Home

Download

Statistics

Examples

Help

Contact

Editing gene: LAMTOR3 (CAeditome ID:8649)

Gene summary for LAMTOR3

Gene summary

Gene information	Gene symbol	LAMTOR3
	Gene ID	8649
	Gene name	late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
	Synonyms	MAP2K1IP1\|MAPBP\|MAPKSP1\|MP1\|PRO0633\|Ragulator3
	Cytomap	4q23
	Type of gene	protein-coding
	Description	ragulator complex protein LAMTOR3MAPK scaffold protein 1MEK binding partner 1late endosomal/lysosomal adaptor and MAPK and MTOR activator 3mitogen-activated protein kinase kinase 1 interacting protein 1mitogen-activated protein kinase scaffold protei
	Modification date	20210518
	UniProtAcc	Q9UHA4
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
LAMTOR3	GO:0005085	Ragulator complex protein LAMTOR3	22980980
LAMTOR3	GO:0060090	Ragulator complex protein LAMTOR3	22980980
LAMTOR3	GO:0071986	Ragulator complex protein LAMTOR3	20381137

Top

RNA A-to-I events for LAMTOR3

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000109270.11

RNA A-to-I editing events in Cancer.

CAediting_377723(99879758, -), CAediting_377724(99879821, -), CAediting_377725(99880342, -), CAediting_377726(99880347, -), CAediting_377727(99880348, -), CAediting_377728(99880349, -), CAediting_377729(99880350, -), CAediting_377730(99880410, -), CAediting_377731(99880417, -), CAediting_377732(99880421, -), CAediting_377733(99880427, -), CAediting_377734(99880430, -), CAediting_377735(99880436, -), CAediting_377736(99880445, -), CAediting_377737(99880446, -), CAediting_377738(99880453, -), CAediting_377739(99880471, -), CAediting_377740(99880481, -), CAediting_377741(99880500, -), CAediting_377742(99880511, -), CAediting_377743(99880546, -), CAediting_377744(99880549, -), CAediting_377745(99880563, -), CAediting_377746(99880588, -), CAediting_377747(99880590, -), CAediting_377748(99880592, -), CAediting_377749(99880594, -), CAediting_377750(99880742, -), CAediting_377751(99880960, -), CAediting_377752(99880961, -), CAediting_377753(99880962, -), CAediting_377754(99880965, -), CAediting_377755(99880966, -), CAediting_377756(99880990, -), CAediting_377757(99880993, -), CAediting_377758(99881007, -), CAediting_377759(99881012, -), CAediting_377760(99881023, -), CAediting_377761(99881027, -), CAediting_377762(99881043, -), CAediting_377763(99881044, -),

Top

RNA editing positional annotations for LAMTOR3 using Annovar

Protein coding RNA editing(s).

CAeditome ID

Position

Variant type

ENST

NTchange

AAchange

SIFT_score

Polyphen2_HVAR_score

PROVEAN_pred

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_377723	chr4_99879758_-	UTR3
CAediting_377724	chr4_99879821_-	UTR3
CAediting_377725	chr4_99880342_-	UTR3
CAediting_377726	chr4_99880347_-	UTR3
CAediting_377727	chr4_99880348_-	UTR3
CAediting_377728	chr4_99880349_-	UTR3
CAediting_377729	chr4_99880350_-	UTR3
CAediting_377730	chr4_99880410_-	UTR3
CAediting_377731	chr4_99880417_-	UTR3
CAediting_377732	chr4_99880421_-	UTR3
CAediting_377733	chr4_99880427_-	UTR3
CAediting_377734	chr4_99880430_-	UTR3
CAediting_377735	chr4_99880436_-	UTR3
CAediting_377736	chr4_99880445_-	UTR3
CAediting_377737	chr4_99880446_-	UTR3
CAediting_377738	chr4_99880453_-	UTR3
CAediting_377739	chr4_99880471_-	UTR3
CAediting_377740	chr4_99880481_-	UTR3
CAediting_377741	chr4_99880500_-	UTR3
CAediting_377742	chr4_99880511_-	UTR3
CAediting_377743	chr4_99880546_-	UTR3
CAediting_377744	chr4_99880549_-	UTR3
CAediting_377745	chr4_99880563_-	UTR3
CAediting_377746	chr4_99880588_-	UTR3
CAediting_377747	chr4_99880590_-	UTR3
CAediting_377748	chr4_99880592_-	UTR3
CAediting_377749	chr4_99880594_-	UTR3
CAediting_377750	chr4_99880742_-	UTR3
CAediting_377751	chr4_99880960_-	UTR3
CAediting_377752	chr4_99880961_-	UTR3
CAediting_377753	chr4_99880962_-	UTR3
CAediting_377754	chr4_99880965_-	UTR3
CAediting_377755	chr4_99880966_-	UTR3
CAediting_377756	chr4_99880990_-	UTR3
CAediting_377757	chr4_99880993_-	UTR3
CAediting_377758	chr4_99881007_-	UTR3
CAediting_377759	chr4_99881012_-	UTR3
CAediting_377760	chr4_99881023_-	UTR3
CAediting_377761	chr4_99881027_-	UTR3
CAediting_377762	chr4_99881043_-	UTR3
CAediting_377763	chr4_99881044_-	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_377723	chr4_99879758_-	DNA	TcMar-Tigger	Tigger3c
CAediting_377724	chr4_99879821_-	DNA	TcMar-Tigger	Tigger3c
CAediting_377725	chr4_99880342_-	SINE	Alu	AluSz
CAediting_377726	chr4_99880347_-	SINE	Alu	AluSz
CAediting_377727	chr4_99880348_-	SINE	Alu	AluSz
CAediting_377728	chr4_99880349_-	SINE	Alu	AluSz
CAediting_377729	chr4_99880350_-	SINE	Alu	AluSz
CAediting_377730	chr4_99880410_-	SINE	Alu	AluSz
CAediting_377731	chr4_99880417_-	SINE	Alu	AluSz
CAediting_377732	chr4_99880421_-	SINE	Alu	AluSz
CAediting_377733	chr4_99880427_-	SINE	Alu	AluSz
CAediting_377734	chr4_99880430_-	SINE	Alu	AluSz
CAediting_377735	chr4_99880436_-	SINE	Alu	AluSz
CAediting_377736	chr4_99880445_-	SINE	Alu	AluSz
CAediting_377737	chr4_99880446_-	SINE	Alu	AluSz
CAediting_377738	chr4_99880453_-	SINE	Alu	AluSz
CAediting_377739	chr4_99880471_-	SINE	Alu	AluSz
CAediting_377740	chr4_99880481_-	SINE	Alu	AluSz
CAediting_377741	chr4_99880500_-	SINE	Alu	AluSz
CAediting_377742	chr4_99880511_-	SINE	Alu	AluSz
CAediting_377743	chr4_99880546_-	SINE	Alu	AluSz
CAediting_377744	chr4_99880549_-	SINE	Alu	AluSz
CAediting_377745	chr4_99880563_-	SINE	Alu	AluSz
CAediting_377746	chr4_99880588_-	SINE	Alu	AluSz
CAediting_377747	chr4_99880590_-	SINE	Alu	AluSz
CAediting_377748	chr4_99880592_-	SINE	Alu	AluSz
CAediting_377749	chr4_99880594_-	SINE	Alu	AluSz
CAediting_377750	chr4_99880742_-	DNA	hAT-Tip100	MER91C
CAediting_377751	chr4_99880960_-	SINE	Alu	AluYj4
CAediting_377752	chr4_99880961_-	SINE	Alu	AluYj4
CAediting_377753	chr4_99880962_-	SINE	Alu	AluYj4
CAediting_377754	chr4_99880965_-	SINE	Alu	AluYj4
CAediting_377755	chr4_99880966_-	SINE	Alu	AluYj4
CAediting_377756	chr4_99880990_-	SINE	Alu	AluYj4
CAediting_377757	chr4_99880993_-	SINE	Alu	AluYj4
CAediting_377758	chr4_99881007_-	SINE	Alu	AluYj4
CAediting_377759	chr4_99881012_-	SINE	Alu	AluYj4
CAediting_377760	chr4_99881023_-	SINE	Alu	AluYj4
CAediting_377761	chr4_99881027_-	SINE	Alu	AluYj4

Top

RNA A-to-I editing events in the alternative splicing sites for LAMTOR3

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
IR	CAediting_377723	chr4_99879758_-	99879745:99879767	3SS	0+11i	GGCTATACCATATAGCCTAGGTG	-0.21	GGCTATACCGTATAGCCTAGGTG	0.55
IR	CAediting_377724	chr4_99879821_-	99879808:99879830	3SS	0+11i	GGCTATACCATATAGCCTAGGTG	-0.21	GGCTATACCGTATAGCCTAGGTG	0.55

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000109270.11.LAMTOR3.

Correlation between RNA A-to-I editing and PSI for ENSG00000109270.11.LAMTOR3.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for LAMTOR3

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

GBM.CAediting_377747.ENSG00000109270.LAMTOR3.png
Soverview

Top

Protein coding region RNA A-to-I editings for LAMTOR3

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for LAMTOR3

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-340-3p	99880588	99880595	8mer-1a	99880588	99880607	142.00	-16.23
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6827-3p	99880588	99880595	8mer-1a	99880588	99880608	150.00	-16.90
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-384	99880739	99880745	7mer-m8	99880738	99880756	168.00	-15.72
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-516a-3p	99880736	99880743	8mer-1a	99880736	99880753	140.00	-15.22
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-516a-3p	99880736	99880743	8mer-1a	99880736	99880753	140.00	-15.22
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-516b-3p	99880736	99880743	8mer-1a	99880736	99880753	140.00	-15.22
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-516b-3p	99880736	99880743	8mer-1a	99880736	99880753	140.00	-15.22
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7162-5p	99880736	99880743	8mer-1a	99880736	99880753	140.00	-12.92
CAediting_377755	chr4_99880966_-	ENSG00000109270.11	ENST00000499666	hsa-miR-130a-5p	99880963	99880970	8mer-1a	99880963	99880984	145.00	-8.59
CAediting_377755	chr4_99880966_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4753-3p	99880962	99880969	8mer-1a	99880962	99880983	144.00	-8.40
CAediting_377755	chr4_99880966_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6809-3p	99880961	99880968	8mer-1a	99880961	99880981	148.00	-6.29
CAediting_377723	chr4_99879758_-	ENSG00000109270.11	ENST00000499666	hsa-let-7e-3p	99879754	99879760	7mer-m8	99879753	99879775	147.00	-18.67
CAediting_377724	chr4_99879821_-	ENSG00000109270.11	ENST00000499666	hsa-let-7e-3p	99879817	99879823	7mer-m8	99879816	99879838	147.00	-18.67
CAediting_377725	chr4_99880342_-	ENSG00000109270.11	ENST00000499666	hsa-miR-338-3p	99880341	99880347	7mer-m8	99880340	99880361	140.00	-15.44
CAediting_377725	chr4_99880342_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4310	99880342	99880348	7mer-m8	99880341	99880356	140.00	-8.38
CAediting_377725	chr4_99880342_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7157-5p	99880342	99880348	7mer-m8	99880341	99880363	157.00	-22.97
CAediting_377725	chr4_99880342_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7977	99880339	99880345	7mer-m8	99880338	99880355	140.00	-12.35
CAediting_377728	chr4_99880349_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4314	99880347	99880354	8mer-1a	99880347	99880364	140.00	-13.88
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6771-5p	99880348	99880355	8mer-1a	99880348	99880367	157.00	-29.01
CAediting_377730	chr4_99880410_-	ENSG00000109270.11	ENST00000499666	hsa-miR-433-5p	99880409	99880415	7mer-m8	99880408	99880431	167.00	-28.70
CAediting_377731	chr4_99880417_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4680-5p	99880413	99880419	7mer-1a	99880413	99880436	143.00	-13.76
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-340-3p	99880420	99880426	7mer-m8	99880419	99880440	149.00	-17.13
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6827-3p	99880420	99880426	7mer-m8	99880419	99880439	153.00	-17.53
CAediting_377733	chr4_99880427_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6509-3p	99880425	99880430	6mer	99880424	99880445	143.00	-13.09
CAediting_377735	chr4_99880436_-	ENSG00000109270.11	ENST00000499666	hsa-miR-8485	99880435	99880441	7mer-m8	99880434	99880454	142.00	-9.40
CAediting_377736	chr4_99880445_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4686	99880443	99880448	6mer	99880442	99880464	145.00	-21.47
CAediting_377736	chr4_99880445_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4727-5p	99880444	99880450	7mer-m8	99880443	99880463	151.00	-17.08
CAediting_377736	chr4_99880445_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4762-5p	99880440	99880446	7mer-m8	99880439	99880457	143.00	-10.03
CAediting_377737	chr4_99880446_-	ENSG00000109270.11	ENST00000499666	hsa-miR-10a-3p	99880441	99880447	7mer-m8	99880440	99880460	143.00	-14.91
CAediting_377740	chr4_99880481_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4457	99880481	99880487	7mer-m8	99880480	99880499	153.00	-17.97
CAediting_377740	chr4_99880481_-	ENSG00000109270.11	ENST00000499666	hsa-miR-449b-3p	99880478	99880484	7mer-m8	99880477	99880498	145.00	-15.09
CAediting_377740	chr4_99880481_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4691-3p	99880477	99880483	7mer-m8	99880476	99880497	162.00	-29.55
CAediting_377744	chr4_99880549_-	ENSG00000109270.11	ENST00000499666	hsa-miR-122-3p	99880548	99880553	6mer	99880547	99880568	145.00	-19.41
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-10a-5p	99880586	99880592	7mer-m8	99880585	99880607	141.00	-12.89
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-10b-5p	99880586	99880592	7mer-m8	99880585	99880607	140.00	-11.43
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-339-5p	99880587	99880593	7mer-m8	99880586	99880609	148.00	-17.37
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3667-5p	99880583	99880589	7mer-m8	99880582	99880608	147.00	-17.19
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4725-5p	99880585	99880591	7mer-m8	99880584	99880604	140.00	-16.29
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-504-5p	99880585	99880591	7mer-m8	99880584	99880604	146.00	-18.45
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5699-3p	99880588	99880594	7mer-m8	99880587	99880608	146.00	-16.68
CAediting_377748	chr4_99880592_-	ENSG00000109270.11	ENST00000499666	hsa-miR-2682-3p	99880590	99880597	8mer-1a	99880590	99880611	143.00	-9.76
CAediting_377748	chr4_99880592_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5001-3p	99880588	99880594	7mer-m8	99880587	99880608	150.00	-17.80
CAediting_377748	chr4_99880592_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6781-3p	99880590	99880597	8mer-1a	99880590	99880611	140.00	-12.50
CAediting_377752	chr4_99880961_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6809-3p	99880956	99880963	8mer-1a	99880956	99880976	152.00	-11.19
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-130a-5p	99880961	99880968	8mer-1a	99880961	99880982	145.00	-8.51
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4659a-3p	99880956	99880963	8mer-1a	99880956	99880977	141.00	-9.41
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4659b-3p	99880956	99880963	8mer-1a	99880956	99880977	141.00	-9.41
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4753-3p	99880960	99880967	8mer-1a	99880960	99880980	149.00	-9.01
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6809-3p	99880960	99880966	7mer-m8	99880959	99880979	148.00	-10.88
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-942-5p	99880958	99880965	8mer-1a	99880958	99880979	162.00	-16.89
CAediting_377760	chr4_99881023_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4638-5p	99881020	99881027	8mer-1a	99881020	99881041	148.00	-18.83
CAediting_377762	chr4_99881043_-	ENSG00000109270.11	ENST00000499666	hsa-miR-103a-1-5p	99881042	99881048	7mer-m8	99881041	99881064	153.00	-18.66
CAediting_377762	chr4_99881043_-	ENSG00000109270.11	ENST00000499666	hsa-miR-103a-2-5p	99881042	99881048	7mer-m8	99881041	99881064	153.00	-14.81
CAediting_377762	chr4_99881043_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6815-3p	99881041	99881047	7mer-m8	99881040	99881060	154.00	-14.96
CAediting_377743	chr4_99880546_-	ENSG00000109270.11	ENST00000499666	hsa-miR-548ao-3p	99880542	99880547	6mer	99880541	99880561	150.00	-24.93
CAediting_377743	chr4_99880546_-	ENSG00000109270.11	ENST00000499666	hsa-miR-591	99880544	99880550	7mer-m8	99880543	99880560	143.00	-19.82
CAediting_377743	chr4_99880546_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6502-3p	99880543	99880549	7mer-m8	99880542	99880562	147.00	-13.72
CAediting_377743	chr4_99880546_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6872-3p	99880546	99880552	7mer-m8	99880545	99880564	152.00	-22.43
CAediting_377763	chr4_99881044_-	ENSG00000109270.11	ENST00000499666	hsa-miR-130a-5p	99881043	99881050	8mer-1a	99881043	99881063	148.00	-11.93
CAediting_377763	chr4_99881044_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4753-3p	99881043	99881049	7mer-m8	99881042	99881062	148.00	-10.80

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-103a-1-5p	99880736	99880743	8mer-1a	99880736	99880757	153	-15
CAediting_377750	chr4_99880742_-	ENSG00000109270.11	ENST00000499666	hsa-miR-103a-2-5p	99880736	99880743	8mer-1a	99880736	99880757	153	-13.69
CAediting_377740	chr4_99880481_-	ENSG00000109270.11	ENST00000499666	hsa-miR-187-5p	99880479	99880485	7mer-m8	99880478	99880499	148	-18.54
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-30b-3p	99880349	99880356	8mer-1a	99880349	99880370	147	-15.63
CAediting_377758	chr4_99881007_-	ENSG00000109270.11	ENST00000499666	hsa-miR-342-5p	99881002	99881009	8mer-1a	99881002	99881023	142	-16.29
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3664-5p	99880586	99880592	7mer-m8	99880585	99880606	151	-15.54
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3664-5p	99880586	99880592	7mer-m8	99880585	99880606	151	-15.54
CAediting_377756	chr4_99880990_-	ENSG00000109270.11	ENST00000499666	hsa-miR-367-5p	99880988	99880995	8mer-1a	99880988	99881009	143	-12.18
CAediting_377757	chr4_99880993_-	ENSG00000109270.11	ENST00000499666	hsa-miR-367-5p	99880988	99880995	8mer-1a	99880988	99881009	143	-12.18
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3689a-3p	99880349	99880356	8mer-1a	99880349	99880370	144	-19.53
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3689b-3p	99880349	99880356	8mer-1a	99880349	99880370	144	-19.58
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3689c	99880349	99880356	8mer-1a	99880349	99880370	144	-19.58
CAediting_377741	chr4_99880500_-	ENSG00000109270.11	ENST00000499666	hsa-miR-3945	99880495	99880500	6mer	99880494	99880516	140	-20.45
CAediting_377741	chr4_99880500_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4253	99880495	99880501	7mer-m8	99880494	99880511	140	-16.35
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4421	99880418	99880425	8mer-1a	99880418	99880439	154	-16.28
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4432	99880583	99880589	7mer-m8	99880582	99880601	150	-14.43
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4522	99880585	99880591	7mer-m8	99880584	99880604	149	-13.61
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4522	99880585	99880591	7mer-m8	99880584	99880604	149	-13.61
CAediting_377758	chr4_99881007_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4664-5p	99881002	99881009	8mer-1a	99881002	99881022	143	-20.85
CAediting_377733	chr4_99880427_-	ENSG00000109270.11	ENST00000499666	hsa-miR-4684-5p	99880423	99880429	7mer-m8	99880422	99880443	153	-15.48
CAediting_377740	chr4_99880481_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5690	99880477	99880483	7mer-m8	99880476	99880496	142	-14.51
CAediting_377759	chr4_99881012_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5693	99881009	99881015	7mer-m8	99881008	99881029	142	-18.31
CAediting_377743	chr4_99880546_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5694	99880543	99880549	7mer-m8	99880542	99880562	152	-14.45
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-5699-3p	99880418	99880425	8mer-1a	99880418	99880439	153	-17.68
CAediting_377756	chr4_99880990_-	ENSG00000109270.11	ENST00000499666	hsa-miR-593-3p	99880985	99880991	7mer-m8	99880984	99881002	147	-16.65
CAediting_377733	chr4_99880427_-	ENSG00000109270.11	ENST00000499666	hsa-miR-593-3p	99880421	99880427	7mer-1a	99880421	99880439	140	-19.02
CAediting_377751	chr4_99880960_-	ENSG00000109270.11	ENST00000499666	hsa-miR-627-3p	99880958	99880965	8mer-1a	99880958	99880977	150	-10.66
CAediting_377752	chr4_99880961_-	ENSG00000109270.11	ENST00000499666	hsa-miR-627-3p	99880958	99880965	8mer-1a	99880958	99880977	150	-10.66
CAediting_377753	chr4_99880962_-	ENSG00000109270.11	ENST00000499666	hsa-miR-627-3p	99880958	99880965	8mer-1a	99880958	99880977	150	-10.66
CAediting_377758	chr4_99881007_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6737-5p	99881002	99881008	7mer-m8	99881001	99881022	145	-19.95
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6779-5p	99880349	99880356	8mer-1a	99880349	99880369	140	-19.26
CAediting_377758	chr4_99881007_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6812-5p	99881002	99881008	7mer-m8	99881001	99881025	150	-20.06
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6818-3p	99880590	99880596	7mer-m8	99880589	99880610	146	-13.18
CAediting_377748	chr4_99880592_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6818-3p	99880590	99880596	7mer-m8	99880589	99880610	146	-13.18
CAediting_377749	chr4_99880594_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6818-3p	99880590	99880596	7mer-m8	99880589	99880610	146	-13.18
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6818-3p	99880421	99880427	7mer-m8	99880420	99880441	140	-15.97
CAediting_377741	chr4_99880500_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6862-5p	99880495	99880501	7mer-m8	99880494	99880512	147	-17.48
CAediting_377741	chr4_99880500_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6862-5p	99880495	99880501	7mer-m8	99880494	99880512	147	-17.48
CAediting_377746	chr4_99880588_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6888-3p	99880588	99880594	7mer-m8	99880587	99880607	145	-12.7
CAediting_377747	chr4_99880590_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6888-3p	99880588	99880594	7mer-m8	99880587	99880607	145	-12.7
CAediting_377748	chr4_99880592_-	ENSG00000109270.11	ENST00000499666	hsa-miR-6888-3p	99880588	99880594	7mer-m8	99880587	99880607	145	-12.7
CAediting_377731	chr4_99880417_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7152-5p	99880417	99880423	7mer-m8	99880416	99880435	152	-14.11
CAediting_377732	chr4_99880421_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7152-5p	99880417	99880423	7mer-m8	99880416	99880435	152	-14.11
CAediting_377756	chr4_99880990_-	ENSG00000109270.11	ENST00000499666	hsa-miR-744-3p	99880990	99880996	7mer-m8	99880989	99881010	140	-14.79
CAediting_377757	chr4_99880993_-	ENSG00000109270.11	ENST00000499666	hsa-miR-744-3p	99880990	99880996	7mer-m8	99880989	99881010	140	-14.79
CAediting_377745	chr4_99880563_-	ENSG00000109270.11	ENST00000499666	hsa-miR-7703	99880558	99880564	7mer-m8	99880557	99880579	154	-18.71
CAediting_377728	chr4_99880349_-	ENSG00000109270.11	ENST00000499666	hsa-miR-887-5p	99880348	99880355	8mer-1a	99880348	99880368	147	-15.8
CAediting_377729	chr4_99880350_-	ENSG00000109270.11	ENST00000499666	hsa-miR-887-5p	99880348	99880355	8mer-1a	99880348	99880368	147	-15.8

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_688080	chr9_63819626_+	ENSG00000109270.11	ENST00000499666	hsa-miR-4477b	99881369	99881376	8mer-1a	99881369	99881395	145	-12.39
CAediting_688080	chr9_63819626_+	ENSG00000109270.11	ENST00000226522	hsa-miR-4477b	99881369	99881376	8mer-1a	99881369	99881395	145	-12.39
CAediting_1229414	chr17_67471546_+	ENSG00000109270.11	ENST00000499666	hsa-miR-548aa	99880391	99880397	7mer-m8	99880390	99880414	140	-12.74
CAediting_1229415	chr17_67471547_+	ENSG00000109270.11	ENST00000499666	hsa-miR-548aa	99878851	99878857	7mer-m8	99878850	99878878	144	-13.29
CAediting_1160181	chr17_7017644_-	ENSG00000109270.11	ENST00000499666	hsa-miR-195-3p	99879162	99879168	7mer-m8	99879161	99879182	141	-11.8
CAediting_1351755	chr19_40282625_-	ENSG00000109270.11	ENST00000499666	hsa-miR-641	99880722	99880729	8mer-1a	99880722	99880744	152	-12.94
CAediting_1351755	chr19_40282625_-	ENSG00000109270.11	ENST00000499666	hsa-miR-641	99879658	99879664	7mer-m8	99879657	99879680	140	-12.68
CAediting_228905	chr2_188297554_+	ENSG00000109270.11	ENST00000499666	hsa-miR-561-3p	99881365	99881371	7mer-m8	99881364	99881385	147	-12.33
CAediting_442554	chr5_154685830_+	ENSG00000109270.11	ENST00000499666	hsa-miR-1303	99878520	99878526	7mer-m8	99878519	99878540	145	-16.72
CAediting_442554	chr5_154685830_+	ENSG00000109270.11	ENST00000499666	hsa-miR-1303	99878345	99878352	8mer-1a	99878345	99878372	141	-17.42
CAediting_524911	chr7_5495852_-	ENSG00000109270.11	ENST00000499666	hsa-miR-589-3p	99880704	99880710	7mer-m8	99880703	99880726	142	-13.03
CAediting_228905	chr2_188297554_+	ENSG00000109270.11	ENST00000226522	hsa-miR-561-3p	99881365	99881371	7mer-m8	99881364	99881385	147	-12.33

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_442554	chr5_154685830_+	ENSG00000109270.11	ENST00000499666	hsa-miR-1303	99878683	99878689	7mer-m8	99878682	99878703	140	-13.83
CAediting_228905	chr2_188297554_+	ENSG00000109270.11	ENST00000499666	hsa-miR-561-3p	99879035	99879041	7mer-m8	99879034	99879055	148	-8.47
CAediting_1351755	chr19_40282625_-	ENSG00000109270.11	ENST00000499666	hsa-miR-641	99879500	99879506	7mer-m8	99879499	99879521	152	-13.7

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for LAMTOR3

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST	ENST type	RNA structure without RNA A-to-I editing.	RNA structure with RNA A-to-I editing.
ENST00000499666.5	protein_coding

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID	ENST	Editing_Position	MFE_withoneAI	MFE_withoutAI	MFE_withmultipleAI
CAediting_377723	ENST00000499666.5	chr4_99879758_-	-1174.00	-1170.50	-1215.60
CAediting_377724	ENST00000499666.5	chr4_99879821_-	-1174.10	-1170.50	-1215.60
CAediting_377725	ENST00000499666.5	chr4_99880342_-	-1173.30	-1170.50	-1215.60
CAediting_377726	ENST00000499666.5	chr4_99880347_-	-1173.30	-1170.50	-1215.60
CAediting_377727	ENST00000499666.5	chr4_99880348_-	-1173.00	-1170.50	-1215.60
CAediting_377728	ENST00000499666.5	chr4_99880349_-	-1173.30	-1170.50	-1215.60
CAediting_377729	ENST00000499666.5	chr4_99880350_-	-1170.50	-1170.50	-1215.60
CAediting_377730	ENST00000499666.5	chr4_99880410_-	-1170.50	-1170.50	-1215.60
CAediting_377731	ENST00000499666.5	chr4_99880417_-	-1175.40	-1170.50	-1215.60
CAediting_377732	ENST00000499666.5	chr4_99880421_-	-1169.80	-1170.50	-1215.60
CAediting_377733	ENST00000499666.5	chr4_99880427_-	-1171.20	-1170.50	-1215.60
CAediting_377734	ENST00000499666.5	chr4_99880430_-	-1170.90	-1170.50	-1215.60
CAediting_377735	ENST00000499666.5	chr4_99880436_-	-1171.00	-1170.50	-1215.60
CAediting_377736	ENST00000499666.5	chr4_99880445_-	-1170.60	-1170.50	-1215.60
CAediting_377737	ENST00000499666.5	chr4_99880446_-	-1171.80	-1170.50	-1215.60
CAediting_377738	ENST00000499666.5	chr4_99880453_-	-1171.40	-1170.50	-1215.60
CAediting_377739	ENST00000499666.5	chr4_99880471_-	-1172.10	-1170.50	-1215.60
CAediting_377740	ENST00000499666.5	chr4_99880481_-	-1174.20	-1170.50	-1215.60
CAediting_377741	ENST00000499666.5	chr4_99880500_-	-1172.70	-1170.50	-1215.60
CAediting_377742	ENST00000499666.5	chr4_99880511_-	-1171.50	-1170.50	-1215.60
CAediting_377743	ENST00000499666.5	chr4_99880546_-	-1170.00	-1170.50	-1215.60
CAediting_377744	ENST00000499666.5	chr4_99880549_-	-1167.40	-1170.50	-1215.60
CAediting_377745	ENST00000499666.5	chr4_99880563_-	-1177.40	-1170.50	-1215.60
CAediting_377746	ENST00000499666.5	chr4_99880588_-	-1169.60	-1170.50	-1215.60
CAediting_377747	ENST00000499666.5	chr4_99880590_-	-1176.70	-1170.50	-1215.60
CAediting_377748	ENST00000499666.5	chr4_99880592_-	-1169.90	-1170.50	-1215.60
CAediting_377749	ENST00000499666.5	chr4_99880594_-	-1169.60	-1170.50	-1215.60
CAediting_377750	ENST00000499666.5	chr4_99880742_-	-1176.40	-1170.50	-1215.60
CAediting_377751	ENST00000499666.5	chr4_99880960_-	-1170.90	-1170.50	-1215.60
CAediting_377752	ENST00000499666.5	chr4_99880961_-	-1170.60	-1170.50	-1215.60
CAediting_377753	ENST00000499666.5	chr4_99880962_-	-1170.60	-1170.50	-1215.60
CAediting_377754	ENST00000499666.5	chr4_99880965_-	-1170.10	-1170.50	-1215.60
CAediting_377755	ENST00000499666.5	chr4_99880966_-	-1170.60	-1170.50	-1215.60
CAediting_377756	ENST00000499666.5	chr4_99880990_-	-1169.80	-1170.50	-1215.60
CAediting_377757	ENST00000499666.5	chr4_99880993_-	-1170.20	-1170.50	-1215.60
CAediting_377758	ENST00000499666.5	chr4_99881007_-	-1170.10	-1170.50	-1215.60
CAediting_377759	ENST00000499666.5	chr4_99881012_-	-1170.80	-1170.50	-1215.60
CAediting_377760	ENST00000499666.5	chr4_99881023_-	-1170.20	-1170.50	-1215.60
CAediting_377761	ENST00000499666.5	chr4_99881027_-	-1170.70	-1170.50	-1215.60
CAediting_377762	ENST00000499666.5	chr4_99881043_-	-1170.50	-1170.50	-1215.60
CAediting_377763	ENST00000499666.5	chr4_99881044_-	-1170.60	-1170.50	-1215.60

Top

Relation with ADAR for LAMTOR3

Correlation between ADAR gene expression and RNA editing frequency

Cancer	CAeditomID	position	ADAR1 (p-val)	ADAR1 (coeff.)	ADAR2 (p-val)	ADAR2 (coeff.)	ADAR3 (p-val)	ADAR3 (coeff.)
LGG	CAediting_377747	chr4_99880590_-	1.54591582646114e-05	0.194280628648948	.	.	0.012637099706164	0.11281933804129
BRCA	CAediting_377747	chr4_99880590_-	6.99818582123255e-37	0.4790098359121	.	.	.	.
LUAD	CAediting_377747	chr4_99880590_-	0.00205142415435465	0.296180409864864	.	.	.	.
COAD	CAediting_377747	chr4_99880590_-	2.53591853306676e-07	0.423406821070371	.	.	.	.
LUSC	CAediting_377747	chr4_99880590_-	2.62671824345602e-08	0.423683194046189	.	.	.	.
GBM	CAediting_377747	chr4_99880590_-	2.73212717956047e-05	0.34657419086888	.	.	.	.
PRAD	CAediting_377747	chr4_99880590_-	1.49777274238764e-08	0.295232620545895	.	.	.	.
HNSC	CAediting_377747	chr4_99880590_-	0.00158865705330302	0.313335765474616	.	.	.	.
KICH	CAediting_377747	chr4_99880590_-	0.000484637138582417	0.433408847699881	.	.	.	.
THCA	CAediting_377747	chr4_99880590_-	2.27114839412257e-14	0.389358179682387	.	.	.	.
KIRC	CAediting_377747	chr4_99880590_-	6.39400752043653e-11	0.332038001447698	.	.	.	.
KIRP	CAediting_377747	chr4_99880590_-	0.00648914105423435	0.219888285123593	.	.	.	.
ESCA	CAediting_377747	chr4_99880590_-	0.00144990607491191	0.363624178726293	.	.	.	.
OV	CAediting_377747	chr4_99880590_-	2.96291431787918e-06	0.407137651054809	.	.	.	.
PAAD	CAediting_377747	chr4_99880590_-	0.00973671615527805	0.328534670907997	.	.	.	.
PCPG	CAediting_377747	chr4_99880590_-	5.44768670275816e-05	0.390358072727652	0.00498664740866264	0.277345021054936	.	.
SKCM	CAediting_377747	chr4_99880590_-	9.3720230612887e-20	0.542351181191805	.	.	.	.
SARC	CAediting_377747	chr4_99880590_-	5.0241152277228e-06	0.42507725800887	.	.	.	.
LGG	CAediting_377754	chr4_99880965_-	0.000214164349940956	0.286057942330307	.	.	.	.
BRCA	CAediting_377754	chr4_99880965_-	7.62757662431548e-08	0.387607739748232	.	.	.	.
KIRC	CAediting_377754	chr4_99880965_-	0.00549739755004904	0.302167577732674	.	.	.	.
LGG	CAediting_377755	chr4_99880966_-	0.000108477228119946	0.329336923118753	.	.	.	.
BRCA	CAediting_377755	chr4_99880966_-	0.00136351045411188	0.235639705561839	.	.	.	.

Top

Relation with cancer stages for LAMTOR3

Correlation between Cancer stages and RNA editing frequency

Cancer	Stage_type	CAeditomID	position	P-val	Coeff.
KIRP	pathologic_stage	CAediting_377747	chr4_99880590_-	0.00237179404691075	0.253999606412601

Top

Relation with survival for LAMTOR3

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for LAMTOR3

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for LAMTOR3

Diseases associated with this gene.
(DisGeNet 7.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene