![]() |
||||||
|
![]() | |
![]() | |
![]() | Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples |
![]() | |
![]() | |
![]() | The effects of the RNA editing to the stability of the RNA structures |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Editing gene: RPL29 (CAeditome ID:6159) |
Gene summary for RPL29 |
![]() |
Gene information | Gene symbol | RPL29 | Gene ID | 6159 |
Gene name | ribosomal protein L29 | |
Synonyms | HIP|HUMRPL29|L29|RPL29P10|RPL29_3_370 | |
Cytomap | 3p21.2 | |
Type of gene | protein-coding | |
Description | 60S ribosomal protein L29HP/HS-interacting proteincell surface heparin-binding protein HIPheparin/heparan sulfate-binding proteinheparin/heparan sulfate-interacting proteinlarge ribosomal subunit protein eL29ribosomal protein YL43 homologue | |
Modification date | 20210531 | |
UniProtAcc | P47914 | |
Context |
![]() |
Gene | GO ID | GO term | PubMed ID |
RPL29 | GO:0003735 | 60S ribosomal protein L29 | 23636399 |
RPL29 | GO:0022626 | 60S ribosomal protein L29 | 23636399 |
Top |
RNA A-to-I events for RPL29 |
![]() |
![]() |
![]() |
![]() |
CAediting_284495(51993833, -), |
Top |
RNA editing positional annotations for RPL29 using Annovar |
![]() |
CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
![]() |
CAeditome ID | Position | Variant type |
CAediting_284495 | chr3_51993833_- | exonic |
![]() |
CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
CAediting_284495 | chr3_51993833_- | Simple_repeat | Simple_repeat | (GAGCCT)n |
Top |
RNA A-to-I editing events in the alternative splicing sites for RPL29 |
![]() |
AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
IR | CAediting_284495 | chr3_51993833_- | 51993811:51993833 | 3SS | 0+20i | AACCAAGGCCCAGGCTGCAGCCC | -8.42 | GACCAAGGCCCAGGCTGCAGCCC | -7.92 |
IR | CAediting_284495 | chr3_51993833_- | 51993818:51993840 | 3SS | 0+13i | AGGATCAAACCAAGGCCCAGGCT | -9.69 | AGGATCAGACCAAGGCCCAGGCT | -13.3 |
IR | CAediting_284495 | chr3_51993833_- | 51993824:51993846 | 3SS | 0+7i | AGGCCAAGGATCAAACCAAGGCC | -7.69 | AGGCCAAGGATCAGACCAAGGCC | -14.35 |
![]() |
![]() |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for RPL29 |
![]() * The grey color means N/A. |
![]() |
![]() * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for RPL29 |
![]() * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for RPL29 |
**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_284495 | chr3_51993833_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-3151-3p | 51993832 | 51993839 | 8mer-1a | 51993832 | 51993851 | 140.00 | -15.00 |
CAediting_284495 | chr3_51993833_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-3192-3p | 51993832 | 51993838 | 7mer-m8 | 51993831 | 51993851 | 140.00 | -13.01 |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_393 | chr1_1167164_+ | ENSG00000162244.9 | ENST00000481629 | hsa-miR-200b-3p | 51994318 | 51994325 | 8mer-1a | 51994318 | 51994339 | 141 | -11.31 |
CAediting_1054808 | chr15_66496985_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-4512 | 51993768 | 51993774 | 7mer-m8 | 51993767 | 51993788 | 140 | -18.08 |
CAediting_1399425 | chr20_1392958_- | ENSG00000162244.9 | ENST00000481629 | hsa-miR-6869-5p | 51994314 | 51994319 | 6mer | 51994313 | 51994334 | 146 | -21.16 |
CAediting_228905 | chr2_188297554_+ | ENSG00000162244.9 | ENST00000481629 | hsa-miR-561-3p | 51994543 | 51994549 | 7mer-m8 | 51994542 | 51994563 | 151 | -14.91 |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_1054808 | chr15_66496985_- | ENSG00000162244.9 | ENST00000480306 | hsa-miR-4512 | 51994005 | 51994011 | 7mer-m8 | 51994004 | 51994026 | 147 | -17.14 |
![]() |
Top |
The effects of the RNA editing to the stability of the RNA structures for RPL29 |
![]() * Click on the image to enlarge it in a new window. |
![]() |
CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
CAediting_284495 | ENST00000294189.9 | chr3_51993833_- | -245.40 | -245.40 | -245.40 |
CAediting_284495 | ENST00000466397.4 | chr3_51993833_- | -280.50 | -279.50 | -280.50 |
CAediting_284495 | ENST00000475248.4 | chr3_51993833_- | -186.50 | -186.50 | -186.50 |
CAediting_284495 | ENST00000479017.4 | chr3_51993833_- | -240.90 | -240.90 | -240.90 |
CAediting_284495 | ENST00000480306.4 | chr3_51993833_- | -255.20 | -255.20 | -255.20 |
CAediting_284495 | ENST00000492277.4 | chr3_51993833_- | -186.90 | -186.90 | -186.90 |
CAediting_284495 | ENST00000495383.4 | chr3_51993833_- | -259.80 | -258.50 | -259.80 |
Top |
Relation with ADAR for RPL29 |
![]() |
Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for RPL29 |
![]() |
Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for RPL29 |
![]() |
Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for RPL29 |
![]() (DrugBank Version 5.1.8 2021-01-03) |
Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RPL29 |
![]() (DisGeNet 7.0) |
Gene | Disease ID | Disease name | # pubmeds | Source |