ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for BTN2A2

Gene summary

Gene information	Gene symbol	BTN2A2
	Gene ID	10385
	Gene name	butyrophilin subfamily 2 member A2
	Synonyms	BT2.2\|BTF2\|BTN2.2
	Cytomap	6p22.2
	Type of gene	protein-coding
	Description	butyrophilin subfamily 2 member A2butyrophilin 2
	Modification date	20180523
	UniProtAcc	Q8WVV5
	Context	PubMed: BTN2A2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for BTN2A2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for BTN2A2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for BTN2A2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_448570	6	26383370:26383409:26384019:26384143:26385242:26385437	26384019:26384143	ENSG00000124508.12	ENST00000482636.1,ENST00000356709.4,ENST00000432533.2
exon_skip_448571	6	26383370:26383409:26384019:26384143:26388240:26388387	26384019:26384143	ENSG00000124508.12	ENST00000352867.2,ENST00000467485.1
exon_skip_448572	6	26383370:26383409:26384019:26384143:26390232:26390365	26384019:26384143	ENSG00000124508.12	ENST00000482536.1
exon_skip_448575	6	26383370:26383409:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000490025.1
exon_skip_448581	6	26383445:26383527:26384019:26384143:26388240:26388387	26384019:26384143	ENSG00000124508.12	ENST00000472507.1
exon_skip_448586	6	26384019:26384143:26385242:26385590:26388240:26388387	26385242:26385590	ENSG00000124508.12	ENST00000493275.1,ENST00000469230.1,ENST00000356709.4,ENST00000416795.2
exon_skip_448588	6	26384019:26384143:26385242:26385590:26390232:26390365	26385242:26385590	ENSG00000124508.12	ENST00000432533.2
exon_skip_448590	6	26384019:26384143:26385370:26385590:26388240:26388387	26385370:26385590	ENSG00000124508.12	ENST00000471116.1
exon_skip_448593	6	26384019:26384143:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000483410.1,ENST00000352867.2,ENST00000467485.1
exon_skip_448599	6	26385370:26385590:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000469230.1,ENST00000356709.4,ENST00000416795.2
exon_skip_448606	6	26390330:26390439:26390914:26390935:26391030:26391057	26390914:26390935	ENSG00000124508.12	ENST00000469230.1,ENST00000495632.1,ENST00000356709.4,ENST00000490025.1,ENST00000352867.2,ENST00000416795.2,ENST00000482536.1,ENST00000432533.2
exon_skip_448611	6	26390914:26390935:26391030:26391057:26392602:26392950	26391030:26391057	ENSG00000124508.12	ENST00000356709.4,ENST00000490025.1,ENST00000352867.2,ENST00000416795.2,ENST00000482536.1

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for BTN2A2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_448570	6	26383370:26383409:26384019:26384143:26385242:26385437	26384019:26384143	ENSG00000124508.12	ENST00000356709.4,ENST00000432533.2,ENST00000482636.1
exon_skip_448571	6	26383370:26383409:26384019:26384143:26388240:26388387	26384019:26384143	ENSG00000124508.12	ENST00000467485.1,ENST00000352867.2
exon_skip_448572	6	26383370:26383409:26384019:26384143:26390232:26390365	26384019:26384143	ENSG00000124508.12	ENST00000482536.1
exon_skip_448575	6	26383370:26383409:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000490025.1
exon_skip_448581	6	26383445:26383527:26384019:26384143:26388240:26388387	26384019:26384143	ENSG00000124508.12	ENST00000472507.1
exon_skip_448586	6	26384019:26384143:26385242:26385590:26388240:26388387	26385242:26385590	ENSG00000124508.12	ENST00000469230.1,ENST00000356709.4,ENST00000493275.1,ENST00000416795.2
exon_skip_448588	6	26384019:26384143:26385242:26385590:26390232:26390365	26385242:26385590	ENSG00000124508.12	ENST00000432533.2
exon_skip_448590	6	26384019:26384143:26385370:26385590:26388240:26388387	26385370:26385590	ENSG00000124508.12	ENST00000471116.1
exon_skip_448593	6	26384019:26384143:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000467485.1,ENST00000352867.2,ENST00000483410.1
exon_skip_448599	6	26385370:26385590:26388240:26388522:26390232:26390365	26388240:26388522	ENSG00000124508.12	ENST00000469230.1,ENST00000356709.4,ENST00000416795.2
exon_skip_448606	6	26390330:26390439:26390914:26390935:26391030:26391057	26390914:26390935	ENSG00000124508.12	ENST00000469230.1,ENST00000490025.1,ENST00000356709.4,ENST00000352867.2,ENST00000482536.1,ENST00000432533.2,ENST00000416795.2,ENST00000495632.1
exon_skip_448611	6	26390914:26390935:26391030:26391057:26392602:26392950	26391030:26391057	ENSG00000124508.12	ENST00000490025.1,ENST00000356709.4,ENST00000352867.2,ENST00000482536.1,ENST00000416795.2

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for BTN2A2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000356709	26384019	26384143	5CDS-5UTR
ENST00000356709	26385242	26385590	In-frame
ENST00000416795	26385242	26385590	In-frame
ENST00000356709	26388240	26388522	In-frame
ENST00000416795	26388240	26388522	In-frame
ENST00000356709	26390914	26390935	In-frame
ENST00000416795	26390914	26390935	In-frame
ENST00000356709	26391030	26391057	In-frame
ENST00000416795	26391030	26391057	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000356709	26384019	26384143	5CDS-5UTR
ENST00000356709	26385242	26385590	In-frame
ENST00000416795	26385242	26385590	In-frame
ENST00000356709	26388240	26388522	In-frame
ENST00000416795	26388240	26388522	In-frame
ENST00000356709	26390914	26390935	In-frame
ENST00000416795	26390914	26390935	In-frame
ENST00000356709	26391030	26391057	In-frame
ENST00000416795	26391030	26391057	In-frame

Top

Infer the effects of exon skipping event on protein functional features for BTN2A2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000356709	3607	523	26385242	26385590	206	553	31	147
ENST00000416795	2750	523	26385242	26385590	231	578	31	147
ENST00000356709	3607	523	26388240	26388522	554	835	147	241
ENST00000416795	2750	523	26388240	26388522	579	860	147	241

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000356709	3607	523	26385242	26385590	206	553	31	147
ENST00000416795	2750	523	26385242	26385590	231	578	31	147
ENST00000356709	3607	523	26388240	26388522	554	835	147	241
ENST00000416795	2750	523	26388240	26388522	579	860	147	241

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q8WVV5	31	147	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	31	147	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	31	147	55	129	Disulfide bond	Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00114
Q8WVV5	31	147	55	129	Disulfide bond	Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00114
Q8WVV5	31	147	34	145	Domain	Note=Ig-like V-type
Q8WVV5	31	147	34	145	Domain	Note=Ig-like V-type
Q8WVV5	31	147	50	50	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	50	50	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	118	118	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	118	118	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	1	32	Signal peptide	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	1	32	Signal peptide	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	148	241	Alternative sequence	ID=VSP_043562;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	148	241	Alternative sequence	ID=VSP_043562;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	147	241	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	147	241	153	234	Domain	Note=Ig-like C2-type
Q8WVV5	147	241	153	234	Domain	Note=Ig-like C2-type
Q8WVV5	147	241	220	220	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	220	220	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	226	226	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	226	226	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q8WVV5	31	147	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	31	147	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	31	147	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	31	147	55	129	Disulfide bond	Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00114
Q8WVV5	31	147	55	129	Disulfide bond	Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00114
Q8WVV5	31	147	34	145	Domain	Note=Ig-like V-type
Q8WVV5	31	147	34	145	Domain	Note=Ig-like V-type
Q8WVV5	31	147	50	50	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	50	50	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	118	118	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	118	118	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	1	32	Signal peptide	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	1	32	Signal peptide	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	31	147	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	241	Alternative sequence	ID=VSP_044861;Note=In isoform 5. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	32	147	Alternative sequence	ID=VSP_043561;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	148	241	Alternative sequence	ID=VSP_043562;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	148	241	Alternative sequence	ID=VSP_043562;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:14702039;Dbxref=PMID:14702039
Q8WVV5	147	241	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	147	241	33	523	Chain	ID=PRO_0000014530;Note=Butyrophilin subfamily 2 member A2
Q8WVV5	147	241	153	234	Domain	Note=Ig-like C2-type
Q8WVV5	147	241	153	234	Domain	Note=Ig-like C2-type
Q8WVV5	147	241	220	220	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	220	220	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	226	226	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	226	226	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255
Q8WVV5	147	241	33	265	Topological domain	Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255

Top

SNVs in the skipped exons for BTN2A2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_448581 exon_skip_448571 exon_skip_448570 exon_skip_448572	26384020	26384143	26384090	26384090	Frame_Shift_Del	C	-	p.S14fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_448588 exon_skip_448586	26385243	26385590	26385259	26385259	Frame_Shift_Del	G	-	p.V37fs
LIHC	TCGA-DD-A1EG-01	exon_skip_448588 exon_skip_448586	26385243	26385590	26385329	26385329	Frame_Shift_Del	A	-	p.K61fs
COAD	TCGA-CM-4747-01	exon_skip_448575 exon_skip_448599 exon_skip_448593	26388241	26388522	26388304	26388314	Frame_Shift_Del	GCATATCTGGA	-	p.169_172del
LIHC	TCGA-DD-A3A0-01	exon_skip_448575 exon_skip_448599 exon_skip_448593	26388241	26388522	26388330	26388330	Frame_Shift_Del	C	-	p.P178fs
LUAD	TCGA-05-4382-01	exon_skip_448575 exon_skip_448599 exon_skip_448593	26388241	26388522	26388252	26388252	Nonsense_Mutation	A	T	p.K152*
BRCA	TCGA-B6-A0IK-01	exon_skip_448575 exon_skip_448599 exon_skip_448593	26388241	26388522	26388276	26388276	Nonsense_Mutation	C	T	p.Q160*
STAD	TCGA-F1-A448-01	exon_skip_448606	26390915	26390935	26390936	26390936	Splice_Site	G	A	.
STAD	TCGA-F1-A448-01	exon_skip_448606	26390915	26390935	26390936	26390936	Splice_Site	G	A	p.R318_splice

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-05-4382-01
	Cancer type: LUAD
	ESID: exon_skip_448593
	Skipped exon start: 26388241
	Skipped exon end: 26388522
	Mutation start: 26388252
	Mutation end: 26388252
	Mutation type: Nonsense_Mutation
	Reference seq: A
	Mutation seq: T
	AAchange: p.K152*
exon_skip_129994_LUAD_TCGA-05-4382-01.png
exon_skip_129996_LUAD_TCGA-05-4382-01.png
exon_skip_146150_LUAD_TCGA-05-4382-01.png
exon_skip_19523_LUAD_TCGA-05-4382-01.png
exon_skip_327136_LUAD_TCGA-05-4382-01.png
exon_skip_331845_LUAD_TCGA-05-4382-01.png
exon_skip_347552_LUAD_TCGA-05-4382-01.png
exon_skip_347557_LUAD_TCGA-05-4382-01.png
exon_skip_359496_LUAD_TCGA-05-4382-01.png
exon_skip_367842_LUAD_TCGA-05-4382-01.png
exon_skip_367844_LUAD_TCGA-05-4382-01.png
exon_skip_425876_LUAD_TCGA-05-4382-01.png
exon_skip_434000_LUAD_TCGA-05-4382-01.png
exon_skip_448593_LUAD_TCGA-05-4382-01.png
exon_skip_91823_LUAD_TCGA-05-4382-01.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
KYSE30_OESOPHAGUS	26385243	26385590	26385355	26385382	Frame_Shift_Del	GTGGTTCCGGTCTCAGTTCTCCCCCGCA	-	p.RWFRSQFSPA69fs
KYSE30_OESOPHAGUS	26385371	26385590	26385355	26385382	Frame_Shift_Del	GTGGTTCCGGTCTCAGTTCTCCCCCGCA	-	p.RWFRSQFSPA69fs
NCIH1437_LUNG	26385243	26385590	26385474	26385474	Frame_Shift_Del	G	-	p.R109fs
NCIH1437_LUNG	26385371	26385590	26385474	26385474	Frame_Shift_Del	G	-	p.R109fs
H4_CENTRAL_NERVOUS_SYSTEM	26384020	26384143	26384104	26384106	In_Frame_Del	CTG	-	p.L24del
LS1034_LARGE_INTESTINE	26384020	26384143	26384104	26384106	In_Frame_Del	CTG	-	p.L24del
SKNMC_BONE	26384020	26384143	26384104	26384106	In_Frame_Del	CTG	-	p.L24del
OCIMY7_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	26384020	26384143	26384086	26384086	Missense_Mutation	G	A	p.A13T
HEC151_ENDOMETRIUM	26385243	26385590	26385252	26385252	Missense_Mutation	C	G	p.T35S
TE10_OESOPHAGUS	26385243	26385590	26385278	26385278	Missense_Mutation	C	G	p.L44V
JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	26385243	26385590	26385380	26385380	Missense_Mutation	G	A	p.A78T
JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	26385371	26385590	26385380	26385380	Missense_Mutation	G	A	p.A78T
LS411N_LARGE_INTESTINE	26385243	26385590	26385482	26385482	Missense_Mutation	G	A	p.V112M
LS411N_LARGE_INTESTINE	26385371	26385590	26385482	26385482	Missense_Mutation	G	A	p.V112M
HCC1569_BREAST	26385243	26385590	26385500	26385500	Missense_Mutation	A	G	p.N118D
HCC1569_BREAST	26385371	26385590	26385500	26385500	Missense_Mutation	A	G	p.N118D
TGBC24TKB_BILIARY_TRACT	26385243	26385590	26385520	26385520	Missense_Mutation	T	A	p.N124K
TGBC24TKB_BILIARY_TRACT	26385371	26385590	26385520	26385520	Missense_Mutation	T	A	p.N124K
NCIH1623_LUNG	26385243	26385590	26385530	26385530	Missense_Mutation	C	A	p.R128S
NCIH1623_LUNG	26385371	26385590	26385530	26385530	Missense_Mutation	C	A	p.R128S
SNGM_ENDOMETRIUM	26385243	26385590	26385575	26385575	Missense_Mutation	C	T	p.R143C
SNGM_ENDOMETRIUM	26385371	26385590	26385575	26385575	Missense_Mutation	C	T	p.R143C
AU565_BREAST	26388241	26388522	26388336	26388336	Missense_Mutation	A	G	p.T180A
SKBR3_BREAST	26388241	26388522	26388336	26388336	Missense_Mutation	A	G	p.T180A
TT_OESOPHAGUS	26388241	26388522	26388409	26388409	Missense_Mutation	T	G	p.L204R
NUGC2_STOMACH	26388241	26388522	26388463	26388463	Missense_Mutation	C	A	p.S222Y
CAL72_BONE	26388241	26388522	26388489	26388489	Missense_Mutation	G	A	p.G231S
RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	26388241	26388522	26388513	26388513	Missense_Mutation	T	A	p.F239I
SNU1040_LARGE_INTESTINE	26390915	26390935	26390935	26390935	Splice_Site	C	T	p.R318*

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BTN2A2

sQTL information located at the skipped exons.

Exon skip ID	Chromosome	Three exons	Skippped exon	ENST	Cancer type	SNP id	Location	DNA change (ref/var)	P-value
exon_skip_448575	6	26383370:26383409:26388240:26388522:26390232:26390365	26388240:26388522	ENST00000490025.1	LGG	rs62617839	chr6:26388405	G/A	2.39e-04
exon_skip_448599	6	26385370:26385590:26388240:26388522:26390232:26390365	26388240:26388522	ENST00000469230.1,ENST00000356709.4,ENST00000416795.2	LGG	rs62617839	chr6:26388405	G/A	2.39e-04
exon_skip_448593	6	26384019:26384143:26388240:26388522:26390232:26390365	26388240:26388522	ENST00000483410.1,ENST00000352867.2,ENST00000467485.1	LGG	rs62617839	chr6:26388405	G/A	2.39e-04

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BTN2A2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BTN2A2

Top

RelatedDrugs for BTN2A2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for BTN2A2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for BTN2A2

Exon skipping events across known transcript of Ensembl for BTN2A2 from UCSC genome browser

Gene isoform structures and expression levels for BTN2A2

Exon skipping events with PSIs in TCGA for BTN2A2

Exon skipping events with PSIs in GTEx for BTN2A2

Open reading frame (ORF) annotation in the exon skipping event for BTN2A2

Infer the effects of exon skipping event on protein functional features for BTN2A2

SNVs in the skipped exons for BTN2A2

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BTN2A2

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BTN2A2

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BTN2A2

RelatedDrugs for BTN2A2

RelatedDiseases for BTN2A2