Home

Download

Statistics

Examples

Help

Contact

Editing gene: OPA1 (CAeditome ID:4976)

Gene summary for OPA1

Gene summary

Gene information	Gene symbol	OPA1
	Gene ID	4976
	Gene name	OPA1 mitochondrial dynamin like GTPase
	Synonyms	BERHS\|MGM1\|MTDPS14\|NPG\|NTG\|largeG
	Cytomap	3q29
	Type of gene	protein-coding
	Description	dynamin-like 120 kDa protein, mitochondrialdynamin-like guanosine triphosphatasemitochondrial dynamin-like GTPaseoptic atrophy 1 (autosomal dominant)optic atrophy protein 1
	Modification date	20210524
	UniProtAcc	O60313
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
OPA1	GO:0003924	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:0003924	Dynamin-like 120 kDa protein, mitochondrial	27667664
OPA1	GO:0070300	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:1901612	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:0007007	Dynamin-like 120 kDa protein, mitochondrial	12509422
OPA1	GO:0008053	Dynamin-like 120 kDa protein, mitochondrial	17545159
OPA1	GO:0043066	Dynamin-like 120 kDa protein, mitochondrial	12509422
OPA1	GO:0046039	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:0051259	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:0090398	Dynamin-like 120 kDa protein, mitochondrial	17545159
OPA1	GO:0097749	Dynamin-like 120 kDa protein, mitochondrial	20185555
OPA1	GO:0005654	Dynamin-like 120 kDa protein, mitochondrial	0000052
OPA1	GO:0005739	Dynamin-like 120 kDa protein, mitochondrial	0000052
OPA1	GO:0005739	Dynamin-like 120 kDa protein, mitochondrial	17545159
OPA1	GO:0005741	Dynamin-like 120 kDa protein, mitochondrial	12504110
OPA1	GO:0005758	Dynamin-like 120 kDa protein, mitochondrial	17008324
OPA1	GO:0005829	Dynamin-like 120 kDa protein, mitochondrial	0000052
OPA1	GO:0030061	Dynamin-like 120 kDa protein, mitochondrial	12504110

Top

RNA A-to-I events for OPA1

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000198836.7

RNA A-to-I editing events in Cancer.

CAediting_334576(193596705, +), CAediting_334577(193596726, +), CAediting_334578(193596734, +), CAediting_334579(193596783, +), CAediting_334580(193596863, +), CAediting_334581(193596937, +), CAediting_334582(193596969, +), CAediting_334583(193596972, +), CAediting_334584(193596979, +), CAediting_334585(193596982, +), CAediting_334586(193596990, +), CAediting_334587(193600288, +), CAediting_334588(193600362, +), CAediting_334589(193600363, +), CAediting_334590(193600364, +), CAediting_334591(193600442, +), CAediting_334592(193600455, +), CAediting_334593(193600482, +), CAediting_334594(193611504, +), CAediting_334595(193616042, +), CAediting_334596(193616137, +), CAediting_334597(193616141, +), CAediting_334598(193616151, +), CAediting_334599(193616167, +), CAediting_334600(193616270, +), CAediting_334601(193618223, +), CAediting_334602(193618224, +), CAediting_334603(193618357, +), CAediting_334604(193618384, +), CAediting_334605(193628920, +), CAediting_334606(193629014, +), CAediting_334607(193629043, +), CAediting_334608(193629053, +), CAediting_334609(193629055, +), CAediting_334610(193629059, +), CAediting_334611(193629093, +), CAediting_334612(193629096, +), CAediting_334613(193629187, +), CAediting_334614(193629444, +), CAediting_334615(193629487, +), CAediting_334616(193629511, +), CAediting_334617(193629521, +), CAediting_334618(193629553, +), CAediting_334619(193629585, +), CAediting_334620(193629589, +), CAediting_334621(193629606, +), CAediting_334622(193629609, +), CAediting_334623(193632294, +), CAediting_334624(193632805, +), CAediting_334625(193667415, +), CAediting_334626(193667416, +), CAediting_334627(193667454, +), CAediting_334628(193667459, +), CAediting_334629(193667467, +), CAediting_334630(193667482, +), CAediting_334631(193667492, +), CAediting_334632(193667493, +), CAediting_334633(193667513, +), CAediting_334634(193667550, +), CAediting_334635(193667556, +), CAediting_334636(193667560, +), CAediting_334637(193667620, +), CAediting_334638(193667636, +), CAediting_334639(193667641, +), CAediting_334640(193667647, +), CAediting_334641(193667653, +), CAediting_334642(193670646, +), CAediting_334643(193672749, +), CAediting_334644(193676931, +),

Top

RNA editing positional annotations for OPA1 using Annovar

Protein coding RNA editing(s).

CAeditome ID	Position	Variant type	ENST	NTchange	AAchange	SIFT_score	Polyphen2_HVAR_score	PROVEAN_pred
CAediting_334625	chr3_193667415_+	nonsynonymous SNV	ENST00000445863.1	c.A439G	p.N147D	T	.	D
CAediting_334626	chr3_193667416_+	nonsynonymous SNV	ENST00000445863.1	c.A440G	p.N147S	T	.	D
CAediting_334627	chr3_193667454_+	nonsynonymous SNV	ENST00000445863.1	c.A478G	p.R160G	D	.	N

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_334576	chr3_193596705_+	intronic
CAediting_334577	chr3_193596726_+	intronic
CAediting_334578	chr3_193596734_+	intronic
CAediting_334579	chr3_193596783_+	intronic
CAediting_334580	chr3_193596863_+	intronic
CAediting_334581	chr3_193596937_+	intronic
CAediting_334582	chr3_193596969_+	intronic
CAediting_334583	chr3_193596972_+	intronic
CAediting_334584	chr3_193596979_+	intronic
CAediting_334585	chr3_193596982_+	intronic
CAediting_334586	chr3_193596990_+	intronic
CAediting_334587	chr3_193600288_+	intronic
CAediting_334588	chr3_193600362_+	intronic
CAediting_334589	chr3_193600363_+	intronic
CAediting_334590	chr3_193600364_+	intronic
CAediting_334591	chr3_193600442_+	intronic
CAediting_334592	chr3_193600455_+	intronic
CAediting_334593	chr3_193600482_+	intronic
CAediting_334594	chr3_193611504_+	intronic
CAediting_334595	chr3_193616042_+	ncRNA_intronic
CAediting_334596	chr3_193616137_+	ncRNA_intronic
CAediting_334597	chr3_193616141_+	ncRNA_intronic
CAediting_334598	chr3_193616151_+	ncRNA_intronic
CAediting_334599	chr3_193616167_+	ncRNA_intronic
CAediting_334600	chr3_193616270_+	ncRNA_intronic
CAediting_334601	chr3_193618223_+	ncRNA_intronic
CAediting_334602	chr3_193618224_+	ncRNA_intronic
CAediting_334603	chr3_193618357_+	ncRNA_intronic
CAediting_334604	chr3_193618384_+	ncRNA_intronic
CAediting_334605	chr3_193628920_+	ncRNA_intronic
CAediting_334606	chr3_193629014_+	ncRNA_intronic
CAediting_334607	chr3_193629043_+	ncRNA_intronic
CAediting_334608	chr3_193629053_+	ncRNA_intronic
CAediting_334609	chr3_193629055_+	ncRNA_intronic
CAediting_334610	chr3_193629059_+	ncRNA_intronic
CAediting_334611	chr3_193629093_+	ncRNA_intronic
CAediting_334612	chr3_193629096_+	ncRNA_intronic
CAediting_334613	chr3_193629187_+	ncRNA_intronic
CAediting_334614	chr3_193629444_+	ncRNA_intronic
CAediting_334615	chr3_193629487_+	ncRNA_intronic
CAediting_334616	chr3_193629511_+	ncRNA_intronic
CAediting_334617	chr3_193629521_+	ncRNA_intronic
CAediting_334618	chr3_193629553_+	ncRNA_intronic
CAediting_334619	chr3_193629585_+	ncRNA_intronic
CAediting_334620	chr3_193629589_+	ncRNA_intronic
CAediting_334621	chr3_193629606_+	ncRNA_intronic
CAediting_334622	chr3_193629609_+	ncRNA_intronic
CAediting_334623	chr3_193632294_+	ncRNA_intronic
CAediting_334624	chr3_193632805_+	ncRNA_intronic
CAediting_334625	chr3_193667415_+	exonic
CAediting_334626	chr3_193667416_+	exonic
CAediting_334627	chr3_193667454_+	exonic
CAediting_334628	chr3_193667459_+	intronic
CAediting_334629	chr3_193667467_+	intronic
CAediting_334630	chr3_193667482_+	intronic
CAediting_334631	chr3_193667492_+	intronic
CAediting_334632	chr3_193667493_+	intronic
CAediting_334633	chr3_193667513_+	intronic
CAediting_334634	chr3_193667550_+	intronic
CAediting_334635	chr3_193667556_+	intronic
CAediting_334636	chr3_193667560_+	intronic
CAediting_334637	chr3_193667620_+	intronic
CAediting_334638	chr3_193667636_+	intronic
CAediting_334639	chr3_193667641_+	intronic
CAediting_334640	chr3_193667647_+	intronic
CAediting_334641	chr3_193667653_+	intronic
CAediting_334642	chr3_193670646_+	intronic
CAediting_334643	chr3_193672749_+	intronic
CAediting_334644	chr3_193676931_+	intronic

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_334576	chr3_193596705_+	LTR	ERV1	MER57A-int
CAediting_334577	chr3_193596726_+	LTR	ERV1	MER57A-int
CAediting_334578	chr3_193596734_+	LTR	ERV1	MER57A-int
CAediting_334579	chr3_193596783_+	LTR	ERV1	MER57A-int
CAediting_334582	chr3_193596969_+	LTR	ERV1	MER57-int
CAediting_334583	chr3_193596972_+	LTR	ERV1	MER57-int
CAediting_334584	chr3_193596979_+	LTR	ERV1	MER57-int
CAediting_334585	chr3_193596982_+	LTR	ERV1	MER57-int
CAediting_334586	chr3_193596990_+	LTR	ERV1	MER57-int
CAediting_334588	chr3_193600362_+	LTR	ERV1	MER57A-int
CAediting_334589	chr3_193600363_+	LTR	ERV1	MER57A-int
CAediting_334590	chr3_193600364_+	LTR	ERV1	MER57A-int
CAediting_334591	chr3_193600442_+	LTR	ERV1	MER57A-int
CAediting_334592	chr3_193600455_+	LTR	ERV1	MER57A-int
CAediting_334593	chr3_193600482_+	LTR	ERV1	MER57A-int
CAediting_334594	chr3_193611504_+	SINE	Alu	AluSc8
CAediting_334595	chr3_193616042_+	SINE	Alu	AluJo
CAediting_334596	chr3_193616137_+	SINE	Alu	AluJo
CAediting_334597	chr3_193616141_+	SINE	Alu	AluJo
CAediting_334598	chr3_193616151_+	SINE	Alu	AluJo
CAediting_334599	chr3_193616167_+	SINE	Alu	AluJo
CAediting_334600	chr3_193616270_+	SINE	Alu	AluJo
CAediting_334601	chr3_193618223_+	SINE	Alu	AluSc8
CAediting_334602	chr3_193618224_+	SINE	Alu	AluSc8
CAediting_334603	chr3_193618357_+	SINE	Alu	AluSc8
CAediting_334604	chr3_193618384_+	SINE	Alu	AluSc8
CAediting_334605	chr3_193628920_+	SINE	Alu	AluSp
CAediting_334606	chr3_193629014_+	SINE	Alu	AluSp
CAediting_334607	chr3_193629043_+	SINE	Alu	AluSp
CAediting_334608	chr3_193629053_+	SINE	Alu	AluSp
CAediting_334609	chr3_193629055_+	SINE	Alu	AluSp
CAediting_334610	chr3_193629059_+	SINE	Alu	AluSp
CAediting_334611	chr3_193629093_+	SINE	Alu	AluSp
CAediting_334612	chr3_193629096_+	SINE	Alu	AluSp
CAediting_334613	chr3_193629187_+	SINE	Alu	AluSp
CAediting_334614	chr3_193629444_+	SINE	Alu	AluY
CAediting_334615	chr3_193629487_+	SINE	Alu	AluY
CAediting_334616	chr3_193629511_+	SINE	Alu	AluY
CAediting_334617	chr3_193629521_+	SINE	Alu	AluY
CAediting_334618	chr3_193629553_+	SINE	Alu	AluY
CAediting_334619	chr3_193629585_+	SINE	Alu	AluY
CAediting_334620	chr3_193629589_+	SINE	Alu	AluY
CAediting_334621	chr3_193629606_+	SINE	Alu	AluY
CAediting_334622	chr3_193629609_+	SINE	Alu	AluY
CAediting_334623	chr3_193632294_+	SINE	Alu	AluY
CAediting_334624	chr3_193632805_+	SINE	Alu	AluJb
CAediting_334625	chr3_193667415_+	SINE	Alu	AluY
CAediting_334626	chr3_193667416_+	SINE	Alu	AluY
CAediting_334627	chr3_193667454_+	SINE	Alu	AluY
CAediting_334628	chr3_193667459_+	SINE	Alu	AluY
CAediting_334629	chr3_193667467_+	SINE	Alu	AluY
CAediting_334630	chr3_193667482_+	SINE	Alu	AluY
CAediting_334631	chr3_193667492_+	SINE	Alu	AluY
CAediting_334632	chr3_193667493_+	SINE	Alu	AluY
CAediting_334633	chr3_193667513_+	SINE	Alu	AluY
CAediting_334634	chr3_193667550_+	SINE	Alu	AluY
CAediting_334635	chr3_193667556_+	SINE	Alu	AluY
CAediting_334636	chr3_193667560_+	SINE	Alu	AluY
CAediting_334637	chr3_193667620_+	SINE	Alu	AluY
CAediting_334638	chr3_193667636_+	SINE	Alu	AluY
CAediting_334639	chr3_193667641_+	SINE	Alu	AluY
CAediting_334640	chr3_193667647_+	SINE	Alu	AluY
CAediting_334641	chr3_193667653_+	SINE	Alu	AluY
CAediting_334642	chr3_193670646_+	SINE	Alu	AluY
CAediting_334643	chr3_193672749_+	SINE	Alu	AluSx1
CAediting_334644	chr3_193676931_+	SINE	Alu	AluY

Top

RNA A-to-I editing events in the alternative splicing sites for OPA1

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
ES	CAediting_334579	chr3_193596783_+	193596779:193596801	3SS	0+16i	TCTTAAATGTTTTGTATGCAGCT	-19.33	TCTTGAATGTTTTGTATGCAGCT	-20.22
MEX_1	CAediting_334579	chr3_193596783_+	193596779:193596801	3SS	0+16i	TCTTAAATGTTTTGTATGCAGCT	-19.33	TCTTGAATGTTTTGTATGCAGCT	-20.22
ES	CAediting_334627	chr3_193667454_+	193667453:193667461	5SS	2+0i	AAGGTCAGA	6.8	AGGGTCAGA	3.16
IR	CAediting_334627	chr3_193667454_+	193667453:193667461	5SS	2+0i	AAGGTCAGA	6.8	AGGGTCAGA	3.16
ES	CAediting_334628	chr3_193667459_+	193667453:193667461	5SS	0+4i	AAGGTCAGA	6.8	AAGGTCGGA	4.85
IR	CAediting_334628	chr3_193667459_+	193667453:193667461	5SS	0+4i	AAGGTCAGA	6.8	AAGGTCGGA	4.85

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000198836.7.OPA1.

Correlation between RNA A-to-I editing and PSI for ENSG00000198836.7.OPA1.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for OPA1

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for OPA1

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for OPA1

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_748296	chr10_51299626_+	ENSG00000198836.7	ENST00000361715	hsa-miR-605-3p	193696966	193696972	7mer-m8	193696951	193696973	159	-17.72
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361715	hsa-miR-624-3p	193696629	193696635	7mer-m8	193696617	193696636	151	-16.96
CAediting_748296	chr10_51299626_+	ENSG00000198836.7	ENST00000361150	hsa-miR-605-3p	193696966	193696972	7mer-m8	193696951	193696973	159	-17.72
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361150	hsa-miR-624-3p	193696629	193696635	7mer-m8	193696617	193696636	151	-16.96
CAediting_748296	chr10_51299626_+	ENSG00000198836.7	ENST00000361908	hsa-miR-605-3p	193696966	193696972	7mer-m8	193696951	193696973	159	-17.72
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361908	hsa-miR-624-3p	193696629	193696635	7mer-m8	193696617	193696636	151	-16.96
CAediting_1229415	chr17_67471547_+	ENSG00000198836.7	ENST00000361715	hsa-miR-548aa	193697660	193697666	7mer-m8	193697639	193697667	161	-19.78
CAediting_396018	chr5_1062918_-	ENSG00000198836.7	ENST00000361715	hsa-miR-4635	193695874	193695881	8mer-1a	193695859	193695881	154	-19.66
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361715	hsa-miR-3654	193695980	193695986	7mer-m8	193695969	193695987	145	-19.79
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361715	hsa-miR-3654	193694663	193694669	7mer-m8	193694652	193694670	151	-23.05
CAediting_1229415	chr17_67471547_+	ENSG00000198836.7	ENST00000361150	hsa-miR-548aa	193697660	193697666	7mer-m8	193697639	193697667	161	-19.78
CAediting_396018	chr5_1062918_-	ENSG00000198836.7	ENST00000361150	hsa-miR-4635	193695874	193695881	8mer-1a	193695859	193695881	154	-19.66
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361150	hsa-miR-3654	193695980	193695986	7mer-m8	193695969	193695987	145	-19.79
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361150	hsa-miR-3654	193694663	193694669	7mer-m8	193694652	193694670	151	-23.05
CAediting_1229415	chr17_67471547_+	ENSG00000198836.7	ENST00000361908	hsa-miR-548aa	193697660	193697666	7mer-m8	193697639	193697667	161	-19.78
CAediting_396018	chr5_1062918_-	ENSG00000198836.7	ENST00000361908	hsa-miR-4635	193695874	193695881	8mer-1a	193695859	193695881	154	-19.66
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361908	hsa-miR-3654	193695980	193695986	7mer-m8	193695969	193695987	145	-19.79
CAediting_604450	chr7_133034877_-	ENSG00000198836.7	ENST00000361908	hsa-miR-3654	193694663	193694669	7mer-m8	193694652	193694670	151	-23.05
CAediting_524911	chr7_5495852_-	ENSG00000198836.7	ENST00000445863	hsa-miR-589-3p	193668459	193668464	6mer	193668447	193668470	150	-19.87
CAediting_524911	chr7_5495852_-	ENSG00000198836.7	ENST00000445863	hsa-miR-589-3p	193668463	193668470	8mer-1a	193668447	193668470	150	-19.87

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_442554	chr5_154685830_+	ENSG00000198836.7	ENST00000361715	hsa-miR-1303	193697268	193697274	7mer-m8	193697253	193697275	144	-12.97
CAediting_1368054	chr19_46709310_-	ENSG00000198836.7	ENST00000361715	hsa-miR-320e	193695253	193695260	8mer-1a	193695242	193695260	148	-14.87
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361715	hsa-miR-624-3p	193697375	193697381	7mer-m8	193697364	193697382	151	-10.29
CAediting_442554	chr5_154685830_+	ENSG00000198836.7	ENST00000361150	hsa-miR-1303	193697268	193697274	7mer-m8	193697253	193697275	144	-12.97
CAediting_1368054	chr19_46709310_-	ENSG00000198836.7	ENST00000361150	hsa-miR-320e	193695253	193695260	8mer-1a	193695242	193695260	148	-14.87
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361150	hsa-miR-624-3p	193697375	193697381	7mer-m8	193697364	193697382	151	-10.29
CAediting_442554	chr5_154685830_+	ENSG00000198836.7	ENST00000361908	hsa-miR-1303	193697268	193697274	7mer-m8	193697253	193697275	144	-12.97
CAediting_1368054	chr19_46709310_-	ENSG00000198836.7	ENST00000361908	hsa-miR-320e	193695253	193695260	8mer-1a	193695242	193695260	148	-14.87
CAediting_980496	chr14_31014685_-	ENSG00000198836.7	ENST00000361908	hsa-miR-624-3p	193697375	193697381	7mer-m8	193697364	193697382	151	-10.29

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for OPA1

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST	ENST type	RNA structure without RNA A-to-I editing.	RNA structure with RNA A-to-I editing.
ENST00000445863.1	protein_coding

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID	ENST	Editing_Position	MFE_withoneAI	MFE_withoutAI	MFE_withmultipleAI
CAediting_334625	ENST00000445863.1	chr3_193667415_+	-277.60	-276.80	-280.30
CAediting_334626	ENST00000445863.1	chr3_193667416_+	-277.70	-276.80	-280.30
CAediting_334627	ENST00000445863.1	chr3_193667454_+	-278.60	-276.80	-280.30

Top

Relation with ADAR for OPA1

Correlation between ADAR gene expression and RNA editing frequency

Cancer

CAeditomID

position

ADAR1 (p-val)

ADAR1 (coeff.)

ADAR2 (p-val)

ADAR2 (coeff.)

ADAR3 (p-val)

ADAR3 (coeff.)

Top

Relation with cancer stages for OPA1

Correlation between Cancer stages and RNA editing frequency

Cancer

Stage_type

CAeditomID

position

P-val

Coeff.

Top

Relation with survival for OPA1

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for OPA1

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for OPA1

Diseases associated with this gene.
(DisGeNet 7.0)

Gene	Disease ID	Disease name	# pubmeds	Source
OPA1	C0338508	Optic Atrophy 1	24	CTD_human;GENOMICS_ENGLAND;UNIPROT
OPA1	C3276549	OPTIC ATROPHY WITH OR WITHOUT DEAFNESS, OPHTHALMOPLEGIA, MYOPATHY, ATAXIA, AND NEUROPATHY	11	GENOMICS_ENGLAND;UNIPROT
OPA1	C0221061	Behr syndrome	3	CTD_human;GENOMICS_ENGLAND;UNIPROT
OPA1	C0036341	Schizophrenia	2	PSYGENET
OPA1	C1832466	CAPOS syndrome	2	ORPHANET
OPA1	C1847730	GLAUCOMA, NORMAL TENSION, SUSCEPTIBILITY TO (finding)	2	CTD_human;GENOMICS_ENGLAND
OPA1	C0029408	Degenerative polyarthritis	1	CTD_human
OPA1	C0086743	Osteoarthrosis Deformans	1	CTD_human
OPA1	C0600519	Ventricular Remodeling	1	CTD_human
OPA1	C0600520	Left Ventricle Remodeling	1	CTD_human
OPA1	C4225163	MITOCHONDRIAL DNA DEPLETION SYNDROME 14 (CARDIOENCEPHALOMYOPATHIC TYPE)	1	CTD_human;UNIPROT

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene