Home

Download

Statistics

Examples

Help

Contact

Editing gene: ADAL (CAeditome ID:161823)

Gene summary for ADAL

Gene summary

Gene information	Gene symbol	ADAL
	Gene ID	161823
	Gene name	adenosine deaminase like
	Synonyms	HsMAPDA
	Cytomap	15q15.3
	Type of gene	protein-coding
	Description	adenosine deaminase-like proteinN6-mAMP deaminaseN6-methyl-AMP aminohydrolase
	Modification date	20210526
	UniProtAcc	Q6DHV7
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

RNA A-to-I events for ADAL

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000168803.13

RNA A-to-I editing events in Cancer.

CAediting_1033269(43333309, +), CAediting_1033270(43333350, +), CAediting_1033271(43333360, +), CAediting_1033272(43333361, +), CAediting_1033273(43333400, +), CAediting_1033274(43333403, +), CAediting_1033275(43333419, +), CAediting_1033276(43333433, +), CAediting_1033277(43337155, +), CAediting_1033278(43337226, +), CAediting_1033279(43340595, +), CAediting_1033280(43341700, +), CAediting_1033281(43342568, +), CAediting_1033282(43342670, +), CAediting_1033283(43352439, +), CAediting_1033284(43352444, +), CAediting_1033285(43352456, +), CAediting_1033286(43352462, +), CAediting_1033287(43352484, +), CAediting_1033288(43352503, +), CAediting_1033289(43352508, +), CAediting_1033290(43352514, +), CAediting_1033291(43352517, +), CAediting_1033292(43352586, +), CAediting_1033293(43352596, +), CAediting_1033294(43352603, +), CAediting_1033295(43352608, +), CAediting_1033296(43352609, +), CAediting_1033297(43352665, +), CAediting_1033298(43352670, +), CAediting_1033299(43352694, +), CAediting_1033300(43352695, +), CAediting_1033301(43352706, +), CAediting_1033302(43352964, +), CAediting_1033303(43352965, +), CAediting_1033304(43352967, +), CAediting_1033305(43352969, +), CAediting_1033306(43352977, +), CAediting_1033307(43352996, +), CAediting_1033308(43353005, +), CAediting_1033309(43353013, +), CAediting_1033310(43353015, +), CAediting_1033311(43353069, +),

Top

RNA editing positional annotations for ADAL using Annovar

Protein coding RNA editing(s).

CAeditome ID

Position

Variant type

ENST

NTchange

AAchange

SIFT_score

Polyphen2_HVAR_score

PROVEAN_pred

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_1033269	chr15_43333309_+	splicing
CAediting_1033270	chr15_43333350_+	UTR5
CAediting_1033271	chr15_43333360_+	UTR5
CAediting_1033272	chr15_43333361_+	UTR5
CAediting_1033273	chr15_43333400_+	UTR5
CAediting_1033274	chr15_43333403_+	UTR5
CAediting_1033275	chr15_43333419_+	UTR5
CAediting_1033276	chr15_43333433_+	UTR5
CAediting_1033277	chr15_43337155_+	intronic
CAediting_1033278	chr15_43337226_+	intronic
CAediting_1033279	chr15_43340595_+	intronic
CAediting_1033280	chr15_43341700_+	intronic
CAediting_1033281	chr15_43342568_+	intronic
CAediting_1033282	chr15_43342670_+	intronic
CAediting_1033283	chr15_43352439_+	UTR3
CAediting_1033284	chr15_43352444_+	UTR3
CAediting_1033285	chr15_43352456_+	UTR3
CAediting_1033286	chr15_43352462_+	UTR3
CAediting_1033287	chr15_43352484_+	UTR3
CAediting_1033288	chr15_43352503_+	UTR3
CAediting_1033289	chr15_43352508_+	UTR3
CAediting_1033290	chr15_43352514_+	UTR3
CAediting_1033291	chr15_43352517_+	UTR3
CAediting_1033292	chr15_43352586_+	UTR3
CAediting_1033293	chr15_43352596_+	UTR3
CAediting_1033294	chr15_43352603_+	UTR3
CAediting_1033295	chr15_43352608_+	UTR3
CAediting_1033296	chr15_43352609_+	UTR3
CAediting_1033297	chr15_43352665_+	UTR3
CAediting_1033298	chr15_43352670_+	UTR3
CAediting_1033299	chr15_43352694_+	UTR3
CAediting_1033300	chr15_43352695_+	UTR3
CAediting_1033301	chr15_43352706_+	UTR3
CAediting_1033302	chr15_43352964_+	UTR3
CAediting_1033303	chr15_43352965_+	UTR3
CAediting_1033304	chr15_43352967_+	UTR3
CAediting_1033305	chr15_43352969_+	UTR3
CAediting_1033306	chr15_43352977_+	UTR3
CAediting_1033307	chr15_43352996_+	UTR3
CAediting_1033308	chr15_43353005_+	UTR3
CAediting_1033309	chr15_43353013_+	UTR3
CAediting_1033310	chr15_43353015_+	UTR3
CAediting_1033311	chr15_43353069_+	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_1033269	chr15_43333309_+	SINE	Alu	AluJb
CAediting_1033270	chr15_43333350_+	SINE	Alu	AluJb
CAediting_1033271	chr15_43333360_+	SINE	Alu	AluJb
CAediting_1033272	chr15_43333361_+	SINE	Alu	AluJb
CAediting_1033273	chr15_43333400_+	SINE	Alu	AluJb
CAediting_1033274	chr15_43333403_+	SINE	Alu	AluJb
CAediting_1033275	chr15_43333419_+	SINE	Alu	AluJb
CAediting_1033276	chr15_43333433_+	SINE	Alu	AluJb
CAediting_1033277	chr15_43337155_+	SINE	Alu	AluY
CAediting_1033278	chr15_43337226_+	SINE	Alu	AluY
CAediting_1033279	chr15_43340595_+	SINE	Alu	AluJr4
CAediting_1033280	chr15_43341700_+	SINE	Alu	AluJb
CAediting_1033281	chr15_43342568_+	SINE	Alu	AluSz6
CAediting_1033282	chr15_43342670_+	SINE	Alu	AluSz6
CAediting_1033283	chr15_43352439_+	SINE	Alu	AluJo
CAediting_1033284	chr15_43352444_+	SINE	Alu	AluJo
CAediting_1033285	chr15_43352456_+	SINE	Alu	AluJo
CAediting_1033286	chr15_43352462_+	SINE	Alu	AluJo
CAediting_1033287	chr15_43352484_+	SINE	Alu	AluJo
CAediting_1033288	chr15_43352503_+	SINE	Alu	AluJo
CAediting_1033289	chr15_43352508_+	SINE	Alu	AluJo
CAediting_1033290	chr15_43352514_+	SINE	Alu	AluJo
CAediting_1033291	chr15_43352517_+	SINE	Alu	AluJo
CAediting_1033292	chr15_43352586_+	SINE	Alu	AluJo
CAediting_1033293	chr15_43352596_+	SINE	Alu	AluJo
CAediting_1033294	chr15_43352603_+	SINE	Alu	AluJo
CAediting_1033295	chr15_43352608_+	SINE	Alu	AluJo
CAediting_1033296	chr15_43352609_+	SINE	Alu	AluJo
CAediting_1033297	chr15_43352665_+	SINE	Alu	AluJo
CAediting_1033298	chr15_43352670_+	SINE	Alu	AluJo
CAediting_1033299	chr15_43352694_+	SINE	Alu	AluJo
CAediting_1033300	chr15_43352695_+	SINE	Alu	AluJo
CAediting_1033301	chr15_43352706_+	SINE	Alu	AluJo
CAediting_1033302	chr15_43352964_+	SINE	Alu	AluJb
CAediting_1033303	chr15_43352965_+	SINE	Alu	AluJb
CAediting_1033304	chr15_43352967_+	SINE	Alu	AluJb
CAediting_1033305	chr15_43352969_+	SINE	Alu	AluJb
CAediting_1033306	chr15_43352977_+	SINE	Alu	AluJb
CAediting_1033307	chr15_43352996_+	SINE	Alu	AluJb
CAediting_1033308	chr15_43353005_+	SINE	Alu	AluJb
CAediting_1033309	chr15_43353013_+	SINE	Alu	AluJb
CAediting_1033310	chr15_43353015_+	SINE	Alu	AluJb

Top

RNA A-to-I editing events in the alternative splicing sites for ADAL

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
ES	CAediting_1033269	chr15_43333309_+	43333290:43333312	3SS	0+1i	CCTGTGATCTCTGCTGCTTAGGA	-9.4	CCTGTGATCTCTGCTGCTTGGGA	-0.65
ES	CAediting_1033276	chr15_43333433_+	43333432:43333440	5SS	2+0i	AAGGTATGT	9.79	AGGGTATGT	8.34

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000168803.13.ADAL.

Correlation between RNA A-to-I editing and PSI for ENSG00000168803.13.ADAL.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for ADAL

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

Top

Protein coding region RNA A-to-I editings for ADAL

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for ADAL

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000428046	hsa-miR-129-1-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.06
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000428046	hsa-miR-129-2-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.18
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6780b-3p	43352964	43352970	7mer-m8	43352951	43352971	140.00	-11.04
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000422466	hsa-miR-129-1-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.06
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000422466	hsa-miR-129-2-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.18
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6780b-3p	43352964	43352970	7mer-m8	43352951	43352971	140.00	-11.04
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1233-3p	43352967	43352973	7mer-m8	43352954	43352974	141.00	-13.84
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000566154	hsa-miR-129-1-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.06
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000566154	hsa-miR-129-2-3p	43352966	43352972	7mer-m8	43352952	43352973	151.00	-12.18
CAediting_1033305	chr15_43352969_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6780b-3p	43352964	43352970	7mer-m8	43352951	43352971	140.00	-11.04
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000428046	hsa-miR-8052	43352437	43352443	7mer-1a	43352425	43352443	148.00	-29.06
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000422466	hsa-miR-8052	43352437	43352443	7mer-1a	43352425	43352443	148.00	-29.06
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000566154	hsa-miR-8052	43352437	43352443	7mer-1a	43352425	43352443	148.00	-29.06
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000428046	hsa-miR-371a-3p	43352442	43352448	7mer-m8	43352427	43352449	144.00	-15.05
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000422466	hsa-miR-371a-3p	43352442	43352448	7mer-m8	43352427	43352449	144.00	-15.05
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000566154	hsa-miR-371a-3p	43352442	43352448	7mer-m8	43352427	43352449	144.00	-15.05
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000428046	hsa-miR-150-5p	43352449	43352455	7mer-m8	43352435	43352456	140.00	-15.80
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6778-3p	43352451	43352457	7mer-m8	43352438	43352458	143.00	-13.97
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6878-3p	43352453	43352460	8mer-1a	43352440	43352460	142.00	-14.14
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000422466	hsa-miR-150-5p	43352449	43352455	7mer-m8	43352435	43352456	140.00	-15.80
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6778-3p	43352451	43352457	7mer-m8	43352438	43352458	143.00	-13.97
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6878-3p	43352453	43352460	8mer-1a	43352440	43352460	142.00	-14.14
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000566154	hsa-miR-150-5p	43352449	43352455	7mer-m8	43352435	43352456	140.00	-15.80
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6778-3p	43352451	43352457	7mer-m8	43352438	43352458	143.00	-13.97
CAediting_1033285	chr15_43352456_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6878-3p	43352453	43352460	8mer-1a	43352440	43352460	142.00	-14.14
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1224-3p	43352460	43352466	7mer-m8	43352447	43352467	149.00	-19.52
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000428046	hsa-miR-212-5p	43352456	43352462	7mer-m8	43352439	43352463	166.00	-23.48
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6813-3p	43352457	43352463	7mer-m8	43352444	43352464	150.00	-18.90
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1224-3p	43352460	43352466	7mer-m8	43352447	43352467	149.00	-19.52
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000422466	hsa-miR-212-5p	43352456	43352462	7mer-m8	43352439	43352463	166.00	-23.48
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6813-3p	43352457	43352463	7mer-m8	43352444	43352464	150.00	-18.90
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1224-3p	43352460	43352466	7mer-m8	43352447	43352467	149.00	-19.52
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000566154	hsa-miR-212-5p	43352456	43352462	7mer-m8	43352439	43352463	166.00	-23.48
CAediting_1033286	chr15_43352462_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6813-3p	43352457	43352463	7mer-m8	43352444	43352464	150.00	-18.90
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6764-5p	43352480	43352486	7mer-1a	43352465	43352486	140.00	-25.98
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6840-3p	43352479	43352486	8mer-1a	43352467	43352486	143.00	-18.84
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6764-5p	43352480	43352486	7mer-1a	43352465	43352486	140.00	-25.98
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6840-3p	43352479	43352486	8mer-1a	43352467	43352486	143.00	-18.84
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6764-5p	43352480	43352486	7mer-1a	43352465	43352486	140.00	-25.98
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6840-3p	43352479	43352486	8mer-1a	43352467	43352486	143.00	-18.84
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4726-3p	43352499	43352504	6mer	43352484	43352505	143.00	-21.38
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4726-3p	43352499	43352504	6mer	43352484	43352505	143.00	-21.38
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4726-3p	43352499	43352504	6mer	43352484	43352505	143.00	-21.38
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1182	43352515	43352521	7mer-m8	43352500	43352522	141.00	-14.18
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6873-3p	43352512	43352517	6mer	43352496	43352518	140.00	-11.00
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6895-3p	43352512	43352518	7mer-m8	43352499	43352519	149.00	-17.69
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1182	43352515	43352521	7mer-m8	43352500	43352522	141.00	-14.18
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6873-3p	43352512	43352517	6mer	43352496	43352518	140.00	-11.00
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6895-3p	43352512	43352518	7mer-m8	43352499	43352519	149.00	-17.69
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1182	43352515	43352521	7mer-m8	43352500	43352522	141.00	-14.18
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6873-3p	43352512	43352517	6mer	43352496	43352518	140.00	-11.00
CAediting_1033291	chr15_43352517_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6895-3p	43352512	43352518	7mer-m8	43352499	43352519	149.00	-17.69
CAediting_1033292	chr15_43352586_+	ENSG00000168803.13	ENST00000428046	hsa-miR-140-3p	43352581	43352587	7mer-m8	43352568	43352588	164.00	-25.37
CAediting_1033292	chr15_43352586_+	ENSG00000168803.13	ENST00000422466	hsa-miR-140-3p	43352581	43352587	7mer-m8	43352568	43352588	164.00	-25.37
CAediting_1033292	chr15_43352586_+	ENSG00000168803.13	ENST00000566154	hsa-miR-140-3p	43352581	43352587	7mer-m8	43352568	43352588	164.00	-25.37
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6770-3p	43352592	43352598	7mer-m8	43352579	43352599	166.00	-28.09
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-331-3p	43352596	43352602	7mer-m8	43352582	43352603	143.00	-18.14
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-3943	43352600	43352607	8mer-1a	43352586	43352607	143.00	-23.66
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-331-3p	43352596	43352602	7mer-m8	43352582	43352603	143.00	-18.14
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-3943	43352600	43352607	8mer-1a	43352586	43352607	143.00	-23.66
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-331-3p	43352596	43352602	7mer-m8	43352582	43352603	143.00	-18.14
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-3943	43352600	43352607	8mer-1a	43352586	43352607	143.00	-23.66
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000428046	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000428046	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000428046	hsa-miR-107	43352659	43352666	8mer-1a	43352644	43352666	148.00	-16.04
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000422466	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000422466	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000422466	hsa-miR-107	43352659	43352666	8mer-1a	43352644	43352666	148.00	-16.04
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000566154	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000566154	hsa-miR-103a-3p	43352659	43352666	8mer-1a	43352644	43352666	148.00	-17.50
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000566154	hsa-miR-107	43352659	43352666	8mer-1a	43352644	43352666	148.00	-16.04
CAediting_1033299	chr15_43352694_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1182	43352692	43352698	7mer-m8	43352677	43352699	142.00	-13.29
CAediting_1033299	chr15_43352694_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1182	43352692	43352698	7mer-m8	43352677	43352699	142.00	-13.29
CAediting_1033299	chr15_43352694_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1182	43352692	43352698	7mer-m8	43352677	43352699	142.00	-13.29
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000428046	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000428046	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6837-3p	43352688	43352694	7mer-m8	43352670	43352695	150.00	-20.27
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000422466	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000422466	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6837-3p	43352688	43352694	7mer-m8	43352670	43352695	150.00	-20.27
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000566154	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000566154	hsa-miR-3158-3p	43352692	43352698	7mer-m8	43352674	43352699	161.00	-27.63
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6837-3p	43352688	43352694	7mer-m8	43352670	43352695	150.00	-20.27
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6882-3p	43352502	43352509	8mer-1a	43352487	43352509	151.00	-19.87
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6882-3p	43352502	43352509	8mer-1a	43352487	43352509	151.00	-19.87
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6882-3p	43352502	43352509	8mer-1a	43352487	43352509	151.00	-19.87
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000428046	hsa-miR-324-3p	43352998	43353004	7mer-m8	43352983	43353005	148.00	-24.73
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4252	43352999	43353006	8mer-1a	43352986	43353006	149.00	-22.82
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000422466	hsa-miR-324-3p	43352998	43353004	7mer-m8	43352983	43353005	148.00	-24.73
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4252	43352999	43353006	8mer-1a	43352986	43353006	149.00	-22.82
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000566154	hsa-miR-324-3p	43352998	43353004	7mer-m8	43352983	43353005	148.00	-24.73
CAediting_1033308	chr15_43353005_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4252	43352999	43353006	8mer-1a	43352986	43353006	149.00	-22.82

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000428046	hsa-miR-10399-5p	43352433	43352439	7mer-m8	43352419	43352440	144	-10.64
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000428046	hsa-miR-20b-3p	43352662	43352667	6mer	43352648	43352668	141	-15.47
CAediting_1033311	chr15_43353069_+	ENSG00000168803.13	ENST00000428046	hsa-miR-2115-5p	43353064	43353070	7mer-m8	43353050	43353071	147	-15.53
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4423-5p	43352502	43352509	8mer-1a	43352487	43352509	144	-14.71
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4716-5p	43352506	43352513	8mer-1a	43352492	43352513	152	-16.81
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000428046	hsa-miR-504-3p	43352667	43352674	8mer-1a	43352653	43352674	149	-17.58
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000428046	hsa-miR-508-5p	43352991	43352997	7mer-m8	43352974	43352998	144	-19.5
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000428046	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000428046	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033301	chr15_43352706_+	ENSG00000168803.13	ENST00000428046	hsa-miR-510-3p	43352699	43352705	7mer-m8	43352686	43352706	140	-7.64
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000428046	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000428046	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000428046	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000428046	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000428046	hsa-miR-5571-3p	43352480	43352486	7mer-m8	43352469	43352487	145	-13.67
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000428046	hsa-miR-5586-3p	43352974	43352980	7mer-m8	43352959	43352981	151	-19.24
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6501-5p	43352503	43352509	7mer-1a	43352488	43352509	144	-26.43
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6506-5p	43352438	43352444	7mer-m8	43352423	43352445	144	-16.21
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6512-3p	43352989	43352995	7mer-m8	43352975	43352996	142	-17.01
CAediting_1033302	chr15_43352964_+	ENSG00000168803.13	ENST00000428046	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033303	chr15_43352965_+	ENSG00000168803.13	ENST00000428046	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033304	chr15_43352967_+	ENSG00000168803.13	ENST00000428046	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6720-5p	43352989	43352995	7mer-m8	43352975	43352996	148	-21.94
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6778-3p	43352599	43352605	7mer-m8	43352586	43352606	150	-19.5
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6791-3p	43352600	43352605	6mer	43352586	43352606	150	-25.13
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6823-5p	43352693	43352699	7mer-m8	43352680	43352700	140	-20.04
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6829-3p	43352600	43352605	6mer	43352587	43352606	143	-22.29
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000428046	hsa-miR-6842-3p	43352589	43352595	7mer-m8	43352576	43352596	141	-16.15
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000428046	hsa-miR-7113-3p	43352597	43352603	7mer-m8	43352582	43352604	141	-23.46
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000428046	hsa-miR-744-3p	43352503	43352509	7mer-m8	43352490	43352510	144	-9.78
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000428046	hsa-miR-759	43352975	43352981	7mer-m8	43352960	43352982	151	-16.04
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000428046	hsa-miR-766-3p	43352990	43352996	7mer-m8	43352976	43352997	145	-20.72
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000422466	hsa-miR-10399-5p	43352433	43352439	7mer-m8	43352419	43352440	144	-10.64
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000422466	hsa-miR-20b-3p	43352662	43352667	6mer	43352648	43352668	141	-15.47
CAediting_1033311	chr15_43353069_+	ENSG00000168803.13	ENST00000422466	hsa-miR-2115-5p	43353064	43353070	7mer-m8	43353050	43353071	147	-15.53
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4423-5p	43352502	43352509	8mer-1a	43352487	43352509	144	-14.71
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4716-5p	43352506	43352513	8mer-1a	43352492	43352513	152	-16.81
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000422466	hsa-miR-504-3p	43352667	43352674	8mer-1a	43352653	43352674	149	-17.58
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000422466	hsa-miR-508-5p	43352991	43352997	7mer-m8	43352974	43352998	144	-19.5
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000422466	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000422466	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033301	chr15_43352706_+	ENSG00000168803.13	ENST00000422466	hsa-miR-510-3p	43352699	43352705	7mer-m8	43352686	43352706	140	-7.64
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000422466	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000422466	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000422466	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000422466	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000422466	hsa-miR-5571-3p	43352480	43352486	7mer-m8	43352469	43352487	145	-13.67
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000422466	hsa-miR-5586-3p	43352974	43352980	7mer-m8	43352959	43352981	151	-19.24
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6501-5p	43352503	43352509	7mer-1a	43352488	43352509	144	-26.43
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6506-5p	43352438	43352444	7mer-m8	43352423	43352445	144	-16.21
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6512-3p	43352989	43352995	7mer-m8	43352975	43352996	142	-17.01
CAediting_1033302	chr15_43352964_+	ENSG00000168803.13	ENST00000422466	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033303	chr15_43352965_+	ENSG00000168803.13	ENST00000422466	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033304	chr15_43352967_+	ENSG00000168803.13	ENST00000422466	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6720-5p	43352989	43352995	7mer-m8	43352975	43352996	148	-21.94
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6778-3p	43352599	43352605	7mer-m8	43352586	43352606	150	-19.5
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6791-3p	43352600	43352605	6mer	43352586	43352606	150	-25.13
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6823-5p	43352693	43352699	7mer-m8	43352680	43352700	140	-20.04
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6829-3p	43352600	43352605	6mer	43352587	43352606	143	-22.29
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000422466	hsa-miR-6842-3p	43352589	43352595	7mer-m8	43352576	43352596	141	-16.15
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000422466	hsa-miR-7113-3p	43352597	43352603	7mer-m8	43352582	43352604	141	-23.46
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000422466	hsa-miR-744-3p	43352503	43352509	7mer-m8	43352490	43352510	144	-9.78
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000422466	hsa-miR-759	43352975	43352981	7mer-m8	43352960	43352982	151	-16.04
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000422466	hsa-miR-766-3p	43352990	43352996	7mer-m8	43352976	43352997	145	-20.72
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000566154	hsa-miR-10399-5p	43352433	43352439	7mer-m8	43352419	43352440	144	-10.64
CAediting_1033297	chr15_43352665_+	ENSG00000168803.13	ENST00000566154	hsa-miR-20b-3p	43352662	43352667	6mer	43352648	43352668	141	-15.47
CAediting_1033311	chr15_43353069_+	ENSG00000168803.13	ENST00000566154	hsa-miR-2115-5p	43353064	43353070	7mer-m8	43353050	43353071	147	-15.53
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4423-5p	43352502	43352509	8mer-1a	43352487	43352509	144	-14.71
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033309	chr15_43353013_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033310	chr15_43353015_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4679	43353009	43353016	8mer-1a	43352995	43353016	145	-15.75
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4716-5p	43352506	43352513	8mer-1a	43352492	43352513	152	-16.81
CAediting_1033288	chr15_43352503_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-4774-3p	43352501	43352507	7mer-m8	43352488	43352508	143	-11.14
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000566154	hsa-miR-504-3p	43352667	43352674	8mer-1a	43352653	43352674	149	-17.58
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000566154	hsa-miR-508-5p	43352991	43352997	7mer-m8	43352974	43352998	144	-19.5
CAediting_1033283	chr15_43352439_+	ENSG00000168803.13	ENST00000566154	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000566154	hsa-miR-5089-5p	43352437	43352443	7mer-m8	43352425	43352444	146	-13.24
CAediting_1033301	chr15_43352706_+	ENSG00000168803.13	ENST00000566154	hsa-miR-510-3p	43352699	43352705	7mer-m8	43352686	43352706	140	-7.64
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000566154	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000566154	hsa-miR-512-3p	43352442	43352448	7mer-m8	43352428	43352449	149	-15
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000566154	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033298	chr15_43352670_+	ENSG00000168803.13	ENST00000566154	hsa-miR-512-3p	43352665	43352671	7mer-m8	43352646	43352672	153	-21.13
CAediting_1033287	chr15_43352484_+	ENSG00000168803.13	ENST00000566154	hsa-miR-5571-3p	43352480	43352486	7mer-m8	43352469	43352487	145	-13.67
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000566154	hsa-miR-5586-3p	43352974	43352980	7mer-m8	43352959	43352981	151	-19.24
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6501-5p	43352503	43352509	7mer-1a	43352488	43352509	144	-26.43
CAediting_1033284	chr15_43352444_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6506-5p	43352438	43352444	7mer-m8	43352423	43352445	144	-16.21
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6512-3p	43352989	43352995	7mer-m8	43352975	43352996	142	-17.01
CAediting_1033302	chr15_43352964_+	ENSG00000168803.13	ENST00000566154	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033303	chr15_43352965_+	ENSG00000168803.13	ENST00000566154	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033304	chr15_43352967_+	ENSG00000168803.13	ENST00000566154	hsa-miR-653-5p	43352960	43352967	8mer-1a	43352947	43352967	152	-7.53
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6720-5p	43352989	43352995	7mer-m8	43352975	43352996	148	-21.94
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6778-3p	43352599	43352605	7mer-m8	43352586	43352606	150	-19.5
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6791-3p	43352600	43352605	6mer	43352586	43352606	150	-25.13
CAediting_1033300	chr15_43352695_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6823-5p	43352693	43352699	7mer-m8	43352680	43352700	140	-20.04
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6829-3p	43352600	43352605	6mer	43352587	43352606	143	-22.29
CAediting_1033293	chr15_43352596_+	ENSG00000168803.13	ENST00000566154	hsa-miR-6842-3p	43352589	43352595	7mer-m8	43352576	43352596	141	-16.15
CAediting_1033294	chr15_43352603_+	ENSG00000168803.13	ENST00000566154	hsa-miR-7113-3p	43352597	43352603	7mer-m8	43352582	43352604	141	-23.46
CAediting_1033289	chr15_43352508_+	ENSG00000168803.13	ENST00000566154	hsa-miR-744-3p	43352503	43352509	7mer-m8	43352490	43352510	144	-9.78
CAediting_1033306	chr15_43352977_+	ENSG00000168803.13	ENST00000566154	hsa-miR-759	43352975	43352981	7mer-m8	43352960	43352982	151	-16.04
CAediting_1033307	chr15_43352996_+	ENSG00000168803.13	ENST00000566154	hsa-miR-766-3p	43352990	43352996	7mer-m8	43352976	43352997	145	-20.72

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_748296	chr10_51299626_+	ENSG00000168803.13	ENST00000428046	hsa-miR-605-3p	43352833	43352839	7mer-m8	43352819	43352840	163	-23.34
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000428046	hsa-miR-624-3p	43353476	43353482	7mer-m8	43353463	43353483	140	-13.41
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000428046	hsa-miR-624-3p	43352517	43352523	7mer-m8	43352504	43352524	148	-12.27
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000428046	hsa-miR-624-3p	43352694	43352700	7mer-m8	43352681	43352701	148	-12.78
CAediting_748296	chr10_51299626_+	ENSG00000168803.13	ENST00000422466	hsa-miR-605-3p	43352833	43352839	7mer-m8	43352819	43352840	163	-23.34
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000422466	hsa-miR-624-3p	43353476	43353482	7mer-m8	43353463	43353483	140	-13.41
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000422466	hsa-miR-624-3p	43352517	43352523	7mer-m8	43352504	43352524	148	-12.27
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000422466	hsa-miR-624-3p	43352694	43352700	7mer-m8	43352681	43352701	148	-12.78
CAediting_393	chr1_1167164_+	ENSG00000168803.13	ENST00000422466	hsa-miR-200b-3p	43354333	43354339	7mer-1a	43354319	43354339	140	-14.72
CAediting_748296	chr10_51299626_+	ENSG00000168803.13	ENST00000566154	hsa-miR-605-3p	43352833	43352839	7mer-m8	43352819	43352840	163	-23.34
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000566154	hsa-miR-624-3p	43352517	43352523	7mer-m8	43352504	43352524	148	-12.27
CAediting_980496	chr14_31014685_-	ENSG00000168803.13	ENST00000566154	hsa-miR-624-3p	43352694	43352700	7mer-m8	43352681	43352701	148	-12.78
CAediting_1229414	chr17_67471546_+	ENSG00000168803.13	ENST00000428046	hsa-miR-548aa	43353467	43353473	7mer-m8	43353448	43353474	161	-15.24
CAediting_1229415	chr17_67471547_+	ENSG00000168803.13	ENST00000428046	hsa-miR-548aa	43353527	43353533	7mer-m8	43353513	43353534	152	-14.53
CAediting_1160181	chr17_7017644_-	ENSG00000168803.13	ENST00000428046	hsa-miR-195-3p	43353130	43353136	7mer-m8	43353116	43353137	158	-15.31
CAediting_228905	chr2_188297554_+	ENSG00000168803.13	ENST00000428046	hsa-miR-561-3p	43353631	43353637	7mer-m8	43353615	43353638	143	-10.21
CAediting_442554	chr5_154685830_+	ENSG00000168803.13	ENST00000428046	hsa-miR-1303	43352721	43352727	7mer-m8	43352709	43352728	141	-13.17
CAediting_442554	chr5_154685830_+	ENSG00000168803.13	ENST00000389651	hsa-miR-1303	43349274	43349280	7mer-m8	43349260	43349281	140	-10.98
CAediting_1229414	chr17_67471546_+	ENSG00000168803.13	ENST00000422466	hsa-miR-548aa	43353467	43353473	7mer-m8	43353448	43353474	161	-15.24
CAediting_1229415	chr17_67471547_+	ENSG00000168803.13	ENST00000422466	hsa-miR-548aa	43353527	43353533	7mer-m8	43353513	43353534	152	-14.53
CAediting_1160181	chr17_7017644_-	ENSG00000168803.13	ENST00000422466	hsa-miR-195-3p	43353130	43353136	7mer-m8	43353116	43353137	158	-15.31
CAediting_228905	chr2_188297554_+	ENSG00000168803.13	ENST00000422466	hsa-miR-561-3p	43353631	43353637	7mer-m8	43353615	43353638	143	-10.21
CAediting_442554	chr5_154685830_+	ENSG00000168803.13	ENST00000422466	hsa-miR-1303	43352721	43352727	7mer-m8	43352709	43352728	141	-13.17
CAediting_1160181	chr17_7017644_-	ENSG00000168803.13	ENST00000566154	hsa-miR-195-3p	43353130	43353136	7mer-m8	43353116	43353137	158	-15.31
CAediting_442554	chr5_154685830_+	ENSG00000168803.13	ENST00000566154	hsa-miR-1303	43352721	43352727	7mer-m8	43352709	43352728	141	-13.17
CAediting_524911	chr7_5495852_-	ENSG00000168803.13	ENST00000566154	hsa-miR-589-3p	43351444	43351450	7mer-m8	43351428	43351451	140	-13.9
CAediting_524911	chr7_5495852_-	ENSG00000168803.13	ENST00000566154	hsa-miR-589-3p	43351559	43351565	7mer-m8	43351542	43351566	142	-18.06

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1229414	chr17_67471546_+	ENSG00000168803.13	ENST00000428046	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_1229415	chr17_67471547_+	ENSG00000168803.13	ENST00000428046	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_86358	chr1_109598906_+	ENSG00000168803.13	ENST00000422466	hsa-miR-197-5p	43354348	43354354	7mer-m8	43354333	43354355	147	-16.81
CAediting_1229414	chr17_67471546_+	ENSG00000168803.13	ENST00000422466	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_1229415	chr17_67471547_+	ENSG00000168803.13	ENST00000422466	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_1229413	chr17_67471544_+	ENSG00000168803.13	ENST00000422466	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_1229415	chr17_67471547_+	ENSG00000168803.13	ENST00000566154	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43
CAediting_1229413	chr17_67471544_+	ENSG00000168803.13	ENST00000566154	hsa-miR-548aa	43352827	43352833	7mer-m8	43352810	43352834	145	-15.43

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for ADAL

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST

ENST type

RNA structure without RNA A-to-I editing.

RNA structure with RNA A-to-I editing.

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID

ENST

Editing_Position

MFE_withoneAI

MFE_withoutAI

MFE_withmultipleAI

Top

Relation with ADAR for ADAL

Correlation between ADAR gene expression and RNA editing frequency

Cancer	CAeditomID	position	ADAR1 (p-val)	ADAR1 (coeff.)	ADAR2 (p-val)	ADAR2 (coeff.)	ADAR3 (p-val)	ADAR3 (coeff.)
LGG	CAediting_1033305	chr15_43352969_+	2.52866826043923e-05	0.352769427937347	.	.	.	.
BRCA	CAediting_1033305	chr15_43352969_+	4.29368331311521e-20	0.504062839179159	.	.	.	.
LIHC	CAediting_1033305	chr15_43352969_+	0.00175485454634319	0.419750901554789	.	.	.	.
LUSC	CAediting_1033305	chr15_43352969_+	0.00167852358629259	0.379419405765834	.	.	.	.
THCA	CAediting_1033305	chr15_43352969_+	0.000770694521715879	0.305418580715521	0.0104546478936184	0.234898394129761	.	.
SKCM	CAediting_1033305	chr15_43352969_+	1.9943389101405e-06	0.344850720382705	.	.	.	.
SARC	CAediting_1033305	chr15_43352969_+	0.000523507908884534	0.42781662433757	.	.	.	.
TGCT	CAediting_1033305	chr15_43352969_+	0.0357362606914509	0.29478609135813	.	.	.	.

Top

Relation with cancer stages for ADAL

Correlation between Cancer stages and RNA editing frequency

Cancer	Stage_type	CAeditomID	position	P-val	Coeff.
TGCT	clinical_stage	CAediting_1033305	chr15_43352969_+	0.0409478824770601	0.420135065116093

Top

Relation with survival for ADAL

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for ADAL

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for ADAL

Diseases associated with this gene.
(DisGeNet 7.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene