Home

Download

Statistics

Examples

Help

Contact

Editing gene: COX6B2 (CAeditome ID:125965)

Gene summary for COX6B2

Gene summary

Gene information	Gene symbol	COX6B2
	Gene ID	125965
	Gene name	cytochrome c oxidase subunit 6B2
	Synonyms	COXVIB2\|CT59
	Cytomap	19q13.42
	Type of gene	protein-coding
	Description	cytochrome c oxidase subunit 6B2COX VIb-2cancer/testis antigen 59cytochrome c oxidase subunit VIb polypeptide 2 (testis)cytochrome c oxidase subunit VIb, testes-specific
	Modification date	20210518
	UniProtAcc	Q6YFQ2
	Context

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene	GO ID	GO term	PubMed ID
COX6B2	GO:0030061	Cytochrome c oxidase subunit 6B2	12874793

Top

RNA A-to-I events for COX6B2

RNA A-to-I editing events across TCGA 33 cancers data sets based on Ensembl gene isoform structure.

RNA editing frequencies across 33 cancers of gene: ENSG00000160471.11

RNA A-to-I editing events in Cancer.

CAediting_1391238(55349334, -), CAediting_1391239(55349347, -), CAediting_1391240(55349349, -), CAediting_1391241(55349354, -), CAediting_1391242(55349358, -), CAediting_1391243(55349374, -), CAediting_1391244(55349379, -), CAediting_1391245(55349393, -), CAediting_1391246(55349406, -), CAediting_1391247(55349410, -), CAediting_1391248(55349414, -), CAediting_1391249(55349422, -), CAediting_1391250(55349440, -), CAediting_1391251(55349449, -), CAediting_1391252(55349482, -), CAediting_1391253(55349490, -), CAediting_1391254(55349510, -), CAediting_1391255(55349515, -), CAediting_1391256(55349529, -), CAediting_1391257(55349535, -), CAediting_1391258(55349562, -), CAediting_1391259(55349564, -), CAediting_1391260(55349869, -), CAediting_1391261(55349883, -), CAediting_1391262(55349884, -), CAediting_1391263(55349898, -), CAediting_1391264(55349907, -), CAediting_1391265(55349962, -), CAediting_1391266(55349965, -), CAediting_1391267(55349978, -), CAediting_1391268(55349983, -), CAediting_1391269(55350003, -), CAediting_1391270(55350027, -), CAediting_1391271(55350075, -), CAediting_1391272(55350080, -), CAediting_1391273(55350091, -), CAediting_1391274(55350122, -), CAediting_1391275(55350124, -), CAediting_1391276(55350126, -), CAediting_1391277(55350142, -), CAediting_1391278(55350148, -),

Top

RNA editing positional annotations for COX6B2 using Annovar

Protein coding RNA editing(s).

CAeditome ID

Position

Variant type

ENST

NTchange

AAchange

SIFT_score

Polyphen2_HVAR_score

PROVEAN_pred

Gene structure information of RNA editing(s).

CAeditome ID	Position	Variant type
CAediting_1391238	chr19_55349334_-	UTR3
CAediting_1391239	chr19_55349347_-	UTR3
CAediting_1391240	chr19_55349349_-	UTR3
CAediting_1391241	chr19_55349354_-	UTR3
CAediting_1391242	chr19_55349358_-	UTR3
CAediting_1391243	chr19_55349374_-	UTR3
CAediting_1391244	chr19_55349379_-	UTR3
CAediting_1391245	chr19_55349393_-	UTR3
CAediting_1391246	chr19_55349406_-	UTR3
CAediting_1391247	chr19_55349410_-	UTR3
CAediting_1391248	chr19_55349414_-	UTR3
CAediting_1391249	chr19_55349422_-	UTR3
CAediting_1391250	chr19_55349440_-	UTR3
CAediting_1391251	chr19_55349449_-	UTR3
CAediting_1391252	chr19_55349482_-	UTR3
CAediting_1391253	chr19_55349490_-	UTR3
CAediting_1391254	chr19_55349510_-	UTR3
CAediting_1391255	chr19_55349515_-	UTR3
CAediting_1391256	chr19_55349529_-	UTR3
CAediting_1391257	chr19_55349535_-	UTR3
CAediting_1391258	chr19_55349562_-	UTR3
CAediting_1391259	chr19_55349564_-	UTR3
CAediting_1391260	chr19_55349869_-	UTR3
CAediting_1391261	chr19_55349883_-	UTR3
CAediting_1391262	chr19_55349884_-	UTR3
CAediting_1391263	chr19_55349898_-	UTR3
CAediting_1391264	chr19_55349907_-	UTR3
CAediting_1391265	chr19_55349962_-	UTR3
CAediting_1391266	chr19_55349965_-	UTR3
CAediting_1391267	chr19_55349978_-	UTR3
CAediting_1391268	chr19_55349983_-	UTR3
CAediting_1391269	chr19_55350003_-	UTR3
CAediting_1391270	chr19_55350027_-	UTR3
CAediting_1391271	chr19_55350075_-	UTR3
CAediting_1391272	chr19_55350080_-	UTR3
CAediting_1391273	chr19_55350091_-	UTR3
CAediting_1391274	chr19_55350122_-	UTR3
CAediting_1391275	chr19_55350124_-	UTR3
CAediting_1391276	chr19_55350126_-	UTR3
CAediting_1391277	chr19_55350142_-	UTR3
CAediting_1391278	chr19_55350148_-	UTR3

Repat-regional RNA editing(s).

CAeditome ID	Position	Repeat family	Repeat sub family	Repeat name
CAediting_1391238	chr19_55349334_-	SINE	Alu	AluJb
CAediting_1391239	chr19_55349347_-	SINE	Alu	AluJb
CAediting_1391240	chr19_55349349_-	SINE	Alu	AluJb
CAediting_1391241	chr19_55349354_-	SINE	Alu	AluJb
CAediting_1391242	chr19_55349358_-	SINE	Alu	AluJb
CAediting_1391243	chr19_55349374_-	SINE	Alu	AluJb
CAediting_1391244	chr19_55349379_-	SINE	Alu	AluJb
CAediting_1391245	chr19_55349393_-	SINE	Alu	AluJb
CAediting_1391246	chr19_55349406_-	SINE	Alu	AluJb
CAediting_1391247	chr19_55349410_-	SINE	Alu	AluJb
CAediting_1391248	chr19_55349414_-	SINE	Alu	AluJb
CAediting_1391249	chr19_55349422_-	SINE	Alu	AluJb
CAediting_1391250	chr19_55349440_-	SINE	Alu	AluJb
CAediting_1391251	chr19_55349449_-	SINE	Alu	AluJb
CAediting_1391252	chr19_55349482_-	SINE	Alu	AluJb
CAediting_1391253	chr19_55349490_-	SINE	Alu	AluJb
CAediting_1391254	chr19_55349510_-	SINE	Alu	AluJb
CAediting_1391255	chr19_55349515_-	SINE	Alu	AluJb
CAediting_1391256	chr19_55349529_-	SINE	Alu	AluJb
CAediting_1391257	chr19_55349535_-	SINE	Alu	AluJb
CAediting_1391258	chr19_55349562_-	SINE	Alu	AluJb
CAediting_1391259	chr19_55349564_-	SINE	Alu	AluJb
CAediting_1391260	chr19_55349869_-	SINE	Alu	AluSp
CAediting_1391261	chr19_55349883_-	SINE	Alu	AluSp
CAediting_1391262	chr19_55349884_-	SINE	Alu	AluSp
CAediting_1391263	chr19_55349898_-	SINE	Alu	AluSp
CAediting_1391264	chr19_55349907_-	SINE	Alu	AluSp
CAediting_1391265	chr19_55349962_-	SINE	Alu	AluSp
CAediting_1391266	chr19_55349965_-	SINE	Alu	AluSp
CAediting_1391267	chr19_55349978_-	SINE	Alu	AluSp
CAediting_1391268	chr19_55349983_-	SINE	Alu	AluSp
CAediting_1391269	chr19_55350003_-	SINE	Alu	AluSp
CAediting_1391270	chr19_55350027_-	SINE	Alu	AluSp
CAediting_1391271	chr19_55350075_-	SINE	Alu	AluSp
CAediting_1391272	chr19_55350080_-	SINE	Alu	AluSp
CAediting_1391273	chr19_55350091_-	SINE	Alu	AluSp
CAediting_1391274	chr19_55350122_-	SINE	Alu	AluSp
CAediting_1391275	chr19_55350124_-	SINE	Alu	AluSp
CAediting_1391276	chr19_55350126_-	SINE	Alu	AluSp
CAediting_1391277	chr19_55350142_-	SINE	Alu	AluSp
CAediting_1391278	chr19_55350148_-	SINE	Alu	AluSp

Top

RNA A-to-I editing events in the alternative splicing sites for COX6B2

RNA A-to-I editing(s) in the alternative splicing sites.

AStype	CAeditomID	Editing position	AS position	AS direction	Exonic location	Wildtype sequence	Wildtype splicing strength	RNA edited sequence	RNA edited splicing strength
IR	CAediting_1391274	chr19_55350122_-	55350118:55350140	3SS	0+2i	TTTTATTTTTTTTGAGACAGAGT	2.26	TTTTATTTTTTTTGAGACGGAGT	-5.69
IR	CAediting_1391275	chr19_55350124_-	55350118:55350140	3SS	0+4i	TTTTATTTTTTTTGAGACAGAGT	2.26	TTTTATTTTTTTTGAGGCAGAGT	2.28
IR	CAediting_1391276	chr19_55350126_-	55350118:55350140	3SS	0+6i	TTTTATTTTTTTTGAGACAGAGT	2.26	TTTTATTTTTTTTGGGACAGAGT	6.38

Differential percent of spliced in (PSI) between RNA A-to-I edited and non-edited samples for ENSG00000160471.11.COX6B2.

Correlation between RNA A-to-I editing and PSI for ENSG00000160471.11.COX6B2.

Top

Differntial gene expression between RNA A-to-I edited versus non-edited samples for COX6B2

Differential gene expressions between RNA A-to-I edited and non-edited tumor samples.
* The grey color means N/A.

Correlation between RNA A-to-I editing and gene expression.

- Differentially expressed gene between RNA A-to-I edited samples versus non-edited samples.
* Click on the image to enlarge it in a new window.

THYM.CAediting_1391258.ENSG00000160471.COX6B2.png
Soverview

Top

Protein coding region RNA A-to-I editings for COX6B2

- Lollipop plot for RNA A-to-I editings across protein structure.
* Click on the image to enlarge it in a new window.

Top

The effects of the RNA editing to the miRNA binding sites for COX6B2

**If you are searching a miRNA gene with RNA editing events in its seed regions, please see the search pages of miRNA targets to discover the effects of this RNA editing event to miRNA regulations. For more information, please check the files in the Download page.

RNA A-to-I editing in the 3'-UTR regions of mRNA gained miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1391241	chr19_55349354_-	ENSG00000160471.11	ENST00000588572	hsa-miR-324-3p	55349354	55349360	7mer-m8	55349353	55349379	145.00	-28.89
CAediting_1391241	chr19_55349354_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6075	55349349	55349356	8mer-1a	55349349	55349370	148.00	-22.96
CAediting_1391247	chr19_55349410_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1207-3p	55349410	55349416	7mer-m8	55349409	55349425	145.00	-15.21
CAediting_1391247	chr19_55349410_-	ENSG00000160471.11	ENST00000588572	hsa-miR-646	55349408	55349414	7mer-m8	55349407	55349425	145.00	-17.36
CAediting_1391249	chr19_55349422_-	ENSG00000160471.11	ENST00000588572	hsa-miR-140-3p	55349418	55349424	7mer-m8	55349417	55349437	152.00	-21.58
CAediting_1391249	chr19_55349422_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6715b-5p	55349422	55349428	7mer-m8	55349421	55349441	141.00	-21.90
CAediting_1391250	chr19_55349440_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4258	55349436	55349442	7mer-m8	55349435	55349451	140.00	-19.15
CAediting_1391253	chr19_55349490_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6501-5p	55349484	55349491	8mer-1a	55349484	55349505	168.00	-27.66
CAediting_1391259	chr19_55349564_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4466	55349560	55349565	6mer	55349559	55349576	147.00	-31.78
CAediting_1391261	chr19_55349883_-	ENSG00000160471.11	ENST00000588572	hsa-miR-3189-3p	55349882	55349888	7mer-m8	55349881	55349900	153.00	-22.76
CAediting_1391261	chr19_55349883_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6813-3p	55349881	55349887	7mer-m8	55349880	55349900	140.00	-10.68
CAediting_1391261	chr19_55349883_-	ENSG00000160471.11	ENST00000593184	hsa-miR-3189-3p	55349882	55349888	7mer-m8	55349881	55349900	153.00	-22.76
CAediting_1391261	chr19_55349883_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6813-3p	55349881	55349887	7mer-m8	55349880	55349900	140.00	-10.68
CAediting_1391265	chr19_55349962_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6509-3p	55349960	55349965	6mer	55349959	55349980	144.00	-14.23
CAediting_1391265	chr19_55349962_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6509-3p	55349960	55349965	6mer	55349959	55349980	144.00	-14.23
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4537	55350070	55350077	8mer-1a	55350070	55350091	147.00	-21.03
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4537	55350070	55350077	8mer-1a	55350070	55350091	147.00	-21.03
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-25-3p	55350087	55350093	7mer-m8	55350086	55350109	161.00	-25.27
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-32-5p	55350087	55350093	7mer-m8	55350086	55350108	147.00	-12.53
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-363-3p	55350087	55350093	7mer-m8	55350086	55350107	147.00	-16.12
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-367-3p	55350087	55350093	7mer-m8	55350086	55350107	168.00	-26.49
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-7703	55350088	55350095	8mer-1a	55350088	55350110	162.00	-25.75
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-92a-3p	55350087	55350093	7mer-m8	55350086	55350103	155.00	-26.92
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-92a-3p	55350087	55350093	7mer-m8	55350086	55350103	155.00	-26.92
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000588572	hsa-miR-92b-3p	55350087	55350093	7mer-m8	55350086	55350108	156.00	-23.65
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-25-3p	55350087	55350093	7mer-m8	55350086	55350109	161.00	-25.27
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-32-5p	55350087	55350093	7mer-m8	55350086	55350108	147.00	-12.53
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-363-3p	55350087	55350093	7mer-m8	55350086	55350107	147.00	-16.12
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-367-3p	55350087	55350093	7mer-m8	55350086	55350107	168.00	-26.49
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-7703	55350088	55350095	8mer-1a	55350088	55350110	162.00	-25.75
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-92a-3p	55350087	55350093	7mer-m8	55350086	55350103	155.00	-26.92
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-92a-3p	55350087	55350093	7mer-m8	55350086	55350103	155.00	-26.92
CAediting_1391273	chr19_55350091_-	ENSG00000160471.11	ENST00000593184	hsa-miR-92b-3p	55350087	55350093	7mer-m8	55350086	55350108	156.00	-23.65
CAediting_1391242	chr19_55349358_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6511b-3p	55349353	55349358	6mer	55349352	55349374	140.00	-24.84
CAediting_1391242	chr19_55349358_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6511b-3p	55349353	55349358	6mer	55349352	55349374	140.00	-24.84
CAediting_1391242	chr19_55349358_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6784-3p	55349353	55349358	6mer	55349352	55349374	143.00	-26.47
CAediting_1391257	chr19_55349535_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1281	55349535	55349541	7mer-m8	55349528	55349544	143.00	-24.19
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-326	55349882	55349888	7mer-m8	55349881	55349900	140.00	-13.25
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-330-5p	55349882	55349888	7mer-m8	55349881	55349904	141.00	-19.74
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4314	55349883	55349889	7mer-m8	55349882	55349900	141.00	-20.85
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-326	55349882	55349888	7mer-m8	55349881	55349900	140.00	-13.25
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-330-5p	55349882	55349888	7mer-m8	55349881	55349904	141.00	-19.74
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4314	55349883	55349889	7mer-m8	55349882	55349900	141.00	-20.85
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-514a-5p	55349881	55349887	7mer-m8	55349880	55349903	150.00	-18.62
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6765-5p	55349893	55349899	7mer-m8	55349892	55349914	153.00	-27.43
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000588572	hsa-miR-7112-5p	55349898	55349904	7mer-m8	55349897	55349918	141.00	-23.08
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6765-5p	55349893	55349899	7mer-m8	55349892	55349914	153.00	-27.43
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000593184	hsa-miR-7112-5p	55349898	55349904	7mer-m8	55349897	55349918	141.00	-23.08
CAediting_1391264	chr19_55349907_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6078	55349906	55349913	8mer-1a	55349906	55349925	152.00	-19.16
CAediting_1391264	chr19_55349907_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6078	55349906	55349913	8mer-1a	55349906	55349925	152.00	-19.16
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000588572	hsa-miR-340-3p	55350120	55350127	8mer-1a	55350120	55350141	148.00	-18.75
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6827-3p	55350120	55350127	8mer-1a	55350120	55350140	140.00	-14.67
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000593184	hsa-miR-340-3p	55350120	55350127	8mer-1a	55350120	55350141	148.00	-18.75
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6827-3p	55350120	55350127	8mer-1a	55350120	55350140	140.00	-14.67
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000588572	hsa-miR-5001-3p	55350120	55350126	7mer-m8	55350119	55350140	146.00	-15.93
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000593184	hsa-miR-5001-3p	55350120	55350126	7mer-m8	55350119	55350140	146.00	-15.93
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4433b-5p	55350122	55350128	7mer-m8	55350121	55350141	140.00	-10.81
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4433b-5p	55350122	55350128	7mer-m8	55350121	55350141	140.00	-10.81
CAediting_1391251	chr19_55349449_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4637	55349444	55349450	7mer-m8	55349443	55349464	152.00	-10.44

RNA A-to-I editing in the 3'-UTR regions of mRNA lost miRNA binding sites.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_1391254	chr19_55349510_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1200	55349507	55349513	7mer-m8	55349506	55349527	153	-28.72
CAediting_1391246	chr19_55349406_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1200	55349403	55349409	7mer-m8	55349402	55349423	143	-20.14
CAediting_1391252	chr19_55349482_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1304-3p	55349476	55349483	8mer-1a	55349476	55349497	145	-15.65
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000588572	hsa-miR-3160-3p	55350070	55350077	8mer-1a	55350070	55350091	150	-15.17
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000588572	hsa-miR-3160-3p	55350070	55350077	8mer-1a	55350070	55350091	150	-15.17
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000588572	hsa-miR-320e	55349978	55349985	8mer-1a	55349978	55349996	147	-17.46
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000588572	hsa-miR-3664-5p	55350118	55350124	7mer-m8	55350117	55350138	153	-16.53
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000588572	hsa-miR-371b-5p	55350124	55350131	8mer-1a	55350124	55350145	146	-7.79
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000588572	hsa-miR-373-5p	55350124	55350131	8mer-1a	55350124	55350145	140	-8.35
CAediting_1391243	chr19_55349374_-	ENSG00000160471.11	ENST00000588572	hsa-miR-378j	55349373	55349379	7mer-m8	55349372	55349389	154	-16.37
CAediting_1391258	chr19_55349562_-	ENSG00000160471.11	ENST00000588572	hsa-miR-3934-5p	55349558	55349564	7mer-m8	55349557	55349579	155	-24.89
CAediting_1391241	chr19_55349354_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4284	55349351	55349357	7mer-m8	55349350	55349367	151	-17.62
CAediting_1391249	chr19_55349422_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4423-3p	55349422	55349428	7mer-m8	55349421	55349441	140	-13.75
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4478	55350023	55350029	7mer-m8	55350022	55350037	149	-25.05
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4486	55349982	55349988	7mer-m8	55349981	55349996	153	-26.36
CAediting_1391240	chr19_55349349_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4638-5p	55349347	55349354	8mer-1a	55349347	55349366	146	-20.28
CAediting_1391253	chr19_55349490_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4639-5p	55349486	55349493	8mer-1a	55349486	55349509	155	-17.17
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4649-3p	55350026	55350032	7mer-m8	55350025	55350045	140	-14.11
CAediting_1391242	chr19_55349358_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4772-3p	55349357	55349363	7mer-m8	55349356	55349378	154	-18.37
CAediting_1391251	chr19_55349449_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4775	55349446	55349452	7mer-m8	55349445	55349469	141	-6.26
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000588572	hsa-miR-514b-5p	55350124	55350129	6mer	55350123	55350144	142	-11.14
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000588572	hsa-miR-514b-5p	55350124	55350129	6mer	55350123	55350144	142	-11.14
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000588572	hsa-miR-541-3p	55349896	55349902	7mer-m8	55349895	55349916	155	-21.62
CAediting_1391258	chr19_55349562_-	ENSG00000160471.11	ENST00000588572	hsa-miR-552-3p	55349557	55349563	7mer-m8	55349556	55349576	140	-13.67
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000588572	hsa-miR-5589-5p	55349981	55349986	6mer	55349980	55350000	147	-23.4
CAediting_1391251	chr19_55349449_-	ENSG00000160471.11	ENST00000588572	hsa-miR-590-3p	55349446	55349453	8mer-1a	55349446	55349466	140	-3.31
CAediting_1391265	chr19_55349962_-	ENSG00000160471.11	ENST00000588572	hsa-miR-593-3p	55349957	55349962	6mer	55349956	55349974	140	-18.96
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6134	55349893	55349900	8mer-1a	55349893	55349912	151	-21.37
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000588572	hsa-miR-616-5p	55350124	55350131	8mer-1a	55350124	55350145	140	-5.71
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000588572	hsa-miR-654-5p	55349896	55349902	7mer-m8	55349895	55349916	142	-17.16
CAediting_1391256	chr19_55349529_-	ENSG00000160471.11	ENST00000588572	hsa-miR-660-3p	55349523	55349530	8mer-1a	55349523	55349545	146	-17.2
CAediting_1391243	chr19_55349374_-	ENSG00000160471.11	ENST00000588572	hsa-miR-660-3p	55349369	55349375	7mer-m8	55349368	55349388	146	-16.5
CAediting_1391256	chr19_55349529_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6747-3p	55349526	55349533	8mer-1a	55349526	55349547	150	-25.53
CAediting_1391245	chr19_55349393_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6747-3p	55349390	55349397	8mer-1a	55349390	55349412	149	-23.42
CAediting_1391259	chr19_55349564_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6807-5p	55349564	55349570	7mer-m8	55349563	55349585	144	-25.48
CAediting_1391246	chr19_55349406_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6869-5p	55349406	55349412	7mer-m8	55349405	55349427	149	-20.76
CAediting_1391247	chr19_55349410_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6869-5p	55349406	55349412	7mer-m8	55349405	55349427	149	-20.76
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6888-3p	55350120	55350126	7mer-m8	55350119	55350139	151	-14.42
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6888-3p	55350120	55350126	7mer-m8	55350119	55350139	151	-14.42
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000588572	hsa-miR-7160-5p	55350025	55350031	7mer-m8	55350024	55350044	146	-17.63
CAediting_1391244	chr19_55349379_-	ENSG00000160471.11	ENST00000588572	hsa-miR-7843-3p	55349378	55349384	7mer-1a	55349378	55349401	146	-23.67
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000588572	hsa-miR-887-5p	55349883	55349890	8mer-1a	55349883	55349902	143	-13.53
CAediting_1391252	chr19_55349482_-	ENSG00000160471.11	ENST00000588572	hsa-miR-892a	55349480	55349486	7mer-m8	55349479	55349499	141	-17.41
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000593184	hsa-miR-3160-3p	55350070	55350077	8mer-1a	55350070	55350091	150	-15.17
CAediting_1391271	chr19_55350075_-	ENSG00000160471.11	ENST00000593184	hsa-miR-3160-3p	55350070	55350077	8mer-1a	55350070	55350091	150	-15.17
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000593184	hsa-miR-320e	55349978	55349985	8mer-1a	55349978	55349996	147	-17.46
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000593184	hsa-miR-3664-5p	55350118	55350124	7mer-m8	55350117	55350138	153	-16.53
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000593184	hsa-miR-371b-5p	55350124	55350131	8mer-1a	55350124	55350145	146	-7.79
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000593184	hsa-miR-373-5p	55350124	55350131	8mer-1a	55350124	55350145	140	-8.35
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4478	55350023	55350029	7mer-m8	55350022	55350037	149	-25.05
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4486	55349982	55349988	7mer-m8	55349981	55349996	153	-26.36
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4649-3p	55350026	55350032	7mer-m8	55350025	55350045	140	-14.11
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000593184	hsa-miR-514b-5p	55350124	55350129	6mer	55350123	55350144	142	-11.14
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000593184	hsa-miR-514b-5p	55350124	55350129	6mer	55350123	55350144	142	-11.14
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000593184	hsa-miR-541-3p	55349896	55349902	7mer-m8	55349895	55349916	155	-21.62
CAediting_1391268	chr19_55349983_-	ENSG00000160471.11	ENST00000593184	hsa-miR-5589-5p	55349981	55349986	6mer	55349980	55350000	147	-23.4
CAediting_1391265	chr19_55349962_-	ENSG00000160471.11	ENST00000593184	hsa-miR-593-3p	55349957	55349962	6mer	55349956	55349974	140	-18.96
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6134	55349893	55349900	8mer-1a	55349893	55349912	151	-21.37
CAediting_1391276	chr19_55350126_-	ENSG00000160471.11	ENST00000593184	hsa-miR-616-5p	55350124	55350131	8mer-1a	55350124	55350145	140	-5.71
CAediting_1391263	chr19_55349898_-	ENSG00000160471.11	ENST00000593184	hsa-miR-654-5p	55349896	55349902	7mer-m8	55349895	55349916	142	-17.16
CAediting_1391274	chr19_55350122_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6888-3p	55350120	55350126	7mer-m8	55350119	55350139	151	-14.42
CAediting_1391275	chr19_55350124_-	ENSG00000160471.11	ENST00000593184	hsa-miR-6888-3p	55350120	55350126	7mer-m8	55350119	55350139	151	-14.42
CAediting_1391270	chr19_55350027_-	ENSG00000160471.11	ENST00000593184	hsa-miR-7160-5p	55350025	55350031	7mer-m8	55350024	55350044	146	-17.63
CAediting_1391262	chr19_55349884_-	ENSG00000160471.11	ENST00000593184	hsa-miR-887-5p	55349883	55349890	8mer-1a	55349883	55349902	143	-13.53

RNA A-to-I editing in lncRNA gained miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in lncRNA lost miRNA binding sites.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs lost binding to lncRNA.

CAeditom_ID

Position

ENSG

ENST

miRNA

Targetscan start

Targetscan end

Targetscan score

Miranda start

Miranda end

Miranda score

Miranda energy

RNA A-to-I editing in miRNAs gained binding to the 3'-UTR region of mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_748296	chr10_51299626_+	ENSG00000160471.11	ENST00000588572	hsa-miR-605-3p	55349629	55349635	7mer-m8	55349628	55349648	141	-18.03
CAediting_748296	chr10_51299626_+	ENSG00000160471.11	ENST00000588572	hsa-miR-605-3p	55350530	55350536	7mer-m8	55350529	55350550	140	-13.49
CAediting_980496	chr14_31014685_-	ENSG00000160471.11	ENST00000588572	hsa-miR-624-3p	55349309	55349315	7mer-m8	55349308	55349329	149	-16.32
CAediting_688081	chr9_63819627_+	ENSG00000160471.11	ENST00000588572	hsa-miR-4477b	55350475	55350481	7mer-m8	55350474	55350495	155	-15.87
CAediting_748296	chr10_51299626_+	ENSG00000160471.11	ENST00000593184	hsa-miR-605-3p	55350530	55350536	7mer-m8	55350529	55350550	140	-13.49
CAediting_688081	chr9_63819627_+	ENSG00000160471.11	ENST00000593184	hsa-miR-4477b	55350475	55350481	7mer-m8	55350474	55350495	155	-15.87
CAediting_748296	chr10_51299626_+	ENSG00000160471.11	ENST00000590900	hsa-miR-605-3p	55350530	55350536	7mer-m8	55350529	55350550	140	-13.49
CAediting_688081	chr9_63819627_+	ENSG00000160471.11	ENST00000590900	hsa-miR-4477b	55350475	55350481	7mer-m8	55350474	55350495	155	-15.87
CAediting_86358	chr1_109598906_+	ENSG00000160471.11	ENST00000588572	hsa-miR-197-5p	55353638	55353644	7mer-m8	55353637	55353659	144	-22.64
CAediting_1054808	chr15_66496985_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4512	55350651	55350657	7mer-m8	55350650	55350671	140	-14.36
CAediting_1351755	chr19_40282625_-	ENSG00000160471.11	ENST00000588572	hsa-miR-641	55350408	55350413	6mer	55350407	55350432	148	-21.16
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000588572	hsa-miR-320e	55350518	55350524	7mer-m8	55350517	55350534	151	-18.81
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000588572	hsa-miR-320e	55350376	55350383	8mer-1a	55350376	55350393	148	-18.69
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000588572	hsa-miR-320e	55350213	55350220	8mer-1a	55350213	55350231	146	-19.38
CAediting_86358	chr1_109598906_+	ENSG00000160471.11	ENST00000588572	hsa-miR-197-5p	55349666	55349673	8mer-1a	55349666	55349688	149	-18.97
CAediting_580943	chr7_100356700_+	ENSG00000160471.11	ENST00000588572	hsa-miR-6840-3p	55350049	55350055	7mer-m8	55350048	55350069	140	-25.13
CAediting_524911	chr7_5495852_-	ENSG00000160471.11	ENST00000588572	hsa-miR-589-3p	55350765	55350771	7mer-m8	55350764	55350787	145	-14.63
CAediting_573000	chr7_92204081_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1285-5p	55350499	55350505	7mer-m8	55350498	55350519	144	-19.44
CAediting_86358	chr1_109598906_+	ENSG00000160471.11	ENST00000593184	hsa-miR-197-5p	55353638	55353644	7mer-m8	55353637	55353659	144	-22.64
CAediting_573001	chr7_92204086_-	ENSG00000160471.11	ENST00000593184	hsa-miR-1285-5p	55352671	55352677	7mer-m8	55352670	55352689	143	-25.28
CAediting_1054808	chr15_66496985_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4512	55350651	55350657	7mer-m8	55350650	55350671	140	-14.36
CAediting_1351755	chr19_40282625_-	ENSG00000160471.11	ENST00000593184	hsa-miR-641	55350408	55350413	6mer	55350407	55350432	148	-21.16
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000593184	hsa-miR-320e	55350518	55350524	7mer-m8	55350517	55350534	151	-18.81
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000593184	hsa-miR-320e	55350376	55350383	8mer-1a	55350376	55350393	148	-18.69
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000593184	hsa-miR-320e	55350213	55350220	8mer-1a	55350213	55350231	146	-19.38
CAediting_580943	chr7_100356700_+	ENSG00000160471.11	ENST00000593184	hsa-miR-6840-3p	55350049	55350055	7mer-m8	55350048	55350069	140	-25.13
CAediting_524911	chr7_5495852_-	ENSG00000160471.11	ENST00000593184	hsa-miR-589-3p	55350765	55350771	7mer-m8	55350764	55350787	145	-14.63
CAediting_573000	chr7_92204081_-	ENSG00000160471.11	ENST00000593184	hsa-miR-1285-5p	55350499	55350505	7mer-m8	55350498	55350519	144	-19.44
CAediting_86358	chr1_109598906_+	ENSG00000160471.11	ENST00000590900	hsa-miR-197-5p	55353638	55353644	7mer-m8	55353637	55353659	144	-22.64
CAediting_1229415	chr17_67471547_+	ENSG00000160471.11	ENST00000590900	hsa-miR-548aa	55351766	55351772	7mer-m8	55351765	55351792	147	-15.79
CAediting_524911	chr7_5495852_-	ENSG00000160471.11	ENST00000590900	hsa-miR-589-3p	55351775	55351781	7mer-m8	55351774	55351797	148	-17.66
CAediting_1054808	chr15_66496985_-	ENSG00000160471.11	ENST00000590900	hsa-miR-4512	55350651	55350657	7mer-m8	55350650	55350671	140	-14.36
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000590900	hsa-miR-320e	55350518	55350524	7mer-m8	55350517	55350534	151	-18.81
CAediting_524911	chr7_5495852_-	ENSG00000160471.11	ENST00000590900	hsa-miR-589-3p	55350765	55350771	7mer-m8	55350764	55350787	145	-14.63
CAediting_573000	chr7_92204081_-	ENSG00000160471.11	ENST00000590900	hsa-miR-1285-5p	55350499	55350505	7mer-m8	55350498	55350519	144	-19.44
CAediting_86358	chr1_109598906_+	ENSG00000160471.11	ENST00000589467	hsa-miR-197-5p	55353638	55353644	7mer-m8	55353637	55353659	144	-22.64
CAediting_1524209	chrX_134546392_-	ENSG00000160471.11	ENST00000588572	hsa-miR-503-5p	55349632	55349638	7mer-m8	55349631	55349652	153	-22.16
CAediting_468389	chr6_31355314_-	ENSG00000160471.11	ENST00000590900	hsa-miR-6891-5p	55351786	55351792	7mer-m8	55351785	55351803	145	-23.6

RNA A-to-I editing in miRNAs lost binding to the 3'-UTR mRNA.

CAeditom_ID	Position	ENSG	ENST	miRNA	Targetscan start	Targetscan end	Targetscan score	Miranda start	Miranda end	Miranda score	Miranda energy
CAediting_846604	chr11_93733708_-	ENSG00000160471.11	ENST00000588572	hsa-miR-1304-3p	55349476	55349483	8mer-1a	55349476	55349497	145	-15.65
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000588572	hsa-miR-320e	55349978	55349985	8mer-1a	55349978	55349996	147	-17.46
CAediting_77128	chr1_85133844_+	ENSG00000160471.11	ENST00000588572	hsa-miR-4423-3p	55349422	55349428	7mer-m8	55349421	55349441	140	-13.75
CAediting_1054808	chr15_66496985_-	ENSG00000160471.11	ENST00000588572	hsa-miR-4512	55350232	55350238	7mer-m8	55350231	55350255	153	-22.73
CAediting_1399425	chr20_1392958_-	ENSG00000160471.11	ENST00000588572	hsa-miR-6869-5p	55349406	55349412	7mer-m8	55349405	55349427	149	-20.76
CAediting_1368054	chr19_46709310_-	ENSG00000160471.11	ENST00000593184	hsa-miR-320e	55349978	55349985	8mer-1a	55349978	55349996	147	-17.46
CAediting_1054808	chr15_66496985_-	ENSG00000160471.11	ENST00000593184	hsa-miR-4512	55350232	55350238	7mer-m8	55350231	55350255	153	-22.73
CAediting_604450	chr7_133034877_-	ENSG00000160471.11	ENST00000590900	hsa-miR-3654	55351751	55351758	8mer-1a	55351751	55351771	148	-18.42

Differentially expressed gene-miRNA network

Top

The effects of the RNA editing to the stability of the RNA structures for COX6B2

- RNA A-to-I editing in mRNA.
* Click on the image to enlarge it in a new window.

ENST

ENST type

RNA structure without RNA A-to-I editing.

RNA structure with RNA A-to-I editing.

RNA A-to-I editing in RNA structures for Minimum free energy (MFE).

CAeditom_ID

ENST

Editing_Position

MFE_withoneAI

MFE_withoutAI

MFE_withmultipleAI

Top

Relation with ADAR for COX6B2

Correlation between ADAR gene expression and RNA editing frequency

Cancer	CAeditomID	position	ADAR1 (p-val)	ADAR1 (coeff.)	ADAR2 (p-val)	ADAR2 (coeff.)	ADAR3 (p-val)	ADAR3 (coeff.)
CESC	CAediting_1391258	chr19_55349562_-	0.0032534211281068	0.400580528544913	.	.	.	.
CESC	CAediting_1391278	chr19_55350148_-	.	.	.	.	0.0227146042974326	0.2913612702662

Top

Relation with cancer stages for COX6B2

Correlation between Cancer stages and RNA editing frequency

Cancer

Stage_type

CAeditomID

position

P-val

Coeff.

Top

Relation with survival for COX6B2

Correlation between RNA editing and survival

Cancer

CAeditomID

position

KMpvalue

Coxpvalue

CoxHR

Top

RelatedDrugs for COX6B2

Approved drugs targeting this gene.
(DrugBank Version 5.1.8 2021-01-03)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for COX6B2

Diseases associated with this gene.
(DisGeNet 7.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	RNA A-to-I events
	Differntial gene expression between RNA A-to-I edited tumor samples versus normal samples
	Protein coding region RNA A-to-I editings
	The effects of the RNA editing to the miRNA binding sites
	The effects of the RNA editing to the stability of the RNA structures
	Relation with ADAR
	Relation with cancer stages
	Relation with survival state
	Related drugs with this gene
	Related diseases with this gene