Home

Download

Statistics

Examples

Help

Contact

Editing gene: SPCS3 (CAeditome ID:60559)

Gene summary for SPCS3

Gene summary

Gene information	Gene symbol	SPCS3
	Gene ID	60559
	Gene name	signal peptidase complex subunit 3
	Synonyms	PRO3567\|SPC22\|SPC22/23\|SPC23\|SPC3\|YLR066W
	Cytomap	4q34.2
	Type of gene	protein-coding
	Description	signal peptidase complex subunit 3SPase 22 kDa subunitSPase 22/23 kDa subunitmicrosomal signal peptidase 22/23 kDa subunitmicrosomal signal peptidase 23 kDa subunitsignal peptidase complex subunit 3 homolog
	Modification date	20210518
	UniProtAcc	P61009
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
SPCS3	GO:0006508	Signal peptidase complex subunit 3	27499293
SPCS3	GO:0005783	Signal peptidase complex subunit 3	0000054

Top

RNA A-to-I events for SPCS3

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000129128.11

RNA A-to-I editing events in Cancer.

CAediting_393782(176325761, +), CAediting_393783(176325774, +), CAediting_393784(176325802, +), CAediting_393785(176325844, +), CAediting_393786(176325873, +), CAediting_393787(176326221, +), CAediting_393788(176326222, +), CAediting_393789(176331087, +), CAediting_393790(176331098, +), CAediting_393791(176331158, +), CAediting_393792(176331175, +), CAediting_393793(176331176, +), CAediting_393794(176331181, +), CAediting_393795(176331183, +), CAediting_393796(176331184, +), CAediting_393797(176331189, +), CAediting_393798(176331203, +), CAediting_393799(176331772, +), CAediting_393800(176331851, +), CAediting_393801(176331857, +), CAediting_393802(176331862, +),

Top

RNA editing positional annotations for SPCS3 using Annovar

Protein coding RNA editing(s).

CAeditome ID

Position

Variant type

ENST

NTchange

AAchange

SIFT_score

Polyphen2_HVAR_score

PROVEAN_pred

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_393782	chr4_176325761_+	ncRNA_intronic
CAediting_393783	chr4_176325774_+	ncRNA_intronic
CAediting_393784	chr4_176325802_+	ncRNA_intronic
CAediting_393785	chr4_176325844_+	ncRNA_intronic
CAediting_393786	chr4_176325873_+	ncRNA_intronic
CAediting_393787	chr4_176326221_+	ncRNA_intronic
CAediting_393788	chr4_176326222_+	ncRNA_intronic
CAediting_393789	chr4_176331087_+	UTR3
CAediting_393790	chr4_176331098_+	UTR3
CAediting_393791	chr4_176331158_+	UTR3
CAediting_393792	chr4_176331175_+	UTR3
CAediting_393793	chr4_176331176_+	UTR3
CAediting_393794	chr4_176331181_+	UTR3
CAediting_393795	chr4_176331183_+	UTR3
CAediting_393796	chr4_176331184_+	UTR3
CAediting_393797	chr4_176331189_+	UTR3
CAediting_393798	chr4_176331203_+	UTR3
CAediting_393799	chr4_176331772_+	UTR3
CAediting_393800	chr4_176331851_+	UTR3
CAediting_393801	chr4_176331857_+	UTR3
CAediting_393802	chr4_176331862_+	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_393782	chr4_176325761_+	SINE	Alu	AluSq
CAediting_393783	chr4_176325774_+	SINE	Alu	AluSq
CAediting_393784	chr4_176325802_+	SINE	Alu	AluSq
CAediting_393785	chr4_176325844_+	SINE	Alu	AluSq
CAediting_393786	chr4_176325873_+	SINE	Alu	AluSq
CAediting_393787	chr4_176326221_+	SINE	Alu	AluSx
CAediting_393788	chr4_176326222_+	SINE	Alu	AluSx
CAediting_393799	chr4_176331772_+	SINE	Alu	AluSq2
CAediting_393800	chr4_176331851_+	SINE	Alu	AluSq2
CAediting_393801	chr4_176331857_+	SINE	Alu	AluSq2
CAediting_393802	chr4_176331862_+	SINE	Alu	AluSq2

Top

RNA A-to-I editing events in the alternative splicing sites for SPCS3

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
IR	CAediting_393792	chr4_176331175_+	176331172:176331194	3SS	0+17i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTGAGATGATAATCTTAAAGCC	-9.47
IR	CAediting_393793	chr4_176331176_+	176331172:176331194	3SS	0+16i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTAGGATGATAATCTTAAAGCC	-10.49
IR	CAediting_393794	chr4_176331181_+	176331172:176331194	3SS	0+11i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTAAGATGGTAATCTTAAAGCC	-9.4
IR	CAediting_393795	chr4_176331183_+	176331172:176331194	3SS	0+9i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTAAGATGATGATCTTAAAGCC	-10.43
IR	CAediting_393796	chr4_176331184_+	176331172:176331194	3SS	0+8i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTAAGATGATAGTCTTAAAGCC	-15.69
IR	CAediting_393797	chr4_176331189_+	176331172:176331194	3SS	0+3i	TCTAAGATGATAATCTTAAAGCC	-9.94	TCTAAGATGATAATCTTGAAGCC	-16.82

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000129128.11.SPCS3.

Correlation between RNA A-to-I editing and PSI for ENSG00000129128.11.SPCS3.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for SPCS3

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for SPCS3

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for SPCS3

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_393790	chr4_176331098_+	ENSG00000129128.11	ENST00000503362	hsa-miR-216a-5p	176331096	176331103	8mer-1a	176331082	176331103	152.00	-18.52
CAediting_393792	chr4_176331175_+	ENSG00000129128.11	ENST00000503362	hsa-miR-3919	176331168	176331175	8mer-1a	176331158	176331175	154.00	-19.55
CAediting_393795	chr4_176331183_+	ENSG00000129128.11	ENST00000503362	hsa-miR-5694	176331180	176331186	7mer-m8	176331167	176331187	140.00	-9.78
CAediting_393796	chr4_176331184_+	ENSG00000129128.11	ENST00000503362	hsa-miR-499a-5p	176331182	176331189	8mer-1a	176331169	176331189	144.00	-10.09
CAediting_393797	chr4_176331189_+	ENSG00000129128.11	ENST00000503362	hsa-miR-520e-5p	176331183	176331190	8mer-1a	176331171	176331190	144.00	-8.46
CAediting_393799	chr4_176331772_+	ENSG00000129128.11	ENST00000503362	hsa-miR-181a-2-3p	176331766	176331773	8mer-1a	176331752	176331773	140.00	-11.24
CAediting_393799	chr4_176331772_+	ENSG00000129128.11	ENST00000503362	hsa-miR-6509-3p	176331767	176331773	7mer-m8	176331753	176331774	155.00	-13.80
CAediting_393801	chr4_176331857_+	ENSG00000129128.11	ENST00000503362	hsa-miR-4733-5p	176331854	176331861	8mer-1a	176331840	176331861	152.00	-15.10
CAediting_393791	chr4_176331158_+	ENSG00000129128.11	ENST00000503362	hsa-miR-6849-3p	176331156	176331162	7mer-m8	176331145	176331163	147.00	-17.60
CAediting_393800	chr4_176331851_+	ENSG00000129128.11	ENST00000503362	hsa-miR-3189-3p	176331845	176331851	7mer-m8	176331829	176331852	149.00	-26.69
CAediting_393800	chr4_176331851_+	ENSG00000129128.11	ENST00000503362	hsa-miR-6813-3p	176331846	176331852	7mer-m8	176331833	176331853	140.00	-12.15
CAediting_393802	chr4_176331862_+	ENSG00000129128.11	ENST00000503362	hsa-miR-215-3p	176331859	176331865	7mer-m8	176331836	176331866	147.00	-21.31

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_393791	chr4_176331158_+	ENSG00000129128.11	ENST00000503362	hsa-miR-208a-5p	176331154	176331160	7mer-m8	176331140	176331161	140	-9.6
CAediting_393791	chr4_176331158_+	ENSG00000129128.11	ENST00000503362	hsa-miR-208b-5p	176331154	176331160	7mer-m8	176331139	176331161	155	-11.47
CAediting_393791	chr4_176331158_+	ENSG00000129128.11	ENST00000503362	hsa-miR-335-3p	176331151	176331157	7mer-m8	176331137	176331158	145	-8.31
CAediting_393799	chr4_176331772_+	ENSG00000129128.11	ENST00000503362	hsa-miR-593-3p	176331771	176331776	6mer	176331759	176331777	144	-21.33

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_393	chr1_1167164_+	ENSG00000129128.11	ENST00000503362	hsa-miR-200b-3p	176331917	176331923	7mer-m8	176331903	176331924	149	-9.07
CAediting_688080	chr9_63819626_+	ENSG00000129128.11	ENST00000503362	hsa-miR-4477b	176329723	176329730	8mer-1a	176329711	176329730	157	-12.54
CAediting_688080	chr9_63819626_+	ENSG00000129128.11	ENST00000503362	hsa-miR-4477b	176329254	176329260	7mer-m8	176329239	176329261	141	-10.99
CAediting_1229413	chr17_67471544_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176330034	176330040	7mer-m8	176330018	176330041	142	-12.1
CAediting_1229413	chr17_67471544_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176330953	176330959	7mer-m8	176330936	176330960	151	-11.59
CAediting_1160181	chr17_7017644_-	ENSG00000129128.11	ENST00000503362	hsa-miR-195-3p	176331356	176331362	7mer-m8	176331341	176331363	151	-17.41
CAediting_86358	chr1_109598906_+	ENSG00000129128.11	ENST00000503362	hsa-miR-197-5p	176331671	176331677	7mer-m8	176331656	176331678	168	-29.99
CAediting_396018	chr5_1062918_-	ENSG00000129128.11	ENST00000503362	hsa-miR-4635	176331818	176331824	7mer-m8	176331805	176331825	162	-21.04

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_442554	chr5_154685830_+	ENSG00000129128.11	ENST00000503362	hsa-miR-1303	176330886	176330892	7mer-m8	176330872	176330893	154	-16.49
CAediting_442554	chr5_154685830_+	ENSG00000129128.11	ENST00000503362	hsa-miR-1303	176329019	176329026	8mer-1a	176329005	176329026	143	-12.36
CAediting_393	chr1_1167164_+	ENSG00000129128.11	ENST00000503362	hsa-miR-200b-3p	176330920	176330926	7mer-m8	176330907	176330927	142	-10.95
CAediting_1229413	chr17_67471544_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176331021	176331026	6mer	176331003	176331027	140	-18.93
CAediting_1229414	chr17_67471546_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176331021	176331026	6mer	176331003	176331027	140	-18.93
CAediting_1229415	chr17_67471547_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176331021	176331026	6mer	176331003	176331027	140	-18.93
CAediting_1229413	chr17_67471544_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176328426	176328432	7mer-m8	176328409	176328433	147	-9.28
CAediting_1229414	chr17_67471546_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176328426	176328432	7mer-m8	176328409	176328433	147	-9.28
CAediting_1229415	chr17_67471547_+	ENSG00000129128.11	ENST00000503362	hsa-miR-548aa	176328426	176328432	7mer-m8	176328409	176328433	147	-9.28
CAediting_117844	chr1_162342605_+	ENSG00000129128.11	ENST00000503362	hsa-miR-556-3p	176329562	176329568	7mer-m8	176329548	176329569	141	-8.64
CAediting_228905	chr2_188297554_+	ENSG00000129128.11	ENST00000503362	hsa-miR-561-3p	176330018	176330024	7mer-m8	176330003	176330025	151	-8.92
CAediting_228905	chr2_188297554_+	ENSG00000129128.11	ENST00000503362	hsa-miR-561-3p	176331390	176331396	7mer-m8	176331375	176331397	144	-5.92

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for SPCS3

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST	ENST type	RNA structure without RNA A-to-I editing.	RNA structure with RNA A-to-I editing.
ENST00000503362.1	protein_coding

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID	ENST	Editing_Position	MFE_withoneAI	MFE_withoutAI	MFE_withmultipleAI
CAediting_393789	ENST00000503362.1	chr4_176331087_+	-1193.90	-1194.20	-1202.00
CAediting_393790	ENST00000503362.1	chr4_176331098_+	-1194.30	-1194.20	-1202.00
CAediting_393791	ENST00000503362.1	chr4_176331158_+	-1193.90	-1194.20	-1202.00
CAediting_393792	ENST00000503362.1	chr4_176331175_+	-1194.30	-1194.20	-1202.00
CAediting_393793	ENST00000503362.1	chr4_176331176_+	-1193.90	-1194.20	-1202.00
CAediting_393794	ENST00000503362.1	chr4_176331181_+	-1193.60	-1194.20	-1202.00
CAediting_393795	ENST00000503362.1	chr4_176331183_+	-1194.30	-1194.20	-1202.00
CAediting_393796	ENST00000503362.1	chr4_176331184_+	-1194.20	-1194.20	-1202.00
CAediting_393797	ENST00000503362.1	chr4_176331189_+	-1194.30	-1194.20	-1202.00
CAediting_393798	ENST00000503362.1	chr4_176331203_+	-1194.60	-1194.20	-1202.00
CAediting_393799	ENST00000503362.1	chr4_176331772_+	-1197.00	-1194.20	-1202.00
CAediting_393800	ENST00000503362.1	chr4_176331851_+	-1195.20	-1194.20	-1202.00
CAediting_393801	ENST00000503362.1	chr4_176331857_+	-1200.70	-1194.20	-1202.00
CAediting_393802	ENST00000503362.1	chr4_176331862_+	-1194.60	-1194.20	-1202.00

Top

Relation with ADAR for SPCS3

Correlation between ADAR gene expression and RNA editing frequency

Cancer	CAeditomID	position	ADAR1 (p-val)	ADAR1 (coeff.)	ADAR2 (p-val)	ADAR2 (coeff.)	ADAR3 (p-val)	ADAR3 (coeff.)
BLCA	CAediting_393789	chr4_176331087_+	3.75833231020817e-18	0.469134029451156	.	.	.	.
LGG	CAediting_393789	chr4_176331087_+	1.24097808811837e-19	0.581044321352944	.	.	.	.
BRCA	CAediting_393789	chr4_176331087_+	4.35986482456746e-117	0.642338840251955	.	.	.	.
LIHC	CAediting_393789	chr4_176331087_+	1.3499177114982e-16	0.431132695972112	.	.	.	.
CESC	CAediting_393789	chr4_176331087_+	1.07334803713164e-12	0.41982806469035	.	.	.	.
LUAD	CAediting_393789	chr4_176331087_+	6.85182741623533e-39	0.538196779752605	.	.	.	.
COAD	CAediting_393789	chr4_176331087_+	6.72522234886693e-17	0.444103551413409	.	.	.	.
LUSC	CAediting_393789	chr4_176331087_+	2.54981525276033e-24	0.457216818280766	.	.	.	.
GBM	CAediting_393789	chr4_176331087_+	2.09077109040956e-10	0.592156232931146	.	.	.	.
PRAD	CAediting_393789	chr4_176331087_+	5.2851935250566e-22	0.530357254074053	.	.	.	.
HNSC	CAediting_393789	chr4_176331087_+	1.79757780308174e-19	0.41086813530772	0.0378315645065608	0.0987036361594163	.	.
STAD	CAediting_393789	chr4_176331087_+	1.96615782985374e-25	0.513095177385194	.	.	.	.
THCA	CAediting_393789	chr4_176331087_+	1.00342030676403e-13	0.384774599882459	.	.	.	.
KIRC	CAediting_393789	chr4_176331087_+	5.07593144424785e-14	0.336943572638558	.	.	.	.
UCEC	CAediting_393789	chr4_176331087_+	3.6951409975982e-24	0.482182507252153	.	.	.	.
KIRP	CAediting_393789	chr4_176331087_+	3.30088940487477e-06	0.349053145234751	.	.	.	.
ESCA	CAediting_393789	chr4_176331087_+	1.42001239673423e-11	0.501557113186529	.	.	.	.
LAML	CAediting_393789	chr4_176331087_+	0.000211496111842274	0.444007534058911	.	.	.	.
OV	CAediting_393789	chr4_176331087_+	7.76160756119938e-21	0.462905387134223	.	.	.	.
PAAD	CAediting_393789	chr4_176331087_+	1.79712144293467e-10	0.477063467165887	.	.	.	.
PCPG	CAediting_393789	chr4_176331087_+	2.94928038241252e-07	0.422722815592067	.	.	.	.
SKCM	CAediting_393789	chr4_176331087_+	1.97687085508132e-27	0.544701812614255	.	.	.	.
MESO	CAediting_393789	chr4_176331087_+	0.000155890851880957	0.403405775008077	.	.	.	.
READ	CAediting_393789	chr4_176331087_+	4.24540309213662e-05	0.376695657427978	.	.	.	.
SARC	CAediting_393789	chr4_176331087_+	4.47239642539131e-12	0.471523219053039	.	.	.	.
TGCT	CAediting_393789	chr4_176331087_+	1.56883087636069e-13	0.60109192230821	.	.	.	.
BLCA	CAediting_393792	chr4_176331175_+	4.7977147771793e-21	0.498269564433226	.	.	.	.
LGG	CAediting_393792	chr4_176331175_+	4.96260688556888e-17	0.569406358481833	.	.	.	.
BRCA	CAediting_393792	chr4_176331175_+	1.64129888882695e-78	0.555764969209377	.	.	.	.
LIHC	CAediting_393792	chr4_176331175_+	7.19198151258922e-15	0.406339460199725	.	.	.	.
CESC	CAediting_393792	chr4_176331175_+	1.57367138666353e-13	0.431424370873498	.	.	.	.
LUAD	CAediting_393792	chr4_176331175_+	1.69166224373841e-30	0.481929855276786	.	.	.	.
COAD	CAediting_393792	chr4_176331175_+	2.75374493972282e-14	0.431175992638126	0.0360367210746377	0.124469922525628	.	.
LUSC	CAediting_393792	chr4_176331175_+	6.75589078326841e-25	0.463724290759384	.	.	0.0433797485533584	0.0962419056303873
GBM	CAediting_393792	chr4_176331175_+	1.56530528123799e-10	0.556422250689034	.	.	.	.
PRAD	CAediting_393792	chr4_176331175_+	5.04845293219943e-24	0.515705418438442	.	.	.	.
HNSC	CAediting_393792	chr4_176331175_+	2.6012413520996e-15	0.358562001008053	0.0210642919495624	0.107889287817903	.	.
STAD	CAediting_393792	chr4_176331175_+	1.64440176648886e-22	0.490332823307675	.	.	.	.
THCA	CAediting_393792	chr4_176331175_+	2.95777024434845e-16	0.398009648791485	.	.	.	.
KIRC	CAediting_393792	chr4_176331175_+	3.2255931931562e-12	0.309382431875268	.	.	.	.
UCEC	CAediting_393792	chr4_176331175_+	8.82656952235796e-18	0.447234680500624	.	.	.	.
KIRP	CAediting_393792	chr4_176331175_+	0.00666660623768817	0.20210223455195	.	.	.	.
ESCA	CAediting_393792	chr4_176331175_+	2.18768873165787e-08	0.424647742091362	.	.	.	.
LAML	CAediting_393792	chr4_176331175_+	2.08008543932077e-06	0.542810957127973	.	.	.	.
OV	CAediting_393792	chr4_176331175_+	3.7514516687413e-18	0.437284340378467	.	.	.	.
PAAD	CAediting_393792	chr4_176331175_+	1.30842640101661e-08	0.436995351032594	.	.	.	.
PCPG	CAediting_393792	chr4_176331175_+	0.00577303813448359	0.255903526951214	.	.	.	.
SKCM	CAediting_393792	chr4_176331175_+	3.24824723975815e-20	0.462476075556436	.	.	.	.
MESO	CAediting_393792	chr4_176331175_+	3.28197688784367e-05	0.449242657871889	.	.	.	.
READ	CAediting_393792	chr4_176331175_+	0.00524622494581931	0.285717569094061	.	.	.	.
SARC	CAediting_393792	chr4_176331175_+	4.18048096757488e-10	0.444259003764145	.	.	.	.
TGCT	CAediting_393792	chr4_176331175_+	2.06643972403521e-08	0.45952555494099	.	.	.	.
THYM	CAediting_393792	chr4_176331175_+	3.18683413231937e-07	0.569985785859482	.	.	.	.
BLCA	CAediting_393793	chr4_176331176_+	3.5897130255805e-39	0.59009772587803	.	.	.	.
LGG	CAediting_393793	chr4_176331176_+	9.47473531482154e-33	0.504996684983958	.	.	.	.
BRCA	CAediting_393793	chr4_176331176_+	1.54830399147965e-90	0.559025534971253	.	.	.	.
LIHC	CAediting_393793	chr4_176331176_+	2.83264749925127e-13	0.371271273799887	.	.	.	.
CESC	CAediting_393793	chr4_176331176_+	3.33071243678235e-16	0.448516542619042	.	.	.	.
LUAD	CAediting_393793	chr4_176331176_+	1.05397465852754e-25	0.435074501799593	.	.	.	.
COAD	CAediting_393793	chr4_176331176_+	1.96033976930448e-31	0.532742952470078	0.0146715939245521	0.120450697289316	.	.
LUSC	CAediting_393793	chr4_176331176_+	4.89107752161243e-31	0.486265610521052	0.024224945868771	0.10077704071487	0.0317837345734247	0.0960404432047039
GBM	CAediting_393793	chr4_176331176_+	6.42227509686826e-10	0.456383677516609	.	.	.	.
PRAD	CAediting_393793	chr4_176331176_+	7.27643605651435e-34	0.508649065051273	.	.	.	.
HNSC	CAediting_393793	chr4_176331176_+	1.67428270285349e-22	0.420900601380446	0.000655833686492995	0.153255372264933	.	.
STAD	CAediting_393793	chr4_176331176_+	3.69194821401244e-23	0.483190429279156	.	.	.	.
THCA	CAediting_393793	chr4_176331176_+	2.34561233794093e-22	0.414591911449051	.	.	.	.
KIRC	CAediting_393793	chr4_176331176_+	7.35385297213634e-17	0.351521664976802	.	.	.	.
UCEC	CAediting_393793	chr4_176331176_+	2.49049682683683e-32	0.514122209923005	.	.	.	.
KIRP	CAediting_393793	chr4_176331176_+	9.866366128892e-06	0.263030801211915	.	.	.	.
ACC	CAediting_393793	chr4_176331176_+	2.13391001364215e-09	0.638234526029608	0.00130049655798252	0.374320520936187	.	.
ESCA	CAediting_393793	chr4_176331176_+	6.67331097794716e-08	0.408730990577193	.	.	.	.
LAML	CAediting_393793	chr4_176331176_+	1.66285942482434e-09	0.483404772526061	.	.	.	.
OV	CAediting_393793	chr4_176331176_+	3.86008281361788e-21	0.460011249609171	.	.	.	.
PAAD	CAediting_393793	chr4_176331176_+	6.01945529669045e-15	0.544041493912145	.	.	.	.
PCPG	CAediting_393793	chr4_176331176_+	4.4418371155402e-08	0.398145833949338	.	.	.	.
SKCM	CAediting_393793	chr4_176331176_+	1.07192555314811e-35	0.538816664680138	.	.	.	.
UCS	CAediting_393793	chr4_176331176_+	3.4330245007892e-06	0.584745159674623	.	.	.	.
UVM	CAediting_393793	chr4_176331176_+	0.000166035935860815	0.426832591709706	.	.	.	.
MESO	CAediting_393793	chr4_176331176_+	8.44704114562895e-05	0.413304082536306	.	.	.	.
READ	CAediting_393793	chr4_176331176_+	1.44935569354966e-09	0.470168296563476	.	.	.	.
SARC	CAediting_393793	chr4_176331176_+	4.78061901488375e-12	0.4144421981978	.	.	.	.
TGCT	CAediting_393793	chr4_176331176_+	1.70625489988882e-11	0.514125623053612	.	.	.	.
THYM	CAediting_393793	chr4_176331176_+	1.97279067273173e-10	0.55387357247281	.	.	0.000179621695124412	0.34533543868999
BLCA	CAediting_393795	chr4_176331183_+	1.96186349944433e-06	0.517777541651689	.	.	.	.
BRCA	CAediting_393795	chr4_176331183_+	0.00319526320797393	0.215668328029125	.	.	.	.
LIHC	CAediting_393795	chr4_176331183_+	0.00389439406382418	0.271880077643925	.	.	.	.
CESC	CAediting_393795	chr4_176331183_+	0.00831832676042124	0.334980082579676	.	.	.	.
LUAD	CAediting_393795	chr4_176331183_+	0.00100032659698926	0.302902130642586	.	.	.	.
LUSC	CAediting_393795	chr4_176331183_+	0.0113929502613517	0.281590416646228	.	.	.	.
HNSC	CAediting_393795	chr4_176331183_+	0.0395434946930268	0.184387208528298	.	.	.	.

Top

Relation with cancer stages for SPCS3

Correlation between Cancer stages and RNA editing frequency

Cancer	Stage_type	CAeditomID	position	P-val	Coeff.
BRCA	pathologic_stage	CAediting_393789	chr4_176331087_+	0.0351639134277813	0.067435979289706
HNSC	pathologic_stage	CAediting_393789	chr4_176331087_+	0.0156308879255025	0.122500424370051
KIRC	pathologic_stage	CAediting_393789	chr4_176331087_+	2.0387212349907e-07	0.236628939281705
KIRC	pathologic_stage	CAediting_393792	chr4_176331175_+	3.47064177201412e-05	0.187200918380883
KIRC	pathologic_stage	CAediting_393793	chr4_176331176_+	0.00198064867116052	0.134318584139498
KIRP	clinical_stage	CAediting_393789	chr4_176331087_+	0.00432298159234603	0.26200164006396
KIRP	clinical_stage	CAediting_393793	chr4_176331176_+	0.0212361161761227	0.167058471270708
KIRP	pathologic_stage	CAediting_393789	chr4_176331087_+	8.02780280336447e-05	0.309443441333564
KIRP	pathologic_stage	CAediting_393792	chr4_176331175_+	0.0316112291636423	0.168956752912326
KIRP	pathologic_stage	CAediting_393793	chr4_176331176_+	0.00362779098459217	0.183693006554332
LUAD	pathologic_stage	CAediting_393789	chr4_176331087_+	0.0054774132516869	0.124794175436794
LUAD	pathologic_stage	CAediting_393793	chr4_176331176_+	0.0459156875786168	0.0876646514835463
STAD	pathologic_stage	CAediting_393793	chr4_176331176_+	0.0284905703784138	0.116934084144888
THCA	pathologic_stage	CAediting_393789	chr4_176331087_+	0.0160290705781364	0.129767153611918
THCA	pathologic_stage	CAediting_393793	chr4_176331176_+	0.021861321156579	0.102727632433911
UCS	clinical_stage	CAediting_393793	chr4_176331176_+	0.0162038912660037	-0.325823330615621

Top

Relation with survival for SPCS3

Correlation between RNA editing and survival

Cancer	CAeditomID	position	KMpvalue	Coxpvalue	CoxHR
LUAD	CAediting_393789	chr4_176331087_+	0.0432309441566426	0.0453093	3.1913
UCEC	CAediting_393789	chr4_176331087_+	0.0177787456555746	0.00459364	18.7182
UCEC	CAediting_393792	chr4_176331175_+	0.0421992736663452	0.000806091	12.1748

Top

RelatedDrugs for SPCS3

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for SPCS3

Diseases associated with this gene.
(DisGeNet 7.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene