|
Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples | |
The effects of the RNA editing to the stability of the RNA structures | |
Editing gene: SLC22A10 (CAeditome ID:387775) |
Gene summary for SLC22A10 |
Gene summary |
Gene information | Gene symbol | SLC22A10 | Gene ID | 387775 |
Gene name | solute carrier family 22 member 10 | |
Synonyms | OAT5|hOAT5 | |
Cytomap | 11q12.3 | |
Type of gene | protein-coding | |
Description | solute carrier family 22 member 10organic anion transporter 5solute carrier family 22 (organic anion/cation transporter), member 10 | |
Modification date | 20210518 | |
UniProtAcc | Q63ZE4 | |
Context |
Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Gene | GO ID | GO term | PubMed ID |
Top |
RNA A-to-I events for SLC22A10 |
RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure. |
RNA editing frequencies across 33 cancers of gene: ENSG00000184999.10 |
RNA A-to-I editing events in Cancer. |
CAediting_820369(63145406, +), CAediting_820370(63145446, +), CAediting_820371(63145447, +), CAediting_820372(63145512, +), CAediting_820373(63159545, +), CAediting_820374(63160069, +), CAediting_820375(63160955, +), CAediting_820376(63247570, +), CAediting_820377(63290402, +), CAediting_820378(63297624, +), CAediting_820379(63300164, +), CAediting_820380(63300183, +), CAediting_820381(63310445, +), CAediting_820382(63310450, +), CAediting_820383(63310457, +), CAediting_820384(63310464, +), CAediting_820385(63310494, +), |
Top |
RNA editing positional annotations for SLC22A10 using Annovar |
Protein coding RNA editing(s). |
CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
Gene structure information of RNA editing(s). |
CAeditome ID | Position | Variant type |
CAediting_820369 | chr11_63145406_+ | ncRNA_intronic |
CAediting_820370 | chr11_63145446_+ | ncRNA_intronic |
CAediting_820371 | chr11_63145447_+ | ncRNA_intronic |
CAediting_820372 | chr11_63145512_+ | ncRNA_intronic |
CAediting_820373 | chr11_63159545_+ | ncRNA_intronic |
CAediting_820374 | chr11_63160069_+ | ncRNA_intronic |
CAediting_820375 | chr11_63160955_+ | ncRNA_intronic |
CAediting_820376 | chr11_63247570_+ | ncRNA_intronic |
CAediting_820377 | chr11_63290402_+ | exonic |
CAediting_820378 | chr11_63297624_+ | exonic |
CAediting_820379 | chr11_63300164_+ | ncRNA_intronic |
CAediting_820380 | chr11_63300183_+ | ncRNA_intronic |
CAediting_820381 | chr11_63310445_+ | ncRNA_intronic |
CAediting_820382 | chr11_63310450_+ | ncRNA_intronic |
CAediting_820383 | chr11_63310457_+ | ncRNA_intronic |
CAediting_820384 | chr11_63310464_+ | ncRNA_intronic |
CAediting_820385 | chr11_63310494_+ | ncRNA_intronic |
Repat-regional RNA editing(s). |
CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
CAediting_820369 | chr11_63145406_+ | SINE | Alu | AluSx |
CAediting_820370 | chr11_63145446_+ | SINE | Alu | AluSx |
CAediting_820371 | chr11_63145447_+ | SINE | Alu | AluSx |
CAediting_820372 | chr11_63145512_+ | SINE | Alu | AluSx |
CAediting_820373 | chr11_63159545_+ | LTR | ERVL-MaLR | THE1B |
CAediting_820374 | chr11_63160069_+ | LTR | ERVL-MaLR | THE1B-int |
CAediting_820375 | chr11_63160955_+ | LINE | L1 | L1M1 |
CAediting_820376 | chr11_63247570_+ | SINE | Alu | AluSp |
CAediting_820379 | chr11_63300164_+ | SINE | Alu | AluSx |
CAediting_820380 | chr11_63300183_+ | SINE | Alu | AluSx |
CAediting_820381 | chr11_63310445_+ | LINE | L1 | L1PA15 |
CAediting_820382 | chr11_63310450_+ | LINE | L1 | L1PA15 |
CAediting_820383 | chr11_63310457_+ | LINE | L1 | L1PA15 |
CAediting_820384 | chr11_63310464_+ | LINE | L1 | L1PA15 |
CAediting_820385 | chr11_63310494_+ | LINE | L1 | L1PA15 |
Top |
RNA A-to-I editing events in the alternative splicing sites for SLC22A10 |
RNA A-to-I editing(s) in the alternative splicing sites. |
AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
ES | CAediting_820377 | chr11_63290402_+ | 63290383:63290405 | 3SS | 0+1i | TGAGAATCTCTATCCCACTAGAC | -9.16 | TGAGAATCTCTATCCCACTGGAC | -0.4 |
IR | CAediting_820377 | chr11_63290402_+ | 63290383:63290405 | 3SS | 0+1i | TGAGAATCTCTATCCCACTAGAC | -9.16 | TGAGAATCTCTATCCCACTGGAC | -0.4 |
ES | CAediting_820378 | chr11_63297624_+ | 63297602:63297624 | 3SS | 3+0i | ATTGTCATCTGGTGCCCTTAGTA | -9.77 | ATTGTCATCTGGTGCCCTTAGTG | -9.36 |
Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000184999.10.SLC22A10. |
Correlation between RNA A-to-I editing and PSI for ENSG00000184999.10.SLC22A10. |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for SLC22A10 |
Differential gene expressions between RNA A-to-I edited and non-edited tumor samples. * The grey color means N/A. |
Correlation between RNA A-to-I editing and gene expression. |
- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples. * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for SLC22A10 |
- Lollipop plot for RNA A-to-I editings across protein structure. * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for SLC22A10 |
**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in lncRNA gained miRNA binding sites. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in lncRNA lost miRNA binding sites. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in miRNAs gained binding to lncRNA. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in miRNAs lost binding to lncRNA. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_1160181 | chr17_7017644_- | ENSG00000184999.10 | ENST00000533483 | hsa-miR-195-3p | 63311542 | 63311549 | 8mer-1a | 63311526 | 63311549 | 146 | -13.63 |
RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA. |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
Differentially expressed gene-miRNA network |
Top |
The effects of the RNA editing to the stability of the RNA structures for SLC22A10 |
- RNA A-to-I editing in mRNA. * Click on the image to enlarge it in a new window. |
ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
RNA A-to-I editing in RNA structures for Minimum free energy (MFE). |
CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for SLC22A10 |
Correlation between ADAR gene expression and RNA editing frequency |
Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for SLC22A10 |
Correlation between Cancer stages and RNA editing frequency |
Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for SLC22A10 |
Correlation between RNA editing and survival |
Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for SLC22A10 |
Approved drugs targeting this gene. (DrugBank Version 5.1.8 2021-01-03) |
Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SLC22A10 |
Diseases associated with this gene. (DisGeNet 7.0) |
Gene | Disease ID | Disease name | # pubmeds | Source |
SLC22A10 | C2239176 | Liver carcinoma | 2 | CTD_human |
SLC22A10 | C0007131 | Non-Small Cell Lung Carcinoma | 1 | CTD_human |
SLC22A10 | C0017636 | Glioblastoma | 1 | CTD_human |
SLC22A10 | C0024232 | Lymphatic Metastasis | 1 | CTD_human |
SLC22A10 | C0334588 | Giant Cell Glioblastoma | 1 | CTD_human |
SLC22A10 | C0919267 | ovarian neoplasm | 1 | CTD_human |
SLC22A10 | C1140680 | Malignant neoplasm of ovary | 1 | CTD_human |
SLC22A10 | C1621958 | Glioblastoma Multiforme | 1 | CTD_human |