![]() |
||||||
|
![]() | |
![]() | |
![]() | Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples |
![]() | |
![]() | |
![]() | The effects of the RNA editing to the stability of the RNA structures |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Editing gene: HNRNPK (CAeditome ID:3190) |
Gene summary for HNRNPK |
![]() |
Gene information | Gene symbol | HNRNPK | Gene ID | 3190 |
Gene name | heterogeneous nuclear ribonucleoprotein K | |
Synonyms | AUKS|CSBP|HNRPK|TUNP | |
Cytomap | 9q21.32 | |
Type of gene | protein-coding | |
Description | heterogeneous nuclear ribonucleoprotein KdC-stretch binding proteintransformation upregulated nuclear protein | |
Modification date | 20210518 | |
UniProtAcc | P61978 | |
Context |
![]() |
Gene | GO ID | GO term | PubMed ID |
HNRNPK | GO:0000785 | Heterogeneous nuclear ribonucleoprotein K | 20371611 |
HNRNPK | GO:0005654 | Heterogeneous nuclear ribonucleoprotein K | 0000052 |
HNRNPK | GO:0071013 | Heterogeneous nuclear ribonucleoprotein K | 11991638 |
Top |
RNA A-to-I events for HNRNPK |
![]() |
![]() |
![]() |
![]() |
CAediting_692366(83970316, -), |
Top |
RNA editing positional annotations for HNRNPK using Annovar |
![]() |
CAeditome ID | Position | Variant type | ENST | NTchange | AAchange | SIFT_score | Polyphen2_HVAR_score | PROVEAN_pred |
CAediting_692366 | chr9_83970316_- | nonsynonymous SNV | ENST00000351839.6 | c.A1207G | p.I403V | D | D | N |
CAediting_692366 | chr9_83970316_- | nonsynonymous SNV | ENST00000360384.8 | c.A1207G | p.I403V | D | D | N |
CAediting_692366 | chr9_83970316_- | nonsynonymous SNV | ENST00000376263.6 | c.A1207G | p.I403V | D | D | N |
CAediting_692366 | chr9_83970316_- | nonsynonymous SNV | ENST00000376281.7 | c.A1207G | p.I403V | D | D | N |
CAediting_692366 | chr9_83970316_- | nonsynonymous SNV | ENST00000457156.4 | c.A1135G | p.I379V | D | D | N |
![]() |
CAeditome ID | Position | Variant type |
CAediting_692366 | chr9_83970316_- | exonic |
![]() |
CAeditome ID | Position | Repeat family | Repeat sub family | Repeat name |
Top |
RNA A-to-I editing events in the alternative splicing sites for HNRNPK |
![]() |
AStype | CAeditomID | Editing position | AS position | AS direction | Exonic location | Wildtype sequence | Wildtype splicing strength | RNA edited sequence | RNA edited splicing strength |
ES | CAediting_692366 | chr9_83970316_- | 83970304:83970326 | 3SS | 0+10i | TGGATCTATTATTGGCAAAGGTG | 1.08 | TGGATCTATTGTTGGCAAAGGTG | 1.45 |
IR | CAediting_692366 | chr9_83970316_- | 83970304:83970326 | 3SS | 0+10i | TGGATCTATTATTGGCAAAGGTG | 1.08 | TGGATCTATTGTTGGCAAAGGTG | 1.45 |
![]() |
![]() |
Top |
Differntial gene expression between RNA A-to-I edited versus non-edited samples for HNRNPK |
![]() * The grey color means N/A. |
![]() |
![]() * Click on the image to enlarge it in a new window. |
Top |
Protein coding region RNA A-to-I editings for HNRNPK |
![]() * Click on the image to enlarge it in a new window. |
Top |
The effects of the RNA editing to the miRNA binding sites for HNRNPK |
**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page. |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_393 | chr1_1167164_+ | ENSG00000165119.17 | ENST00000481820 | hsa-miR-200b-3p | 83969716 | 83969722 | 7mer-m8 | 83969715 | 83969736 | 151 | -10.81 |
CAediting_393 | chr1_1167164_+ | ENSG00000165119.17 | ENST00000481820 | hsa-miR-200b-3p | 83969516 | 83969521 | 6mer | 83969515 | 83969536 | 148 | -15.09 |
CAediting_1306324 | chr19_13836464_- | ENSG00000165119.17 | ENST00000472778 | hsa-miR-27a-3p | 83973365 | 83973371 | 7mer-m8 | 83973364 | 83973382 | 152 | -16.91 |
CAediting_1160181 | chr17_7017644_- | ENSG00000165119.17 | ENST00000376281 | hsa-miR-195-3p | 83969156 | 83969163 | 8mer-1a | 83969156 | 83969179 | 154 | -20.32 |
CAediting_1160181 | chr17_7017644_- | ENSG00000165119.17 | ENST00000351839 | hsa-miR-195-3p | 83969156 | 83969163 | 8mer-1a | 83969156 | 83969179 | 154 | -20.32 |
CAediting_1160181 | chr17_7017644_- | ENSG00000165119.17 | ENST00000360384 | hsa-miR-195-3p | 83969156 | 83969163 | 8mer-1a | 83969156 | 83969179 | 154 | -20.32 |
CAediting_1160181 | chr17_7017644_- | ENSG00000165119.17 | ENST00000481820 | hsa-miR-195-3p | 83969592 | 83969598 | 7mer-m8 | 83969591 | 83969612 | 154 | -11.42 |
CAediting_228905 | chr2_188297554_+ | ENSG00000165119.17 | ENST00000481820 | hsa-miR-561-3p | 83969557 | 83969562 | 6mer | 83969556 | 83969577 | 151 | -14.78 |
CAediting_1368054 | chr19_46709310_- | ENSG00000165119.17 | ENST00000472778 | hsa-miR-320e | 83973935 | 83973941 | 7mer-m8 | 83973934 | 83973951 | 144 | -16.1 |
![]() |
CAeditom_ID | Position | ENSG | ENST | miRNA | Targetscan start | Targetscan end | Targetscan score | Miranda start | Miranda end | Miranda score | Miranda energy |
CAediting_524911 | chr7_5495852_- | ENSG00000165119.17 | ENST00000376281 | hsa-miR-589-3p | 83969258 | 83969264 | 7mer-m8 | 83969257 | 83969280 | 140 | -13.86 |
CAediting_524911 | chr7_5495852_- | ENSG00000165119.17 | ENST00000351839 | hsa-miR-589-3p | 83969258 | 83969264 | 7mer-m8 | 83969257 | 83969280 | 140 | -13.86 |
![]() |
Top |
The effects of the RNA editing to the stability of the RNA structures for HNRNPK |
![]() * Click on the image to enlarge it in a new window. |
ENST | ENST type | RNA structure without RNA A-to-I editing. | RNA structure with RNA A-to-I editing. |
![]() |
CAeditom_ID | ENST | Editing_Position | MFE_withoneAI | MFE_withoutAI | MFE_withmultipleAI |
Top |
Relation with ADAR for HNRNPK |
![]() |
Cancer | CAeditomID | position | ADAR1 (p-val) | ADAR1 (coeff.) | ADAR2 (p-val) | ADAR2 (coeff.) | ADAR3 (p-val) | ADAR3 (coeff.) |
Top |
Relation with cancer stages for HNRNPK |
![]() |
Cancer | Stage_type | CAeditomID | position | P-val | Coeff. |
Top |
Relation with survival for HNRNPK |
![]() |
Cancer | CAeditomID | position | KMpvalue | Coxpvalue | CoxHR |
Top |
RelatedDrugs for HNRNPK |
![]() (DrugBank Version 5.1.8 2021-01-03) |
Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for HNRNPK |
![]() (DisGeNet 7.0) |
Gene | Disease ID | Disease name | # pubmeds | Source |
HNRNPK | C4225274 | AU-KLINE SYNDROME | 6 | CTD_human;GENOMICS_ENGLAND;ORPHANET |
HNRNPK | C0006142 | Malignant neoplasm of breast | 1 | CTD_human |
HNRNPK | C0152427 | Polydactyly | 1 | GENOMICS_ENGLAND |
HNRNPK | C0678222 | Breast Carcinoma | 1 | CTD_human |
HNRNPK | C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
HNRNPK | C1458155 | Mammary Neoplasms | 1 | CTD_human |
HNRNPK | C3714756 | Intellectual Disability | 1 | GENOMICS_ENGLAND |
HNRNPK | C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |