![]() |
||||||
|
![]() | |
![]() | |
![]() | Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples |
![]() | |
![]() | |
![]() | The effects of the RNA editing to the stability of the RNA structures |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Editing gene: PSME2 (CAeditome ID:5721) |
Gene summary for PSME2 |
![]() |
Gene information | Gene symbol | PSME2 | Gene ID | 5721 |
Gene name | proteasome activator subunit 2 | |
Synonyms | PA28B|PA28beta|REGbeta | |
Cytomap | 14q12 | |
Type of gene | protein-coding | |
Description | proteasome activator complex subunit 211S regulator complex beta subunit11S regulator complex subunit betaMCP activator, 31-kD subunitREG-betaactivator of multicatalytic protease subunit 2cell migration-inducing protein 22proteasome (prosome, macro | |
Modification date | 20210518 | |
UniProtAcc | Q9UL46 | |
Context |
![]() |
Gene | GO ID | GO term | PubMed ID |
Top |
RNA A-to-I events for PSME2 |
![]() |
![]() |
![]() |
![]() |
CAediting_978992(24145220, -), CAediting_978993(24145239, -), CAediting_978994(24145247, -), CAediting_978995(24145275, -), CAediting_978996(24145300, -), CAediting_978997(24145301, -), CAediting_978998(24145302, -), CAediting_978999(24145345, -), |
Top |
RNA editing positional annotations for PSME2 using Annovar |
![]() |
CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
![]() |
CAeditome ID | Position | Variant type |
CAediting_978992 | chr14_24145220_- | ncRNA_exonic |
CAediting_978993 | chr14_24145239_- | exonic |
CAediting_978994 | chr14_24145247_- | exonic |
CAediting_978995 | chr14_24145275_- | ncRNA_exonic;splicing |
CAediting_978996 | chr14_24145300_- | ncRNA_exonic |
CAediting_978997 | chr14_24145301_- | ncRNA_exonic |
CAediting_978998 | chr14_24145302_- | ncRNA_exonic |
CAediting_978999 | chr14_24145345_- | ncRNA_exonic |
![]() |
CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
Top |
RNA A-to-I editing events in the alternative splicing sites for PSME2 |
![]() |
AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
ES | CAediting_978993 | chr14_24145239_- | 24145236:24145244 | 5SS | 0+3i | AGGTAAGAG | -15.81 | AGGTAGGAG | -21.35 |
IR | CAediting_978993 | chr14_24145239_- | 24145236:24145244 | 5SS | 0+3i | AGGTAAGAG | -15.81 | AGGTAGGAG | -21.35 |
ES | CAediting_978995 | chr14_24145275_- | 24145271:24145293 | 3SS | 0+2i | TTCCCCCCTTTTTGCCTTAGATG | 10.49 | TTCCCCCCTTTTTGCCTTGGATG | 2.54 |
IR | CAediting_978995 | chr14_24145275_- | 24145261:24145283 | 3SS | 0+12i | TTTGCCTTAGATGGAAACAGATA | -1.51 | TTTGCCTTGGATGGAAACAGATA | 3.29 |
IR | CAediting_978995 | chr14_24145275_- | 24145271:24145293 | 3SS | 0+2i | TTCCCCCCTTTTTGCCTTAGATG | 10.49 | TTCCCCCCTTTTTGCCTTGGATG | 2.54 |
![]() |
![]() |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for PSME2 |
![]() * The grey color means N/A. |
![]() |
![]() * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for PSME2 |
![]() * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for PSME2 |
**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_978994 | chr14_24145247_- | ENSG00000100911.12 | ENST00000558273 | hsa-miR-1248 | 24145245 | 24145252 | 8mer-1a | 24145245 | 24145271 | 142.00 | -14.49 |
CAediting_978994 | chr14_24145247_- | ENSG00000100911.12 | ENST00000558273 | hsa-miR-6868-3p | 24145244 | 24145251 | 8mer-1a | 24145244 | 24145263 | 151.00 | -18.33 |
CAediting_978994 | chr14_24145247_- | ENSG00000100911.12 | ENST00000560370 | hsa-miR-1248 | 24145245 | 24145252 | 8mer-1a | 24145245 | 24145271 | 142.00 | -14.49 |
CAediting_978994 | chr14_24145247_- | ENSG00000100911.12 | ENST00000560370 | hsa-miR-6868-3p | 24145244 | 24145251 | 8mer-1a | 24145244 | 24145263 | 151.00 | -18.33 |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_86358 | chr1_109598906_+ | ENSG00000100911.12 | ENST00000558273 | hsa-miR-197-5p | 24145390 | 24145397 | 8mer-1a | 24145390 | 24145409 | 160 | -28.76 |
CAediting_573000 | chr7_92204081_- | ENSG00000100911.12 | ENST00000558273 | hsa-miR-1285-5p | 24143639 | 24143645 | 7mer-m8 | 24143638 | 24143658 | 152 | -24.48 |
CAediting_86358 | chr1_109598906_+ | ENSG00000100911.12 | ENST00000560370 | hsa-miR-197-5p | 24145390 | 24145397 | 8mer-1a | 24145390 | 24145409 | 160 | -28.76 |
CAediting_573000 | chr7_92204081_- | ENSG00000100911.12 | ENST00000560370 | hsa-miR-1285-5p | 24143639 | 24143645 | 7mer-m8 | 24143638 | 24143658 | 152 | -24.48 |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
Top |
The effects of the RNA editing to the stability of the RNA structures for PSME2 |
![]() * Click on the image to enlarge it in a new window. |
ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
![]() |
CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for PSME2 |
![]() |
Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for PSME2 |
![]() |
Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for PSME2 |
![]() |
Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for PSME2 |
![]() (DrugBank Version 5.1.8 2021-01-03) |
Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for PSME2 |
![]() (DisGeNet 7.0) |
Gene | Disease ID | Disease name | # pubmeds | Source |
PSME2 | C0019693 | HIV Infections | 1 | CTD_human |
PSME2 | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
PSME2 | C0279626 | Squamous cell carcinoma of esophagus | 1 | CTD_human |
PSME2 | C4505456 | HIV Coinfection | 1 | CTD_human |