Home

Download

Statistics

Examples

Help

Contact

Editing gene: UBE2I (CAeditome ID:7329)

Gene summary for UBE2I

Gene summary

Gene information	Gene symbol	UBE2I
	Gene ID	7329
	Gene name	ubiquitin conjugating enzyme E2 I
	Synonyms	C358B7.1\|P18\|UBC9
	Cytomap	16p13.3
	Type of gene	protein-coding
	Description	SUMO-conjugating enzyme UBC9RING-type E3 SUMO transferase UBC9SUMO-1-protein ligaseSUMO-protein ligaseubiquitin carrier protein 9ubiquitin carrier protein Iubiquitin conjugating enzyme 9ubiquitin conjugating enzyme E2Iubiquitin-conjugating enzyme
	Modification date	20210518
	UniProtAcc	P63279
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
UBE2I	GO:0061656	SUMO-conjugating enzyme UBC9	19955185
UBE2I	GO:0016925	SUMO-conjugating enzyme UBC9	15660128
UBE2I	GO:0016925	SUMO-conjugating enzyme UBC9	19955185
UBE2I	GO:0016925	SUMO-conjugating enzyme UBC9	21968017
UBE2I	GO:0045892	SUMO-conjugating enzyme UBC9	16631117
UBE2I	GO:1903755	SUMO-conjugating enzyme UBC9	19955185
UBE2I	GO:0005634	SUMO-conjugating enzyme UBC9	14752048
UBE2I	GO:0005634	SUMO-conjugating enzyme UBC9	16631117
UBE2I	GO:0005634	SUMO-conjugating enzyme UBC9	27068747
UBE2I	GO:0005634	SUMO-conjugating enzyme UBC9	9223278
UBE2I	GO:0005737	SUMO-conjugating enzyme UBC9	9223278
UBE2I	GO:0016605	SUMO-conjugating enzyme UBC9	9885291
UBE2I	GO:1990234	SUMO-conjugating enzyme UBC9	19955185
UBE2I	GO:1990356	SUMO-conjugating enzyme UBC9	15660128

Top

RNA A-to-I events for UBE2I

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000103275.17

RNA A-to-I editing events in Cancer.

CAediting_1078325(1313477, +), CAediting_1078326(1313486, +), CAediting_1078327(1317009, +), CAediting_1078328(1317031, +), CAediting_1078329(1317113, +), CAediting_1078330(1317140, +), CAediting_1078331(1317141, +), CAediting_1078332(1317145, +), CAediting_1078333(1317146, +), CAediting_1078334(1322871, +), CAediting_1078335(1322879, +), CAediting_1078336(1322902, +), CAediting_1078337(1322909, +), CAediting_1078338(1322920, +), CAediting_1078339(1322925, +), CAediting_1078340(1322970, +), CAediting_1078341(1323121, +), CAediting_1078342(1323125, +), CAediting_1078343(1323130, +), CAediting_1078344(1323189, +), CAediting_1078345(1323232, +),

Top

RNA editing positional annotations for UBE2I using Annovar

Protein coding RNA editing(s).

CAeditome ID

Position

Variant type

ENST

NTchange

AAchange

SIFT_score

Polyphen2_HVAR_score

PROVEAN_pred

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_1078325	chr16_1313477_+	ncRNA_intronic
CAediting_1078326	chr16_1313486_+	ncRNA_intronic
CAediting_1078327	chr16_1317009_+	ncRNA_exonic
CAediting_1078328	chr16_1317031_+	ncRNA_exonic
CAediting_1078329	chr16_1317113_+	ncRNA_exonic
CAediting_1078330	chr16_1317140_+	ncRNA_exonic
CAediting_1078331	chr16_1317141_+	ncRNA_exonic
CAediting_1078332	chr16_1317145_+	ncRNA_exonic
CAediting_1078333	chr16_1317146_+	ncRNA_exonic
CAediting_1078334	chr16_1322871_+	ncRNA_intronic
CAediting_1078335	chr16_1322879_+	ncRNA_intronic
CAediting_1078336	chr16_1322902_+	ncRNA_intronic
CAediting_1078337	chr16_1322909_+	ncRNA_intronic
CAediting_1078338	chr16_1322920_+	ncRNA_intronic
CAediting_1078339	chr16_1322925_+	ncRNA_intronic
CAediting_1078340	chr16_1322970_+	ncRNA_intronic
CAediting_1078341	chr16_1323121_+	ncRNA_intronic
CAediting_1078342	chr16_1323125_+	ncRNA_intronic
CAediting_1078343	chr16_1323130_+	ncRNA_intronic
CAediting_1078344	chr16_1323189_+	ncRNA_intronic
CAediting_1078345	chr16_1323232_+	ncRNA_intronic

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_1078325	chr16_1313477_+	SINE	Alu	AluSx
CAediting_1078326	chr16_1313486_+	SINE	Alu	AluSx
CAediting_1078327	chr16_1317009_+	SINE	Alu	AluSx1
CAediting_1078328	chr16_1317031_+	SINE	Alu	AluSx1
CAediting_1078329	chr16_1317113_+	SINE	Alu	AluSx1
CAediting_1078330	chr16_1317140_+	SINE	Alu	AluSx1
CAediting_1078331	chr16_1317141_+	SINE	Alu	AluSx1
CAediting_1078332	chr16_1317145_+	SINE	Alu	AluSx1
CAediting_1078333	chr16_1317146_+	SINE	Alu	AluSx1
CAediting_1078334	chr16_1322871_+	SINE	Alu	AluJb
CAediting_1078335	chr16_1322879_+	SINE	Alu	AluJb
CAediting_1078336	chr16_1322902_+	SINE	Alu	AluJb
CAediting_1078337	chr16_1322909_+	SINE	Alu	AluJb
CAediting_1078338	chr16_1322920_+	SINE	Alu	AluJb
CAediting_1078339	chr16_1322925_+	SINE	Alu	AluJb
CAediting_1078340	chr16_1322970_+	SINE	Alu	AluJb
CAediting_1078341	chr16_1323121_+	SINE	Alu	AluY
CAediting_1078342	chr16_1323125_+	SINE	Alu	AluY
CAediting_1078343	chr16_1323130_+	SINE	Alu	AluY
CAediting_1078344	chr16_1323189_+	SINE	Alu	AluY
CAediting_1078345	chr16_1323232_+	SINE	Alu	AluY

Top

RNA A-to-I editing events in the alternative splicing sites for UBE2I

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
IR	CAediting_1078327	chr16_1317009_+	1317006:1317028	3SS	0+17i	TTAATCCCAGCTGCTCGGGAGGC	-31.46	TTAGTCCCAGCTGCTCGGGAGGC	-32.53

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000103275.17.UBE2I.

Correlation between RNA A-to-I editing and PSI for ENSG00000103275.17.UBE2I.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for UBE2I

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for UBE2I

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for UBE2I

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_980496	chr14_31014685_-	ENSG00000103275.17	ENST00000402301	hsa-miR-624-3p	1320996	1321002	7mer-m8	1320983	1321003	140	-14.28
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000355803	hsa-miR-4512	1326473	1326479	7mer-m8	1326459	1326480	144	-21.37
CAediting_1229413	chr17_67471544_+	ENSG00000103275.17	ENST00000355803	hsa-miR-548aa	1325539	1325544	6mer	1325518	1325545	145	-19.73
CAediting_1229415	chr17_67471547_+	ENSG00000103275.17	ENST00000355803	hsa-miR-548aa	1326538	1326544	7mer-m8	1326521	1326545	156	-22.42
CAediting_86358	chr1_109598906_+	ENSG00000103275.17	ENST00000355803	hsa-miR-197-5p	1325413	1325419	7mer-1a	1325398	1325419	143	-33.06
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000325437	hsa-miR-4512	1326473	1326479	7mer-m8	1326459	1326480	144	-21.37
CAediting_1229413	chr17_67471544_+	ENSG00000103275.17	ENST00000325437	hsa-miR-548aa	1325539	1325544	6mer	1325518	1325545	145	-19.73
CAediting_1229415	chr17_67471547_+	ENSG00000103275.17	ENST00000325437	hsa-miR-548aa	1326538	1326544	7mer-m8	1326521	1326545	156	-22.42
CAediting_86358	chr1_109598906_+	ENSG00000103275.17	ENST00000325437	hsa-miR-197-5p	1325413	1325419	7mer-1a	1325398	1325419	143	-33.06
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000397515	hsa-miR-4512	1326473	1326479	7mer-m8	1326459	1326480	144	-21.37
CAediting_1229413	chr17_67471544_+	ENSG00000103275.17	ENST00000397515	hsa-miR-548aa	1325539	1325544	6mer	1325518	1325545	145	-19.73
CAediting_1229415	chr17_67471547_+	ENSG00000103275.17	ENST00000397515	hsa-miR-548aa	1326538	1326544	7mer-m8	1326521	1326545	156	-22.42
CAediting_86358	chr1_109598906_+	ENSG00000103275.17	ENST00000397515	hsa-miR-197-5p	1325413	1325419	7mer-1a	1325398	1325419	143	-33.06
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000397514	hsa-miR-4512	1326473	1326479	7mer-m8	1326459	1326480	144	-21.37
CAediting_1229413	chr17_67471544_+	ENSG00000103275.17	ENST00000397514	hsa-miR-548aa	1325539	1325544	6mer	1325518	1325545	145	-19.73
CAediting_1229415	chr17_67471547_+	ENSG00000103275.17	ENST00000397514	hsa-miR-548aa	1326538	1326544	7mer-m8	1326521	1326545	156	-22.42
CAediting_86358	chr1_109598906_+	ENSG00000103275.17	ENST00000397514	hsa-miR-197-5p	1325413	1325419	7mer-1a	1325398	1325419	143	-33.06
CAediting_1229413	chr17_67471544_+	ENSG00000103275.17	ENST00000402301	hsa-miR-548aa	1321477	1321483	7mer-m8	1321462	1321484	152	-12.67
CAediting_86358	chr1_109598906_+	ENSG00000103275.17	ENST00000402301	hsa-miR-197-5p	1320993	1320999	7mer-m8	1320973	1321000	155	-25.12
CAediting_580943	chr7_100356700_+	ENSG00000103275.17	ENST00000402301	hsa-miR-6840-3p	1320724	1320730	7mer-m8	1320710	1320731	155	-29.86
CAediting_468389	chr6_31355314_-	ENSG00000103275.17	ENST00000355803	hsa-miR-6891-5p	1326224	1326231	8mer-1a	1326213	1326231	146	-20.35
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000355803	hsa-miR-503-5p	1326267	1326272	6mer	1326251	1326273	156	-32.11
CAediting_468389	chr6_31355314_-	ENSG00000103275.17	ENST00000325437	hsa-miR-6891-5p	1326224	1326231	8mer-1a	1326213	1326231	146	-20.35
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000325437	hsa-miR-503-5p	1326267	1326272	6mer	1326251	1326273	156	-32.11
CAediting_468389	chr6_31355314_-	ENSG00000103275.17	ENST00000397515	hsa-miR-6891-5p	1326224	1326231	8mer-1a	1326213	1326231	146	-20.35
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000397515	hsa-miR-503-5p	1326267	1326272	6mer	1326251	1326273	156	-32.11
CAediting_468389	chr6_31355314_-	ENSG00000103275.17	ENST00000397514	hsa-miR-6891-5p	1326224	1326231	8mer-1a	1326213	1326231	146	-20.35
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000397514	hsa-miR-503-5p	1326267	1326272	6mer	1326251	1326273	156	-32.11

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_393	chr1_1167164_+	ENSG00000103275.17	ENST00000355803	hsa-miR-200b-3p	1325048	1325054	7mer-m8	1325032	1325055	150	-10.85
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000355803	hsa-miR-4512	1326383	1326388	6mer	1326371	1326389	140	-33.5
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000355803	hsa-miR-503-5p	1325235	1325240	6mer	1325217	1325241	142	-21.23
CAediting_393	chr1_1167164_+	ENSG00000103275.17	ENST00000325437	hsa-miR-200b-3p	1325048	1325054	7mer-m8	1325032	1325055	150	-10.85
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000325437	hsa-miR-4512	1326383	1326388	6mer	1326371	1326389	140	-33.5
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000325437	hsa-miR-503-5p	1325235	1325240	6mer	1325217	1325241	142	-21.23
CAediting_393	chr1_1167164_+	ENSG00000103275.17	ENST00000397515	hsa-miR-200b-3p	1325048	1325054	7mer-m8	1325032	1325055	150	-10.85
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000397515	hsa-miR-4512	1326383	1326388	6mer	1326371	1326389	140	-33.5
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000397515	hsa-miR-503-5p	1325235	1325240	6mer	1325217	1325241	142	-21.23
CAediting_393	chr1_1167164_+	ENSG00000103275.17	ENST00000397514	hsa-miR-200b-3p	1325048	1325054	7mer-m8	1325032	1325055	150	-10.85
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000397514	hsa-miR-4512	1326383	1326388	6mer	1326371	1326389	140	-33.5
CAediting_1524209	chrX_134546392_-	ENSG00000103275.17	ENST00000397514	hsa-miR-503-5p	1325235	1325240	6mer	1325217	1325241	142	-21.23
CAediting_846604	chr11_93733708_-	ENSG00000103275.17	ENST00000402301	hsa-miR-1304-3p	1320773	1320779	7mer-m8	1320759	1320780	144	-17.56
CAediting_1054808	chr15_66496985_-	ENSG00000103275.17	ENST00000402301	hsa-miR-4512	1321375	1321381	7mer-m8	1321365	1321382	149	-24.38

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for UBE2I

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST

ENST type

RNA structure without RNA A-to-I editing.

RNA structure with RNA A-to-I editing.

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID

ENST

Editing_Position

MFE_withoneAI

MFE_withoutAI

MFE_withmultipleAI

Top

Relation with ADAR for UBE2I

Correlation between ADAR gene expression and RNA editing frequency

Cancer	CAeditomID	position	ADAR1 (p-val)	ADAR1 (coeff.)	ADAR2 (p-val)	ADAR2 (coeff.)	ADAR3 (p-val)	ADAR3 (coeff.)
BRCA	CAediting_1078338	chr16_1322920_+	.	.	0.0421403089632931	0.24717663972224	.	.

Top

Relation with cancer stages for UBE2I

Correlation between Cancer stages and RNA editing frequency

Cancer

Stage_type

CAeditomID

position

P-val

Coeff.

Top

Relation with survival for UBE2I

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for UBE2I

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for UBE2I

Diseases associated with this gene.
(DisGeNet 7.0)

Gene	Disease ID	Disease name	# pubmeds	Source
UBE2I	C0007097	Carcinoma	1	CTD_human
UBE2I	C0024667	Animal Mammary Neoplasms	1	CTD_human
UBE2I	C0024668	Mammary Neoplasms, Experimental	1	CTD_human
UBE2I	C0205696	Anaplastic carcinoma	1	CTD_human
UBE2I	C0205697	Carcinoma, Spindle-Cell	1	CTD_human
UBE2I	C0205698	Undifferentiated carcinoma	1	CTD_human
UBE2I	C0205699	Carcinomatosis	1	CTD_human
UBE2I	C1257925	Mammary Carcinoma, Animal	1	CTD_human

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene