Home

Download

Statistics

Examples

Help

Contact

Editing gene: TNFRSF14 (CAeditome ID:8764)

Gene summary for TNFRSF14

Gene summary

Gene information	Gene symbol	TNFRSF14
	Gene ID	8764
	Gene name	TNF receptor superfamily member 14
	Synonyms	ATAR\|CD270\|HVEA\|HVEM\|LIGHTR\|TR2
	Cytomap	1p36.32
	Type of gene	protein-coding
	Description	tumor necrosis factor receptor superfamily member 14CD40-like proteinherpes virus entry mediator Atumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)tumor necrosis factor receptor-like gene2
	Modification date	20210518
	UniProtAcc	Q92956
	Context	- 30066919(Increased expression of TNFRSF14 indicates good prognosis and inhibits bladder cancer proliferation by promoting apoptosis)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
TNFRSF14	GO:0031295	Tumor necrosis factor receptor superfamily member 14	10754304
TNFRSF14	GO:1905675	Tumor necrosis factor receptor superfamily member 14	18193050
TNFRSF14	GO:0005886	Tumor necrosis factor receptor superfamily member 14	18193050

Top

RNA A-to-I events for TNFRSF14

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000157873.16

RNA A-to-I editing events in Cancer.

CAediting_3877(2561492, +), CAediting_3878(2561497, +), CAediting_3879(2561505, +), CAediting_3880(2561506, +), CAediting_3881(2561507, +), CAediting_3882(2561511, +), CAediting_3883(2561513, +), CAediting_3884(2561515, +), CAediting_3885(2561524, +), CAediting_3886(2561548, +), CAediting_3887(2561575, +), CAediting_3888(2561755, +), CAediting_3889(2561775, +), CAediting_3890(2561785, +), CAediting_3891(2561799, +), CAediting_3892(2561800, +), CAediting_3893(2561819, +), CAediting_3894(2561824, +), CAediting_3895(2561884, +), CAediting_3896(2561978, +), CAediting_3897(2562016, +), CAediting_3898(2562044, +), CAediting_3899(2562058, +), CAediting_3900(2562070, +), CAediting_3901(2564789, +), CAediting_3902(2564865, +), CAediting_3903(2564925, +), CAediting_3904(2565046, +), CAediting_3905(2565051, +), CAediting_3906(2565097, +), CAediting_3907(2565187, +), CAediting_3908(2565222, +), CAediting_3909(2565291, +), CAediting_3910(2565372, +),

Top

RNA editing positional annotations for TNFRSF14 using Annovar

Protein coding RNA editing(s).

CAeditome ID	Position	Variant type	ENST	NTchange	AAchange	SIFT_score	Polyphen2_HVAR_score	PROVEAN_pred
CAediting_3881	chr1_2561507_+	nonsynonymous SNV	ENST00000409119.4	c.A565G	p.S189G	D	.	N
CAediting_3882	chr1_2561511_+	nonsynonymous SNV	ENST00000409119.4	c.A569G	p.Q190R	D	.	N
CAediting_3883	chr1_2561513_+	nonsynonymous SNV	ENST00000409119.4	c.A571G	p.T191A	D	.	N
CAediting_3892	chr1_2561800_+	nonsynonymous SNV	ENST00000355716.4	c.A679G	p.R227G	D	B	N
CAediting_3892	chr1_2561800_+	nonsynonymous SNV	ENST00000434817.4	c.A679G	p.R227G	D	B	N
CAediting_3892	chr1_2561800_+	nonsynonymous SNV	ENST00000435221.5	c.A679G	p.R227G	D	B	N
CAediting_3892	chr1_2561800_+	nonsynonymous SNV	ENST00000451778.4	c.A679G	p.R227G	D	B	N

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_3877	chr1_2561492_+	ncRNA_exonic;splicing
CAediting_3878	chr1_2561497_+	exonic
CAediting_3879	chr1_2561505_+	exonic
CAediting_3880	chr1_2561506_+	exonic
CAediting_3881	chr1_2561507_+	exonic
CAediting_3882	chr1_2561511_+	exonic
CAediting_3883	chr1_2561513_+	exonic
CAediting_3884	chr1_2561515_+	exonic
CAediting_3885	chr1_2561524_+	exonic
CAediting_3886	chr1_2561548_+	ncRNA_exonic
CAediting_3887	chr1_2561575_+	ncRNA_exonic
CAediting_3888	chr1_2561755_+	exonic
CAediting_3889	chr1_2561775_+	exonic;splicing
CAediting_3890	chr1_2561785_+	exonic
CAediting_3891	chr1_2561799_+	exonic
CAediting_3892	chr1_2561800_+	exonic
CAediting_3893	chr1_2561819_+	ncRNA_exonic
CAediting_3894	chr1_2561824_+	ncRNA_exonic
CAediting_3895	chr1_2561884_+	ncRNA_exonic
CAediting_3896	chr1_2561978_+	ncRNA_exonic
CAediting_3897	chr1_2562016_+	ncRNA_exonic
CAediting_3898	chr1_2562044_+	ncRNA_exonic
CAediting_3899	chr1_2562058_+	ncRNA_exonic
CAediting_3900	chr1_2562070_+	ncRNA_exonic
CAediting_3901	chr1_2564789_+	intronic
CAediting_3902	chr1_2564865_+	intronic
CAediting_3903	chr1_2564925_+	intronic
CAediting_3904	chr1_2565046_+	intronic
CAediting_3905	chr1_2565051_+	splicing
CAediting_3906	chr1_2565097_+	UTR3
CAediting_3907	chr1_2565187_+	UTR3
CAediting_3908	chr1_2565222_+	UTR3
CAediting_3909	chr1_2565291_+	UTR3
CAediting_3910	chr1_2565372_+	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_3909	chr1_2565291_+	SINE	MIR	MIRb

Top

RNA A-to-I editing events in the alternative splicing sites for TNFRSF14

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
ES	CAediting_3877	chr1_2561492_+	2561473:2561495	3SS	0+1i	CTTCTCTCCACCTCCCCATAGCC	-11.41	CTTCTCTCCACCTCCCCATGGCC	-2.66
IR	CAediting_3877	chr1_2561492_+	2561473:2561495	3SS	0+1i	CTTCTCTCCACCTCCCCATAGCC	-11.41	CTTCTCTCCACCTCCCCATGGCC	-2.66
MEX_1	CAediting_3877	chr1_2561492_+	2561473:2561495	3SS	0+1i	CTTCTCTCCACCTCCCCATAGCC	-11.41	CTTCTCTCCACCTCCCCATGGCC	-2.66
ES	CAediting_3889	chr1_2561775_+	2561756:2561778	3SS	0+1i	TCGTCATTGTTTGCTCCACAGTT	-10.97	TCGTCATTGTTTGCTCCACGGTT	-2.22
IR	CAediting_3889	chr1_2561775_+	2561756:2561778	3SS	0+1i	TCGTCATTGTTTGCTCCACAGTT	-10.97	TCGTCATTGTTTGCTCCACGGTT	-2.22
MEX_2	CAediting_3889	chr1_2561775_+	2561756:2561778	3SS	0+1i	TCGTCATTGTTTGCTCCACAGTT	-10.97	TCGTCATTGTTTGCTCCACGGTT	-2.22
ES	CAediting_3893	chr1_2561819_+	2561813:2561821	5SS	0+4i	GGGGTGAGC	5.97	GGGGTGGGC	1.95
IR	CAediting_3893	chr1_2561819_+	2561813:2561821	5SS	0+4i	GGGGTGAGC	5.97	GGGGTGGGC	1.95
MEX_2	CAediting_3893	chr1_2561819_+	2561813:2561821	5SS	0+4i	GGGGTGAGC	5.97	GGGGTGGGC	1.95

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000157873.16.TNFRSF14.

Correlation between RNA A-to-I editing and PSI for ENSG00000157873.16.TNFRSF14.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for TNFRSF14

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for TNFRSF14

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for TNFRSF14

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-6781-5p	2561545	2561552	8mer-1a	2561528	2561552	149.00	-25.46
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-1915-3p	2565091	2565098	8mer-1a	2565079	2565098	154.00	-21.81
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-4713-5p	2565094	2565101	8mer-1a	2565080	2565101	140.00	-18.13
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-629-3p	2565095	2565102	8mer-1a	2565082	2565102	152.00	-20.14
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-6764-5p	2565091	2565098	8mer-1a	2565075	2565098	146.00	-24.04
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-7113-5p	2565090	2565096	7mer-m8	2565077	2565097	147.00	-23.77
CAediting_3907	chr1_2565187_+	ENSG00000157873.16	ENST00000482602	hsa-miR-11401	2565183	2565188	6mer	2565171	2565189	144.00	-28.48
CAediting_3907	chr1_2565187_+	ENSG00000157873.16	ENST00000482602	hsa-miR-662	2565184	2565191	8mer-1a	2565170	2565191	162.00	-31.82
CAediting_3908	chr1_2565222_+	ENSG00000157873.16	ENST00000482602	hsa-miR-128-1-5p	2565220	2565227	8mer-1a	2565202	2565227	146.00	-22.94
CAediting_3908	chr1_2565222_+	ENSG00000157873.16	ENST00000482602	hsa-miR-128-2-5p	2565220	2565227	8mer-1a	2565207	2565227	148.00	-23.03
CAediting_3908	chr1_2565222_+	ENSG00000157873.16	ENST00000482602	hsa-miR-6877-5p	2565219	2565225	7mer-m8	2565201	2565226	146.00	-28.60
CAediting_3887	chr1_2561575_+	ENSG00000157873.16	ENST00000409119	hsa-miR-885-3p	2561573	2561579	7mer-m8	2561560	2561580	150.00	-23.80

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-138-5p	2561543	2561549	7mer-m8	2561529	2561550	150	-21.41
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-138-5p	2561543	2561549	7mer-m8	2561529	2561550	150	-21.41
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-1587	2561546	2561552	7mer-m8	2561533	2561553	148	-23.12
CAediting_3887	chr1_2561575_+	ENSG00000157873.16	ENST00000409119	hsa-miR-34a-5p	2561573	2561579	7mer-m8	2561559	2561580	140	-18.1
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-3620-5p	2561546	2561552	7mer-m8	2561530	2561553	155	-25.97
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-4492	2561545	2561552	8mer-1a	2561536	2561552	145	-22.56
CAediting_3886	chr1_2561548_+	ENSG00000157873.16	ENST00000409119	hsa-miR-4498	2561545	2561552	8mer-1a	2561533	2561552	145	-25.18
CAediting_3887	chr1_2561575_+	ENSG00000157873.16	ENST00000409119	hsa-miR-449a	2561573	2561579	7mer-m8	2561561	2561580	144	-15.33
CAediting_3887	chr1_2561575_+	ENSG00000157873.16	ENST00000409119	hsa-miR-449b-5p	2561573	2561579	7mer-m8	2561561	2561580	144	-16.65
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-12128	2565090	2565096	7mer-m8	2565073	2565097	150	-17.9
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-1266-5p	2565091	2565098	8mer-1a	2565076	2565098	140	-16.22
CAediting_3909	chr1_2565291_+	ENSG00000157873.16	ENST00000482602	hsa-miR-4252	2565290	2565296	7mer-1a	2565278	2565296	147	-25.85
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-4518	2565091	2565098	8mer-1a	2565073	2565098	151	-18.51
CAediting_3907	chr1_2565187_+	ENSG00000157873.16	ENST00000482602	hsa-miR-4716-5p	2565184	2565189	6mer	2565169	2565190	144	-25.51
CAediting_3908	chr1_2565222_+	ENSG00000157873.16	ENST00000482602	hsa-miR-4758-5p	2565216	2565221	6mer	2565200	2565222	154	-35.45
CAediting_3910	chr1_2565372_+	ENSG00000157873.16	ENST00000482602	hsa-miR-6780a-3p	2565371	2565376	6mer	2565357	2565377	147	-28.99
CAediting_3906	chr1_2565097_+	ENSG00000157873.16	ENST00000482602	hsa-miR-6833-3p	2565095	2565102	8mer-1a	2565080	2565102	141	-18.54
CAediting_3908	chr1_2565222_+	ENSG00000157873.16	ENST00000482602	hsa-miR-8077	2565217	2565223	7mer-m8	2565204	2565224	155	-25.82

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_688080	chr9_63819626_+	ENSG00000157873.16	ENST00000355716	hsa-miR-4477b	2563821	2563828	8mer-1a	2563807	2563828	150	-9.96
CAediting_1054808	chr15_66496985_-	ENSG00000157873.16	ENST00000355716	hsa-miR-4512	2563420	2563425	6mer	2563404	2563426	147	-30.14
CAediting_1054808	chr15_66496985_-	ENSG00000157873.16	ENST00000355716	hsa-miR-4512	2563642	2563648	7mer-m8	2563626	2563649	142	-27.71
CAediting_580943	chr7_100356700_+	ENSG00000157873.16	ENST00000482602	hsa-miR-6840-3p	2565271	2565277	7mer-m8	2565257	2565278	151	-23.57

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_580943	chr7_100356700_+	ENSG00000157873.16	ENST00000355716	hsa-miR-6840-3p	2563570	2563576	7mer-m8	2563553	2563577	151	-28.26

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for TNFRSF14

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST	ENST type	RNA structure without RNA A-to-I editing.	RNA structure with RNA A-to-I editing.
ENST00000355716.4	protein_coding
ENST00000409119.4	protein_coding
ENST00000434817.4	protein_coding
ENST00000435221.5	protein_coding
ENST00000451778.4	protein_coding
ENST00000463471.5	retained_intron
ENST00000463835.4	retained_intron
ENST00000466750.4	retained_intron
ENST00000471768.1	retained_intron
ENST00000475523.4	retained_intron
ENST00000482602.5	protein_coding
ENST00000496064.4	retained_intron
ENST00000480305.1	processed_transcript

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID	ENST	Editing_Position	MFE_withoneAI	MFE_withoutAI	MFE_withmultipleAI
CAediting_3888	ENST00000355716.4	chr1_2561755_+	-725.60	-726.70	-727.40
CAediting_3889	ENST00000355716.4	chr1_2561775_+	-726.90	-726.70	-727.40
CAediting_3890	ENST00000355716.4	chr1_2561785_+	-728.70	-726.70	-727.40
CAediting_3891	ENST00000355716.4	chr1_2561799_+	-727.70	-726.70	-727.40
CAediting_3892	ENST00000355716.4	chr1_2561800_+	-727.10	-726.70	-727.40
CAediting_3878	ENST00000409119.4	chr1_2561497_+	-396.80	-396.00	-405.40
CAediting_3879	ENST00000409119.4	chr1_2561505_+	-396.00	-396.00	-405.40
CAediting_3880	ENST00000409119.4	chr1_2561506_+	-396.00	-396.00	-405.40
CAediting_3881	ENST00000409119.4	chr1_2561507_+	-399.60	-396.00	-405.40
CAediting_3882	ENST00000409119.4	chr1_2561511_+	-396.40	-396.00	-405.40
CAediting_3883	ENST00000409119.4	chr1_2561513_+	-395.40	-396.00	-405.40
CAediting_3884	ENST00000409119.4	chr1_2561515_+	-394.60	-396.00	-405.40
CAediting_3885	ENST00000409119.4	chr1_2561524_+	-402.60	-396.00	-405.40
CAediting_3886	ENST00000409119.4	chr1_2561548_+	-395.30	-396.00	-405.40
CAediting_3887	ENST00000409119.4	chr1_2561575_+	-396.00	-396.00	-405.40
CAediting_3888	ENST00000434817.4	chr1_2561755_+	-356.90	-357.60	-358.70
CAediting_3889	ENST00000434817.4	chr1_2561775_+	-356.10	-357.60	-358.70
CAediting_3890	ENST00000434817.4	chr1_2561785_+	-360.30	-357.60	-358.70
CAediting_3891	ENST00000434817.4	chr1_2561799_+	-357.60	-357.60	-358.70
CAediting_3892	ENST00000434817.4	chr1_2561800_+	-357.60	-357.60	-358.70
CAediting_3888	ENST00000435221.5	chr1_2561755_+	-544.70	-544.90	-548.60
CAediting_3889	ENST00000435221.5	chr1_2561775_+	-546.70	-544.90	-548.60
CAediting_3890	ENST00000435221.5	chr1_2561785_+	-545.50	-544.90	-548.60
CAediting_3891	ENST00000435221.5	chr1_2561799_+	-545.90	-544.90	-548.60
CAediting_3892	ENST00000435221.5	chr1_2561800_+	-545.90	-544.90	-548.60
CAediting_3888	ENST00000451778.4	chr1_2561755_+	-344.70	-345.40	-346.60
CAediting_3889	ENST00000451778.4	chr1_2561775_+	-344.90	-345.40	-346.60
CAediting_3890	ENST00000451778.4	chr1_2561785_+	-348.10	-345.40	-346.60
CAediting_3891	ENST00000451778.4	chr1_2561799_+	-347.00	-345.40	-346.60
CAediting_3892	ENST00000451778.4	chr1_2561800_+	-345.10	-345.40	-346.60
CAediting_3878	ENST00000463471.5	chr1_2561497_+	-1988.70	-1988.40	-2023.70
CAediting_3879	ENST00000463471.5	chr1_2561505_+	-1991.50	-1988.40	-2023.70
CAediting_3880	ENST00000463471.5	chr1_2561506_+	-1989.40	-1988.40	-2023.70
CAediting_3881	ENST00000463471.5	chr1_2561507_+	-1991.30	-1988.40	-2023.70
CAediting_3882	ENST00000463471.5	chr1_2561511_+	-1991.70	-1988.40	-2023.70
CAediting_3883	ENST00000463471.5	chr1_2561513_+	-1991.70	-1988.40	-2023.70
CAediting_3884	ENST00000463471.5	chr1_2561515_+	-1988.40	-1988.40	-2023.70
CAediting_3885	ENST00000463471.5	chr1_2561524_+	-1994.10	-1988.40	-2023.70
CAediting_3886	ENST00000463471.5	chr1_2561548_+	-1987.70	-1988.40	-2023.70
CAediting_3887	ENST00000463471.5	chr1_2561575_+	-1988.40	-1988.40	-2023.70
CAediting_3888	ENST00000463471.5	chr1_2561755_+	-1992.90	-1988.40	-2023.70
CAediting_3889	ENST00000463471.5	chr1_2561775_+	-1989.80	-1988.40	-2023.70
CAediting_3890	ENST00000463471.5	chr1_2561785_+	-1991.10	-1988.40	-2023.70
CAediting_3891	ENST00000463471.5	chr1_2561799_+	-1989.70	-1988.40	-2023.70
CAediting_3892	ENST00000463471.5	chr1_2561800_+	-1988.70	-1988.40	-2023.70
CAediting_3893	ENST00000463471.5	chr1_2561819_+	-1990.80	-1988.40	-2023.70
CAediting_3894	ENST00000463471.5	chr1_2561824_+	-1991.10	-1988.40	-2023.70
CAediting_3895	ENST00000463471.5	chr1_2561884_+	-1990.70	-1988.40	-2023.70
CAediting_3896	ENST00000463471.5	chr1_2561978_+	-1990.00	-1988.40	-2023.70
CAediting_3897	ENST00000463471.5	chr1_2562016_+	-1991.50	-1988.40	-2023.70
CAediting_3898	ENST00000463471.5	chr1_2562044_+	-1992.90	-1988.40	-2023.70
CAediting_3899	ENST00000463471.5	chr1_2562058_+	-1988.70	-1988.40	-2023.70
CAediting_3900	ENST00000463471.5	chr1_2562070_+	-1989.00	-1988.40	-2023.70
CAediting_3878	ENST00000463835.4	chr1_2561497_+	-386.90	-386.10	-401.20
CAediting_3879	ENST00000463835.4	chr1_2561505_+	-386.10	-386.10	-401.20
CAediting_3880	ENST00000463835.4	chr1_2561506_+	-386.10	-386.10	-401.20
CAediting_3881	ENST00000463835.4	chr1_2561507_+	-389.70	-386.10	-401.20
CAediting_3882	ENST00000463835.4	chr1_2561511_+	-386.50	-386.10	-401.20
CAediting_3883	ENST00000463835.4	chr1_2561513_+	-386.60	-386.10	-401.20
CAediting_3884	ENST00000463835.4	chr1_2561515_+	-385.40	-386.10	-401.20
CAediting_3885	ENST00000463835.4	chr1_2561524_+	-392.70	-386.10	-401.20
CAediting_3886	ENST00000463835.4	chr1_2561548_+	-385.40	-386.10	-401.20
CAediting_3887	ENST00000463835.4	chr1_2561575_+	-389.20	-386.10	-401.20
CAediting_3888	ENST00000463835.4	chr1_2561755_+	-387.00	-386.10	-401.20
CAediting_3889	ENST00000463835.4	chr1_2561775_+	-387.20	-386.10	-401.20
CAediting_3890	ENST00000463835.4	chr1_2561785_+	-386.70	-386.10	-401.20
CAediting_3891	ENST00000463835.4	chr1_2561799_+	-387.10	-386.10	-401.20
CAediting_3892	ENST00000463835.4	chr1_2561800_+	-386.50	-386.10	-401.20
CAediting_3888	ENST00000466750.4	chr1_2561755_+	-1180.80	-1179.10	-1186.40
CAediting_3889	ENST00000466750.4	chr1_2561775_+	-1183.10	-1179.10	-1186.40
CAediting_3890	ENST00000466750.4	chr1_2561785_+	-1179.10	-1179.10	-1186.40
CAediting_3891	ENST00000466750.4	chr1_2561799_+	-1179.70	-1179.10	-1186.40
CAediting_3892	ENST00000466750.4	chr1_2561800_+	-1181.30	-1179.10	-1186.40
CAediting_3878	ENST00000471768.1	chr1_2561497_+	-226.00	-225.20	-238.00
CAediting_3879	ENST00000471768.1	chr1_2561505_+	-225.20	-225.20	-238.00
CAediting_3880	ENST00000471768.1	chr1_2561506_+	-225.20	-225.20	-238.00
CAediting_3881	ENST00000471768.1	chr1_2561507_+	-228.80	-225.20	-238.00
CAediting_3882	ENST00000471768.1	chr1_2561511_+	-225.60	-225.20	-238.00
CAediting_3883	ENST00000471768.1	chr1_2561513_+	-224.60	-225.20	-238.00
CAediting_3884	ENST00000471768.1	chr1_2561515_+	-224.40	-225.20	-238.00
CAediting_3885	ENST00000471768.1	chr1_2561524_+	-231.80	-225.20	-238.00
CAediting_3888	ENST00000475523.4	chr1_2561755_+	-736.70	-734.90	-742.20
CAediting_3889	ENST00000475523.4	chr1_2561775_+	-738.90	-734.90	-742.20
CAediting_3890	ENST00000475523.4	chr1_2561785_+	-736.40	-734.90	-742.20
CAediting_3891	ENST00000475523.4	chr1_2561799_+	-735.50	-734.90	-742.20
CAediting_3892	ENST00000475523.4	chr1_2561800_+	-737.10	-734.90	-742.20
CAediting_3890	ENST00000482602.5	chr1_2561785_+	-186.30	-185.70	-192.70
CAediting_3891	ENST00000482602.5	chr1_2561799_+	-186.70	-185.70	-192.70
CAediting_3892	ENST00000482602.5	chr1_2561800_+	-186.20	-185.70	-192.70
CAediting_3906	ENST00000482602.5	chr1_2565097_+	-186.70	-185.70	-192.70
CAediting_3907	ENST00000482602.5	chr1_2565187_+	-188.20	-185.70	-192.70
CAediting_3908	ENST00000482602.5	chr1_2565222_+	-185.00	-185.70	-192.70
CAediting_3909	ENST00000482602.5	chr1_2565291_+	-185.70	-185.70	-192.70
CAediting_3910	ENST00000482602.5	chr1_2565372_+	-189.60	-185.70	-192.70
CAediting_3877	ENST00000496064.4	chr1_2561492_+	-616.20	-614.10	-632.60
CAediting_3878	ENST00000496064.4	chr1_2561497_+	-616.80	-614.10	-632.60
CAediting_3879	ENST00000496064.4	chr1_2561505_+	-616.90	-614.10	-632.60
CAediting_3880	ENST00000496064.4	chr1_2561506_+	-616.80	-614.10	-632.60
CAediting_3881	ENST00000496064.4	chr1_2561507_+	-617.40	-614.10	-632.60
CAediting_3882	ENST00000496064.4	chr1_2561511_+	-614.90	-614.10	-632.60
CAediting_3883	ENST00000496064.4	chr1_2561513_+	-615.70	-614.10	-632.60
CAediting_3884	ENST00000496064.4	chr1_2561515_+	-614.52	-614.10	-632.60
CAediting_3885	ENST00000496064.4	chr1_2561524_+	-615.42	-614.10	-632.60
CAediting_3893	ENST00000480305.1	chr1_2561819_+	-227.20	-224.80	-229.30
CAediting_3894	ENST00000480305.1	chr1_2561824_+	-224.80	-224.80	-229.30
CAediting_3895	ENST00000480305.1	chr1_2561884_+	-226.90	-224.80	-229.30

Top

Relation with ADAR for TNFRSF14

Correlation between ADAR gene expression and RNA editing frequency

Cancer

CAeditomID

position

ADAR1 (p-val)

ADAR1 (coeff.)

ADAR2 (p-val)

ADAR2 (coeff.)

ADAR3 (p-val)

ADAR3 (coeff.)

Top

Relation with cancer stages for TNFRSF14

Correlation between Cancer stages and RNA editing frequency

Cancer

Stage_type

CAeditomID

position

P-val

Coeff.

Top

Relation with survival for TNFRSF14

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for TNFRSF14

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for TNFRSF14

Diseases associated with this gene.
(DisGeNet 7.0)

Gene	Disease ID	Disease name	# pubmeds	Source
TNFRSF14	C0003873	Rheumatoid Arthritis	1	CTD_human
TNFRSF14	C0007570	Celiac Disease	1	CTD_human

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene