![]() |
||||||
|
![]() | |
![]() | |
![]() | Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples |
![]() | |
![]() | |
![]() | The effects of the RNA editing to the stability of the RNA structures |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Editing gene: UBC (CAeditome ID:7316) |
Gene summary for UBC |
![]() |
Gene information | Gene symbol | UBC | Gene ID | 7316 |
Gene name | ubiquitin C | |
Synonyms | HMG20 | |
Cytomap | 12q24.31 | |
Type of gene | protein-coding | |
Description | polyubiquitin-C | |
Modification date | 20210531 | |
UniProtAcc | P0CG48 | |
Context |
![]() |
Gene | GO ID | GO term | PubMed ID |
Top |
RNA A-to-I events for UBC |
![]() |
![]() |
![]() |
![]() |
CAediting_946855(124913197, -), CAediting_946856(124913670, -), |
Top |
RNA editing positional annotations for UBC using Annovar |
![]() |
CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
CAediting_946855 | chr12_124913197_- | nonsynonymous SNV | ENST00000339647.5 | c.A575G | p.Q192R | D | B | D |
CAediting_946855 | chr12_124913197_- | nonsynonymous SNV | ENST00000536769.1 | c.A575G | p.Q192R | D | B | D |
CAediting_946855 | chr12_124913197_- | nonsynonymous SNV | ENST00000541272.1 | c.A347G | p.Q116R | D | B | D |
![]() |
CAeditome ID | Position | Variant type |
CAediting_946855 | chr12_124913197_- | exonic |
CAediting_946856 | chr12_124913670_- | exonic |
![]() |
CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
Top |
RNA A-to-I editing events in the alternative splicing sites for UBC |
![]() |
AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
ES | CAediting_946855 | chr12_124913197_- | 124913188:124913210 | 3SS | 0+7i | ATTCCTCCTGATCAGCAGAGGTT | -5.95 | ATTCCTCCTGATCGGCAGAGGTT | -3.86 |
IR | CAediting_946855 | chr12_124913197_- | 124913188:124913210 | 3SS | 0+7i | ATTCCTCCTGATCAGCAGAGGTT | -5.95 | ATTCCTCCTGATCGGCAGAGGTT | -3.86 |
IR | CAediting_946855 | chr12_124913197_- | 124913190:124913212 | 3SS | 0+5i | GCATTCCTCCTGATCAGCAGAGG | 2.18 | GCATTCCTCCTGATCGGCAGAGG | 3.98 |
IR | CAediting_946855 | chr12_124913197_- | 124913193:124913215 | 3SS | 0+2i | AAGGCATTCCTCCTGATCAGCAG | 1.3 | AAGGCATTCCTCCTGATCGGCAG | -6.66 |
IR | CAediting_946855 | chr12_124913197_- | 124913196:124913218 | 3SS | 2+0i | AGGAAGGCATTCCTCCTGATCAG | -18.49 | AGGAAGGCATTCCTCCTGATCGG | -22.37 |
MEX_2 | CAediting_946855 | chr12_124913197_- | 124913188:124913210 | 3SS | 0+7i | ATTCCTCCTGATCAGCAGAGGTT | -5.95 | ATTCCTCCTGATCGGCAGAGGTT | -3.86 |
MEX_2 | CAediting_946855 | chr12_124913197_- | 124913190:124913212 | 3SS | 0+5i | GCATTCCTCCTGATCAGCAGAGG | 2.18 | GCATTCCTCCTGATCGGCAGAGG | 3.98 |
MEX_2 | CAediting_946855 | chr12_124913197_- | 124913193:124913215 | 3SS | 0+2i | AAGGCATTCCTCCTGATCAGCAG | 1.3 | AAGGCATTCCTCCTGATCGGCAG | -6.66 |
MEX_1 | CAediting_946855 | chr12_124913197_- | 124913188:124913210 | 3SS | 0+7i | ATTCCTCCTGATCAGCAGAGGTT | -5.95 | ATTCCTCCTGATCGGCAGAGGTT | -3.86 |
IR | CAediting_946856 | chr12_124913670_- | 124913662:124913670 | 5SS | 3+0i | AGGCATCCC | -24.91 | GGGCATCCC | -28.57 |
IR | CAediting_946856 | chr12_124913670_- | 124913664:124913672 | 5SS | 1+0i | GAAGGCATC | -19.2 | GAGGGCATC | -6.97 |
IR | CAediting_946856 | chr12_124913670_- | 124913663:124913671 | 5SS | 2+0i | AAGGCATCC | 0.58 | AGGGCATCC | -4.16 |
![]() |
![]() |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for UBC |
![]() * The grey color means N/A. |
![]() |
![]() * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for UBC |
![]() * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for UBC |
**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
Top |
The effects of the RNA editing to the stability of the RNA structures for UBC |
![]() * Click on the image to enlarge it in a new window. |
ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
![]() |
CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for UBC |
![]() |
Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for UBC |
![]() |
Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for UBC |
![]() |
Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for UBC |
![]() (DrugBank Version 5.1.8 2021-01-03) |
Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for UBC |
![]() (DisGeNet 7.0) |
Gene | Disease ID | Disease name | # pubmeds | Source |