|
||||||
|
 | |
| |
| Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples |
| |
| |
| The effects of the RNA editing to the stability of the RNA structures |
| |
| |
| |
| |
|
Editing gene: RPL29 (CAeditome ID:6159) |
Gene summary for RPL29 |
 Gene summary |
| Gene information | Gene symbol | RPL29 | Gene ID | 6159 |
| Gene name | ribosomal protein L29 | |
| Synonyms | HIP|HUMRPL29|L29|RPL29P10|RPL29_3_370 | |
| Cytomap | 3p21.2 | |
| Type of gene | protein-coding | |
| Description | 60S ribosomal protein L29HP/HS-interacting proteincell surface heparin-binding protein HIPheparin/heparan sulfate-binding proteinheparin/heparan sulfate-interacting proteinlarge ribosomal subunit protein eL29ribosomal protein YL43 homologue | |
| Modification date | 20210531 | |
| UniProtAcc | P47914 | |
| Context |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| RPL29 | GO:0003735 | 60S ribosomal protein L29 | 23636399 |
| RPL29 | GO:0022626 | 60S ribosomal protein L29 | 23636399 |
Top |
RNA A-to-I events for RPL29 |
| RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure. |
 |
| RNA editing frequencies across 33 cancers of gene: ENSG00000162244.9 |
| RNA A-to-I editing events in Cancer. |
| CAediting_284495(51993833, -), |
Top |
RNA editing positional annotations for RPL29 using Annovar |
| Protein coding RNA editing(s). |
| CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
| Gene structure information of RNA editing(s). |
| CAeditome ID | Position | Variant type |
| CAediting_284495 | chr3_51993833_- | exonic |
| Repat-regional RNA editing(s). |
| CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
| CAediting_284495 | chr3_51993833_- | Simple_repeat | Simple_repeat | (GAGCCT)n |
Top |
RNA A-to-I editing events in the alternative splicing sites for RPL29 |
| RNA A-to-I editing(s) in the alternative splicing sites. |
| AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
| IR | CAediting_284495 | chr3_51993833_- | 51993811:51993833 | 3SS | 0+20i | AACCAAGGCCCAGGCTGCAGCCC | -8.42 | GACCAAGGCCCAGGCTGCAGCCC | -7.92 |
| IR | CAediting_284495 | chr3_51993833_- | 51993818:51993840 | 3SS | 0+13i | AGGATCAAACCAAGGCCCAGGCT | -9.69 | AGGATCAGACCAAGGCCCAGGCT | -13.3 |
| IR | CAediting_284495 | chr3_51993833_- | 51993824:51993846 | 3SS | 0+7i | AGGCCAAGGATCAAACCAAGGCC | -7.69 | AGGCCAAGGATCAGACCAAGGCC | -14.35 |
| Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000162244.9.RPL29. |
| Correlation between RNA A-to-I editing and PSI for ENSG00000162244.9.RPL29. |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for RPL29 |
| Differential gene expressions between RNA A-to-I edited and non-edited tumor samples. * The grey color means N/A. |
| Correlation between RNA A-to-I editing and gene expression. |
| - Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for RPL29 |
| - Lollipop plot for RNA A-to-I editings across protein structure. * Click on the image to enlarge it in a new window. |
 |
Top |
The effects of the RNA editing to the miRNA binding sites for RPL29 |
| **If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
| RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| CAediting_284495 | chr3_51993833_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-3151-3p | 51993832 | 51993839 | 8mer-1a | 51993832 | 51993851 | 140.00 | -15.00 |
| CAediting_284495 | chr3_51993833_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-3192-3p | 51993832 | 51993838 | 7mer-m8 | 51993831 | 51993851 | 140.00 | -13.01 |
| RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA gained miRNA binding sites. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in lncRNA lost miRNA binding sites. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to lncRNA. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs lost binding to lncRNA. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| CAediting_393 | chr1_1167164_+ | ENSG00000162244.9 | ENST00000481629 | hsa-miR-200b-3p | 51994318 | 51994325 | 8mer-1a | 51994318 | 51994339 | 141 | -11.31 |
| CAediting_1054808 | chr15_66496985_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-4512 | 51993768 | 51993774 | 7mer-m8 | 51993767 | 51993788 | 140 | -18.08 |
| CAediting_1399425 | chr20_1392958_- | ENSG00000162244.9 | ENST00000481629 | hsa-miR-6869-5p | 51994314 | 51994319 | 6mer | 51994313 | 51994334 | 146 | -21.16 |
| CAediting_228905 | chr2_188297554_+ | ENSG00000162244.9 | ENST00000481629 | hsa-miR-561-3p | 51994543 | 51994549 | 7mer-m8 | 51994542 | 51994563 | 151 | -14.91 |
| RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA. |
| CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
| CAediting_1054808 | chr15_66496985_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-4512 | 51994005 | 51994011 | 7mer-m8 | 51994004 | 51994026 | 147 | -17.14 |
| Differentially expressed gene-miRNA network |
Top |
The effects of the RNA editing to the stability of the RNA structures for RPL29 |
| - RNA A-to-I editing in mRNA. * Click on the image to enlarge it in a new window. |
| ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
| ENST00000294189.9 | protein_coding |  |  |
| ENST00000466397.4 | protein_coding |  |  |
| ENST00000475248.4 | protein_coding |  |  |
| ENST00000479017.4 | protein_coding |  |  |
| ENST00000480306.4 | nonsense_mediated_decay |  |  |
| ENST00000492277.4 | protein_coding |  |  |
| ENST00000495383.4 | protein_coding |  |  |
| RNA A-to-I editing in RNA structures for Minimum free energy (MFE). |
| CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
| CAediting_284495 | ENST00000294189.9 | chr3_51993833_- | -245.40 | -245.40 | -245.40 |
| CAediting_284495 | ENST00000466397.4 | chr3_51993833_- | -280.50 | -279.50 | -280.50 |
| CAediting_284495 | ENST00000475248.4 | chr3_51993833_- | -186.50 | -186.50 | -186.50 |
| CAediting_284495 | ENST00000479017.4 | chr3_51993833_- | -240.90 | -240.90 | -240.90 |
| CAediting_284495 | ENST00000480306.4 | chr3_51993833_- | -255.20 | -255.20 | -255.20 |
| CAediting_284495 | ENST00000492277.4 | chr3_51993833_- | -186.90 | -186.90 | -186.90 |
| CAediting_284495 | ENST00000495383.4 | chr3_51993833_- | -259.80 | -258.50 | -259.80 |
Top |
Relation with ADAR for RPL29 |
| Correlation between ADAR gene expression and RNA editing frequency |
| Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for RPL29 |
| Correlation between Cancer stages and RNA editing frequency |
| Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for RPL29 |
| Correlation between RNA editing and survival |
| Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for RPL29 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.8 2021-01-03) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RPL29 |
| Diseases associated with this gene. (DisGeNet 7.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
