10 | ENST00000381556.2,ENST00000573116.1,ENST00000254718.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for MYBBP1A |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000254718 | 4443642 | 4443779 | Frame-shift |
| ENST00000254718 | 4453352 | 4453648 | Frame-shift |
| ENST00000254718 | 4445758 | 4445827 | In-frame |
| ENST00000254718 | 4448553 | 4448640 | In-frame |
| ENST00000254718 | 4452626 | 4452737 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000254718 | 4443642 | 4443779 | Frame-shift |
| ENST00000254718 | 4453352 | 4453648 | Frame-shift |
| ENST00000254718 | 4445758 | 4445827 | In-frame |
| ENST00000254718 | 4448553 | 4448640 | In-frame |
| ENST00000254718 | 4452626 | 4452737 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for MYBBP1A |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000254718 | 4824 | 1328 | 4452626 | 4452737 | 1627 | 1737 | 440 | 476 |
| ENST00000254718 | 4824 | 1328 | 4448553 | 4448640 | 2381 | 2467 | 691 | 720 |
| ENST00000254718 | 4824 | 1328 | 4445758 | 4445827 | 3326 | 3394 | 1006 | 1029 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000254718 | 4824 | 1328 | 4452626 | 4452737 | 1627 | 1737 | 440 | 476 |
| ENST00000254718 | 4824 | 1328 | 4448553 | 4448640 | 2381 | 2467 | 691 | 720 |
| ENST00000254718 | 4824 | 1328 | 4445758 | 4445827 | 3326 | 3394 | 1006 | 1029 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9BQG0 | 440 | 476 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 440 | 476 | 1 | 582 | Region | Note=Interaction with MYB;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q7TPV4 |
| Q9BQG0 | 691 | 720 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 691 | 720 | 720 | 784 | Compositional bias | Note=Glu-rich |
| Q9BQG0 | 1006 | 1029 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 1006 | 1029 | 1028 | 1028 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9BQG0 | 440 | 476 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 440 | 476 | 1 | 582 | Region | Note=Interaction with MYB;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q7TPV4 |
| Q9BQG0 | 691 | 720 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 691 | 720 | 720 | 784 | Compositional bias | Note=Glu-rich |
| Q9BQG0 | 1006 | 1029 | 1 | 1328 | Chain | ID=PRO_0000096255;Note=Myb-binding protein 1A |
| Q9BQG0 | 1006 | 1029 | 1028 | 1028 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for MYBBP1A |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| ACC | TCGA-OR-A5KB-01 | exon_skip_285711 | 4453353 | 4453648 | 4453405 | 4453405 | Frame_Shift_Del | C | - | p.V423fs |
| ACC | TCGA-OR-A5KB-01 | exon_skip_285711 | 4453353 | 4453648 | 4453405 | 4453406 | Frame_Shift_Del | CC | - | p.423_423del |
| BRCA | TCGA-E2-A1B4-01 | exon_skip_285706 | 4448554 | 4448640 | 4448552 | 4448552 | Splice_Site | A | C | e16+2 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| TE159T_FIBROBLAST | 4443643 | 4443779 | 4443650 | 4443650 | Missense_Mutation | C | T | p.G1143R |
| HEC151_ENDOMETRIUM | 4443643 | 4443779 | 4443689 | 4443689 | Missense_Mutation | G | A | p.R1130C |
| Y79_AUTONOMIC_GANGLIA | 4445759 | 4445827 | 4445763 | 4445763 | Missense_Mutation | T | C | p.H1028R |
| TO175T_FIBROBLAST | 4445759 | 4445827 | 4445778 | 4445778 | Missense_Mutation | G | A | p.P1023L |
| YD15_SALIVARY_GLAND | 4445759 | 4445827 | 4445816 | 4445816 | Missense_Mutation | C | G | p.Q1010H |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 4448554 | 4448640 | 4448573 | 4448573 | Missense_Mutation | C | T | p.R714Q |
| SNU1040_LARGE_INTESTINE | 4452627 | 4452737 | 4452660 | 4452660 | Missense_Mutation | T | C | p.E466G |
| PEER_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 4452627 | 4452737 | 4452681 | 4452681 | Missense_Mutation | A | C | p.I459S |
| BE13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 4452627 | 4452737 | 4452681 | 4452681 | Missense_Mutation | A | C | p.I459S |
| NCIH660_PROSTATE | 4452627 | 4452737 | 4452729 | 4452729 | Missense_Mutation | C | G | p.R443P |
| JEG3_PLACENTA | 4453353 | 4453648 | 4453424 | 4453424 | Missense_Mutation | C | A | p.Q416H |
| LS123_LARGE_INTESTINE | 4453353 | 4453648 | 4453509 | 4453509 | Missense_Mutation | G | A | p.T388M |
| HPAC_PANCREAS | 4453353 | 4453648 | 4453567 | 4453567 | Missense_Mutation | G | A | p.R369W |
| SNU1040_LARGE_INTESTINE | 4452627 | 4452737 | 4452694 | 4452694 | Nonsense_Mutation | G | A | p.R455* |
| SNU601_STOMACH | 4445759 | 4445827 | 4445825 | 4445907 | Splice_Site | CACCTGGTGGGGAGTGACAAGGGCTGTGAGGTGCAGGCTGGGCTGAGCAGGGACCATGAGGAAGCAGGGCAGGCCCCAACACT | - | p.S1007fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for MYBBP1A |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MYBBP1A |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MYBBP1A |
Top |
RelatedDrugs for MYBBP1A |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for MYBBP1A |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|