Home

Download

Statistics

Examples

Help

Contact

Editing gene: VAPA (CAeditome ID:9218)

Gene summary for VAPA

Gene summary

Gene information	Gene symbol	VAPA
	Gene ID	9218
	Gene name	VAMP associated protein A
	Synonyms	VAMP-A\|VAP-33\|VAP-A\|VAP33\|hVAP-33
	Cytomap	18p11.22
	Type of gene	protein-coding
	Description	vesicle-associated membrane protein-associated protein A33 kDa VAMP-associated proteinVAMP (vesicle-associated membrane protein)-associated protein A, 33kDaepididymis secretory sperm binding protein
	Modification date	20210518
	UniProtAcc	Q9P0L0
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
VAPA	GO:0070971	Vesicle-associated membrane protein-associated protein A	18713837
VAPA	GO:0005923	Vesicle-associated membrane protein-associated protein A	10523508
VAPA	GO:0048471	Vesicle-associated membrane protein-associated protein A	16895911
VAPA	GO:0044791	Vesicle-associated membrane protein-associated protein A	19515777
VAPA	GO:0044828	Vesicle-associated membrane protein-associated protein A	19515777
VAPA	GO:0044829	Vesicle-associated membrane protein-associated protein A	19515777
VAPA	GO:0005783	Vesicle-associated membrane protein-associated protein A	0000052
VAPA	GO:0005783	Vesicle-associated membrane protein-associated protein A	18713837
VAPA	GO:0005783	Vesicle-associated membrane protein-associated protein A	19289470
VAPA	GO:0005789	Vesicle-associated membrane protein-associated protein A	30741634
VAPA	GO:0005886	Vesicle-associated membrane protein-associated protein A	10523508
VAPA	GO:0031982	Vesicle-associated membrane protein-associated protein A	10523508

Top

RNA A-to-I events for VAPA

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000101558.12

RNA A-to-I editing events in Cancer.

CAediting_1253195(9922812, +), CAediting_1253196(9931851, +), CAediting_1253197(9931878, +), CAediting_1253198(9931890, +), CAediting_1253199(9932987, +), CAediting_1253200(9933026, +), CAediting_1253201(9933027, +), CAediting_1253202(9933028, +), CAediting_1253203(9933561, +), CAediting_1253204(9933607, +), CAediting_1253205(9933655, +), CAediting_1253206(9933671, +), CAediting_1253207(9933718, +), CAediting_1253208(9933790, +), CAediting_1253209(9933800, +), CAediting_1253210(9933801, +), CAediting_1253211(9933812, +), CAediting_1253212(9933814, +), CAediting_1253213(9934937, +), CAediting_1253214(9934980, +), CAediting_1253215(9935477, +), CAediting_1253216(9935494, +), CAediting_1253217(9935514, +), CAediting_1253218(9935516, +), CAediting_1253219(9936502, +), CAediting_1253220(9936640, +), CAediting_1253221(9936707, +), CAediting_1253222(9936716, +), CAediting_1253223(9936729, +), CAediting_1253224(9948839, +), CAediting_1253225(9952521, +), CAediting_1253226(9954092, +), CAediting_1253227(9954093, +), CAediting_1253228(9954104, +), CAediting_1253229(9954362, +), CAediting_1253230(9954368, +), CAediting_1253231(9954442, +), CAediting_1253232(9957075, +), CAediting_1253233(9957149, +), CAediting_1253234(9957212, +), CAediting_1253235(9957215, +), CAediting_1253236(9957297, +),

Top

RNA editing positional annotations for VAPA using Annovar

Protein coding RNA editing(s).

CAeditome ID	Position	Variant type	ENST	NTchange	AAchange	SIFT_score	Polyphen2_HVAR_score	PROVEAN_pred
CAediting_1253196	chr18_9931851_+	nonsynonymous SNV	ENST00000340541.4	c.A121G	p.N41D	D	D	D
CAediting_1253196	chr18_9931851_+	nonsynonymous SNV	ENST00000400000.5	c.A121G	p.N41D	D	D	D
CAediting_1253197	chr18_9931878_+	nonsynonymous SNV	ENST00000340541.4	c.A148G	p.K50E	D	D	D
CAediting_1253197	chr18_9931878_+	nonsynonymous SNV	ENST00000400000.5	c.A148G	p.K50E	D	D	D
CAediting_1253198	chr18_9931890_+	nonsynonymous SNV	ENST00000340541.4	c.A160G	p.T54A	D	D	D
CAediting_1253198	chr18_9931890_+	nonsynonymous SNV	ENST00000400000.5	c.A160G	p.T54A	D	D	D
CAediting_1253226	chr18_9954092_+	nonsynonymous SNV	ENST00000340541.4	c.A766G	p.K256E	T	D	N
CAediting_1253226	chr18_9954092_+	nonsynonymous SNV	ENST00000400000.5	c.A631G	p.K211E	T	D	N
CAediting_1253227	chr18_9954093_+	nonsynonymous SNV	ENST00000340541.4	c.A767G	p.K256R	T	D	N
CAediting_1253227	chr18_9954093_+	nonsynonymous SNV	ENST00000400000.5	c.A632G	p.K211R	T	D	N

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_1253195	chr18_9922812_+	ncRNA_intronic
CAediting_1253196	chr18_9931851_+	exonic
CAediting_1253197	chr18_9931878_+	exonic
CAediting_1253198	chr18_9931890_+	exonic
CAediting_1253199	chr18_9932987_+	ncRNA_intronic
CAediting_1253200	chr18_9933026_+	ncRNA_intronic
CAediting_1253201	chr18_9933027_+	ncRNA_intronic
CAediting_1253202	chr18_9933028_+	ncRNA_intronic
CAediting_1253203	chr18_9933561_+	ncRNA_intronic
CAediting_1253204	chr18_9933607_+	ncRNA_intronic
CAediting_1253205	chr18_9933655_+	ncRNA_intronic
CAediting_1253206	chr18_9933671_+	ncRNA_intronic
CAediting_1253207	chr18_9933718_+	ncRNA_intronic
CAediting_1253208	chr18_9933790_+	ncRNA_intronic
CAediting_1253209	chr18_9933800_+	ncRNA_intronic
CAediting_1253210	chr18_9933801_+	ncRNA_intronic
CAediting_1253211	chr18_9933812_+	ncRNA_intronic
CAediting_1253212	chr18_9933814_+	ncRNA_intronic
CAediting_1253213	chr18_9934937_+	ncRNA_intronic
CAediting_1253214	chr18_9934980_+	ncRNA_intronic
CAediting_1253215	chr18_9935477_+	ncRNA_intronic
CAediting_1253216	chr18_9935494_+	ncRNA_intronic
CAediting_1253217	chr18_9935514_+	ncRNA_intronic
CAediting_1253218	chr18_9935516_+	ncRNA_intronic
CAediting_1253219	chr18_9936502_+	ncRNA_exonic
CAediting_1253220	chr18_9936640_+	ncRNA_intronic
CAediting_1253221	chr18_9936707_+	ncRNA_intronic
CAediting_1253222	chr18_9936716_+	ncRNA_intronic
CAediting_1253223	chr18_9936729_+	ncRNA_exonic
CAediting_1253224	chr18_9948839_+	ncRNA_exonic
CAediting_1253225	chr18_9952521_+	ncRNA_intronic
CAediting_1253226	chr18_9954092_+	exonic
CAediting_1253227	chr18_9954093_+	exonic
CAediting_1253228	chr18_9954104_+	exonic
CAediting_1253229	chr18_9954362_+	ncRNA_exonic
CAediting_1253230	chr18_9954368_+	ncRNA_exonic
CAediting_1253231	chr18_9954442_+	ncRNA_exonic
CAediting_1253232	chr18_9957075_+	UTR3
CAediting_1253233	chr18_9957149_+	UTR3
CAediting_1253234	chr18_9957212_+	UTR3
CAediting_1253235	chr18_9957215_+	UTR3
CAediting_1253236	chr18_9957297_+	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_1253199	chr18_9932987_+	SINE	Alu	AluSg7
CAediting_1253200	chr18_9933026_+	SINE	Alu	AluSg7
CAediting_1253201	chr18_9933027_+	SINE	Alu	AluSg7
CAediting_1253202	chr18_9933028_+	SINE	Alu	AluSg7
CAediting_1253203	chr18_9933561_+	SINE	Alu	AluSz
CAediting_1253204	chr18_9933607_+	SINE	Alu	AluSz
CAediting_1253205	chr18_9933655_+	SINE	Alu	AluSz
CAediting_1253206	chr18_9933671_+	SINE	Alu	AluSz
CAediting_1253207	chr18_9933718_+	SINE	Alu	AluSz
CAediting_1253208	chr18_9933790_+	SINE	Alu	AluSz
CAediting_1253209	chr18_9933800_+	SINE	Alu	AluSz
CAediting_1253210	chr18_9933801_+	SINE	Alu	AluSz
CAediting_1253211	chr18_9933812_+	SINE	Alu	AluSz
CAediting_1253212	chr18_9933814_+	SINE	Alu	AluSz
CAediting_1253213	chr18_9934937_+	SINE	Alu	AluY
CAediting_1253214	chr18_9934980_+	SINE	Alu	AluY
CAediting_1253215	chr18_9935477_+	SINE	Alu	AluJb
CAediting_1253216	chr18_9935494_+	SINE	Alu	AluJb
CAediting_1253217	chr18_9935514_+	SINE	Alu	AluJb
CAediting_1253218	chr18_9935516_+	SINE	Alu	AluJb
CAediting_1253219	chr18_9936502_+	SINE	Alu	AluJo
CAediting_1253220	chr18_9936640_+	SINE	Alu	AluJo
CAediting_1253221	chr18_9936707_+	SINE	Alu	AluJo
CAediting_1253222	chr18_9936716_+	SINE	Alu	AluJo
CAediting_1253223	chr18_9936729_+	SINE	Alu	AluJo
CAediting_1253224	chr18_9948839_+	SINE	Alu	AluJr
CAediting_1253225	chr18_9952521_+	SINE	Alu	AluSq2
CAediting_1253232	chr18_9957075_+	SINE	Alu	AluSg
CAediting_1253233	chr18_9957149_+	SINE	Alu	AluSg
CAediting_1253234	chr18_9957212_+	SINE	Alu	AluSg
CAediting_1253235	chr18_9957215_+	SINE	Alu	AluSg
CAediting_1253236	chr18_9957297_+	SINE	Alu	AluSg

Top

RNA A-to-I editing events in the alternative splicing sites for VAPA

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
IR	CAediting_1253236	chr18_9957297_+	9957280:9957302	3SS	0+3i	CCCAAAGTGCTGGGATTACAGGT	-18.22	CCCAAAGTGCTGGGATTGCAGGT	-30.13

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000101558.12.VAPA.

Correlation between RNA A-to-I editing and PSI for ENSG00000101558.12.VAPA.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for VAPA

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for VAPA

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for VAPA

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1253198	chr18_9931890_+	ENSG00000101558.12	ENST00000585042	hsa-miR-1205	9931887	9931892	6mer	9931874	9931893	142.00	-20.58
CAediting_1253198	chr18_9931890_+	ENSG00000101558.12	ENST00000585042	hsa-miR-17-3p	9931886	9931892	7mer-m8	9931874	9931893	143.00	-16.81
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-3940-3p	9957072	9957078	7mer-m8	9957058	9957079	147.00	-21.55
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-1199-3p	9957147	9957153	7mer-m8	9957135	9957154	143.00	-19.95
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-615-3p	9957143	9957149	7mer-m8	9957128	9957150	158.00	-22.90
CAediting_1253236	chr18_9957297_+	ENSG00000101558.12	ENST00000400000	hsa-miR-106a-3p	9957293	9957298	6mer	9957278	9957299	141.00	-21.13

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-1199-5p	9957143	9957149	7mer-m8	9957130	9957150	141	-18.19
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-3187-5p	9957069	9957075	7mer-m8	9957051	9957076	149	-27.17
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4663	9957144	9957150	7mer-m8	9957131	9957151	149	-18.25
CAediting_1253231	chr18_9954442_+	ENSG00000101558.12	ENST00000400000	hsa-miR-489-3p	9954435	9954441	7mer-m8	9954421	9954442	141	-9.63
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-5189-5p	9957069	9957075	7mer-m8	9957054	9957076	148	-23.73
CAediting_1253235	chr18_9957215_+	ENSG00000101558.12	ENST00000400000	hsa-miR-593-3p	9957214	9957220	7mer-1a	9957202	9957220	140	-19.02
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-612	9957069	9957075	7mer-m8	9957052	9957076	146	-21.15
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-661	9957071	9957077	7mer-m8	9957055	9957078	142	-19.39
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-6751-3p	9957143	9957149	7mer-m8	9957130	9957150	140	-13.22
CAediting_1253233	chr18_9957149_+	ENSG00000101558.12	ENST00000400000	hsa-miR-6807-5p	9957142	9957148	7mer-m8	9957128	9957149	155	-16.36
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-6860	9957069	9957075	7mer-m8	9957056	9957076	142	-17.44
CAediting_1253232	chr18_9957075_+	ENSG00000101558.12	ENST00000400000	hsa-miR-939-3p	9957070	9957076	7mer-m8	9957057	9957077	140	-15.63
CAediting_1253198	chr18_9931890_+	ENSG00000101558.12	ENST00000585042	hsa-miR-20b-3p	9931886	9931892	7mer-m8	9931874	9931893	151	-16.17
CAediting_1253196	chr18_9931851_+	ENSG00000101558.12	ENST00000585042	hsa-miR-3167	9931848	9931855	8mer-1a	9931834	9931855	148	-9.5
CAediting_1253197	chr18_9931878_+	ENSG00000101558.12	ENST00000585042	hsa-miR-510-3p	9931872	9931879	8mer-1a	9931858	9931879	143	-7.78
CAediting_1253196	chr18_9931851_+	ENSG00000101558.12	ENST00000585042	hsa-miR-876-5p	9931848	9931855	8mer-1a	9931830	9931855	144	-11.92

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1229414	chr17_67471546_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9959314	9959321	8mer-1a	9959298	9959321	157	-10.38
CAediting_1351755	chr19_40282625_-	ENSG00000101558.12	ENST00000400000	hsa-miR-641	9956191	9956197	7mer-1a	9956175	9956197	140	-19.28
CAediting_524911	chr7_5495852_-	ENSG00000101558.12	ENST00000400000	hsa-miR-589-3p	9956571	9956578	8mer-1a	9956555	9956578	149	-17.6
CAediting_573001	chr7_92204086_-	ENSG00000101558.12	ENST00000400000	hsa-miR-1285-5p	9956587	9956593	7mer-m8	9956574	9956594	146	-18.64

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_573001	chr7_92204086_-	ENSG00000101558.12	ENST00000400000	hsa-miR-1285-5p	9957824	9957830	7mer-m8	9957811	9957831	145	-13.26
CAediting_1160181	chr17_7017644_-	ENSG00000101558.12	ENST00000400000	hsa-miR-195-3p	9959214	9959221	8mer-1a	9959198	9959221	148	-10.36
CAediting_393	chr1_1167164_+	ENSG00000101558.12	ENST00000400000	hsa-miR-200b-3p	9958882	9958889	8mer-1a	9958868	9958889	140	-9.82
CAediting_393	chr1_1167164_+	ENSG00000101558.12	ENST00000400000	hsa-miR-200b-3p	9954930	9954936	7mer-m8	9954918	9954937	144	-8.07
CAediting_1368054	chr19_46709310_-	ENSG00000101558.12	ENST00000400000	hsa-miR-320e	9958191	9958198	8mer-1a	9958181	9958198	147	-14.02
CAediting_688080	chr9_63819626_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4477b	9956895	9956900	6mer	9956879	9956901	140	-11.82
CAediting_688081	chr9_63819627_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4477b	9956895	9956900	6mer	9956879	9956901	140	-11.82
CAediting_688080	chr9_63819626_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4477b	9959896	9959902	7mer-m8	9959878	9959903	155	-12.83
CAediting_688081	chr9_63819627_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4477b	9959896	9959902	7mer-m8	9959878	9959903	155	-12.83
CAediting_414656	chr5_72878640_+	ENSG00000101558.12	ENST00000400000	hsa-miR-4804-3p	9957763	9957770	8mer-1a	9957750	9957770	140	-9.21
CAediting_1229413	chr17_67471544_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9954496	9954503	8mer-1a	9954479	9954503	155	-11.66
CAediting_1229414	chr17_67471546_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9954496	9954503	8mer-1a	9954479	9954503	155	-11.66
CAediting_1229415	chr17_67471547_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9954496	9954503	8mer-1a	9954479	9954503	155	-11.66
CAediting_1229413	chr17_67471544_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9955171	9955178	8mer-1a	9955154	9955178	145	-6.07
CAediting_1229414	chr17_67471546_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9955171	9955178	8mer-1a	9955154	9955178	145	-6.07
CAediting_1229415	chr17_67471547_+	ENSG00000101558.12	ENST00000400000	hsa-miR-548aa	9955171	9955178	8mer-1a	9955154	9955178	145	-6.07
CAediting_117844	chr1_162342605_+	ENSG00000101558.12	ENST00000400000	hsa-miR-556-3p	9955304	9955310	7mer-m8	9955290	9955311	150	-10.72
CAediting_117844	chr1_162342605_+	ENSG00000101558.12	ENST00000400000	hsa-miR-556-3p	9956427	9956434	8mer-1a	9956413	9956434	147	-7.59
CAediting_228905	chr2_188297554_+	ENSG00000101558.12	ENST00000400000	hsa-miR-561-3p	9957677	9957684	8mer-1a	9957666	9957684	152	-6.78
CAediting_228905	chr2_188297554_+	ENSG00000101558.12	ENST00000400000	hsa-miR-561-3p	9959857	9959863	7mer-m8	9959845	9959864	149	-9.73
CAediting_524911	chr7_5495852_-	ENSG00000101558.12	ENST00000400000	hsa-miR-589-3p	9956940	9956947	8mer-1a	9956921	9956947	154	-14.98
CAediting_1351755	chr19_40282625_-	ENSG00000101558.12	ENST00000400000	hsa-miR-641	9959298	9959304	7mer-m8	9959282	9959305	148	-11.42
CAediting_468389	chr6_31355314_-	ENSG00000101558.12	ENST00000400000	hsa-miR-6891-5p	9954681	9954687	7mer-m8	9954670	9954688	148	-14.79

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for VAPA

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST

ENST type

RNA structure without RNA A-to-I editing.

RNA structure with RNA A-to-I editing.

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID

ENST

Editing_Position

MFE_withoneAI

MFE_withoutAI

MFE_withmultipleAI

Top

Relation with ADAR for VAPA

Correlation between ADAR gene expression and RNA editing frequency

Cancer

CAeditomID

position

ADAR1 (p-val)

ADAR1 (coeff.)

ADAR2 (p-val)

ADAR2 (coeff.)

ADAR3 (p-val)

ADAR3 (coeff.)

Top

Relation with cancer stages for VAPA

Correlation between Cancer stages and RNA editing frequency

Cancer

Stage_type

CAeditomID

position

P-val

Coeff.

Top

Relation with survival for VAPA

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for VAPA

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for VAPA

Diseases associated with this gene.
(DisGeNet 7.0)

Gene	Disease ID	Disease name	# pubmeds	Source
VAPA	C0005586	Bipolar Disorder	1	PSYGENET

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene