FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 8319

FusionGeneSummary for CPSF6_COL9A1

check button Fusion gene summary
Fusion gene informationFusion gene name: CPSF6_COL9A1
Fusion gene ID: 8319
HgeneTgene
Gene symbol

CPSF6

COL9A1

Gene ID

11052

1297

Gene namecleavage and polyadenylation specific factor 6collagen type IX alpha 1 chain
SynonymsCFIM|CFIM68|CFIM72|HPBRII-4|HPBRII-7DJ149L1.1.2|EDM6|MED|STL4
Cytomap

12q15

6q13

Type of geneprotein-codingprotein-coding
Descriptioncleavage and polyadenylation specificity factor subunit 6CPSF 68 kDa subunitcleavage and polyadenylation specific factor 6, 68kDacleavage and polyadenylation specificity factor 68 kDa subunitcleavage factor Im complex 68 kDa subunitpre-mRNA cleavage collagen alpha-1(IX) chainalpha-1(IX) collagen chaincartilage-specific short collagencollagen IX, alpha-1 polypeptidecollagen, type IX, alpha 1
Modification date2018052220180523
UniProtAcc

Q16630

P20849

Ensembl transtripts involved in fusion geneENST00000435070, ENST00000456847, 
ENST00000266679, ENST00000550987, 
ENST00000551516, 
ENST00000357250, 
ENST00000320755, ENST00000370499, 
ENST00000489611, ENST00000370496, 
Fusion gene scores* DoF score23 X 6 X 11=15184 X 4 X 4=64
# samples 264
** MAII scorelog2(26/1518*10)=-2.54558826238701
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(4/64*10)=-0.678071905112638
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: CPSF6 [Title/Abstract] AND COL9A1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneCPSF6

GO:0006397

mRNA processing

14690600

HgeneCPSF6

GO:0051262

protein tetramerization

20695905

HgeneCPSF6

GO:0051290

protein heterotetramerization

23187700

HgeneCPSF6

GO:1990120

messenger ribonucleoprotein complex assembly

29276085


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVSARCTCGA-FX-A2QS-01ACPSF6chr12

69633486

+COL9A1chr6

70926784

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000435070ENST00000357250CPSF6chr12

69633486

+COL9A1chr6

70926784

-
Frame-shitENST00000435070ENST00000320755CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000435070ENST00000370499CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-5UTRENST00000435070ENST00000489611CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-intronENST00000435070ENST00000370496CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000456847ENST00000357250CPSF6chr12

69633486

+COL9A1chr6

70926784

-
Frame-shitENST00000456847ENST00000320755CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000456847ENST00000370499CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-5UTRENST00000456847ENST00000489611CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-intronENST00000456847ENST00000370496CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000266679ENST00000357250CPSF6chr12

69633486

+COL9A1chr6

70926784

-
Frame-shitENST00000266679ENST00000320755CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000266679ENST00000370499CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-5UTRENST00000266679ENST00000489611CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-intronENST00000266679ENST00000370496CPSF6chr12

69633486

+COL9A1chr6

70926784

-
3UTR-3CDSENST00000550987ENST00000357250CPSF6chr12

69633486

+COL9A1chr6

70926784

-
3UTR-3CDSENST00000550987ENST00000320755CPSF6chr12

69633486

+COL9A1chr6

70926784

-
3UTR-3CDSENST00000550987ENST00000370499CPSF6chr12

69633486

+COL9A1chr6

70926784

-
3UTR-5UTRENST00000550987ENST00000489611CPSF6chr12

69633486

+COL9A1chr6

70926784

-
3UTR-intronENST00000550987ENST00000370496CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000551516ENST00000357250CPSF6chr12

69633486

+COL9A1chr6

70926784

-
Frame-shitENST00000551516ENST00000320755CPSF6chr12

69633486

+COL9A1chr6

70926784

-
In-frameENST00000551516ENST00000370499CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-5UTRENST00000551516ENST00000489611CPSF6chr12

69633486

+COL9A1chr6

70926784

-
5CDS-intronENST00000551516ENST00000370496CPSF6chr12

69633486

+COL9A1chr6

70926784

-

Top

FusionProtFeatures for CPSF6_COL9A1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
CPSF6

Q16630

COL9A1

P20849

Component of the cleavage factor Im (CFIm) complex thatfunctions as an activator of the pre-mRNA 3'-end cleavage andpolyadenylation processing required for the maturation of pre-mRNAinto functional mRNAs (PubMed:9659921, PubMed:8626397,PubMed:14690600, PubMed:29276085). CFIm contributes to therecruitment of multiprotein complexes on specific sequences on thepre-mRNA 3'-end, so called cleavage and polyadenylation signals(pA signals) (PubMed:9659921, PubMed:8626397, PubMed:14690600).Most pre-mRNAs contain multiple pA signals, resulting inalternative cleavage and polyadenylation (APA) producing mRNAswith variable 3'-end formation (PubMed:23187700, PubMed:29276085).The CFIm complex acts as a key regulator of cleavage andpolyadenylation site choice during APA through its binding to 5'-UGUA-3' elements localized in the 3'-untranslated region (UTR) fora huge number of pre-mRNAs (PubMed:20695905, PubMed:29276085).CPSF6 enhances NUDT21/CPSF5 binding to 5'-UGUA-3' elementslocalized upstream of pA signals and promotes RNA looping, andhence activates directly the mRNA 3'-processing machinery(PubMed:15169763, PubMed:29276085, PubMed:21295486). Plays a rolein mRNA export (PubMed:19864460). {ECO:0000269|PubMed:14690600,ECO:0000269|PubMed:15169763, ECO:0000269|PubMed:19864460,ECO:0000269|PubMed:20695905, ECO:0000269|PubMed:21295486,ECO:0000269|PubMed:23187700, ECO:0000269|PubMed:29276085,ECO:0000269|PubMed:8626397, ECO:0000269|PubMed:9659921}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032655_712617679DomainNote=Collagen-like 7
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032713_755617679DomainNote=Collagen-like 8
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032790_847617679DomainNote=Collagen-like 9
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032848_899617679DomainNote=Collagen-like 10
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011269_324-49329DomainNote=Collagen-like 1
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011325_356-49329DomainNote=Collagen-like 2
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011358_403-49329DomainNote=Collagen-like 3
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011416_472-49329DomainNote=Collagen-like 4
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011473_516-49329DomainNote=Collagen-like 5
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-01150_244-49329DomainNote=Laminin G-like
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011587_643-49329DomainNote=Collagen-like 6
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011655_712-49329DomainNote=Collagen-like 7
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011713_755-49329DomainNote=Collagen-like 8
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011790_847-49329DomainNote=Collagen-like 9
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011848_899-49329DomainNote=Collagen-like 10
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032757_786617679RegionNote=Nonhelical region (NC2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032787_901617679RegionNote=Triple-helical region (COL1)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032902_921617679RegionNote=Nonhelical region (NC1)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638902_921860922RegionNote=Nonhelical region (NC1)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-01124_268-49329RegionNote=Nonhelical region (NC4)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011269_405-49329RegionNote=Triple-helical region (COL3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011406_417-49329RegionNote=Nonhelical region (NC3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011418_756-49329RegionNote=Triple-helical region (COL2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011757_786-49329RegionNote=Nonhelical region (NC2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011787_901-49329RegionNote=Triple-helical region (COL1)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000370496-011902_921-49329RegionNote=Nonhelical region (NC1)

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111208_39820701Compositional biasNote=Pro-rich
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111490_55120701Compositional biasNote=Arg-rich
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110208_398202111Compositional biasNote=Pro-rich
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110490_551202111Compositional biasNote=Arg-rich
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111202_20620701MotifGAR
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110202_206202111MotifGAR
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111404_55120701RegionSufficient for nuclear speckle localization
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111405_55120701RegionNecessary for RNA-binding
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+111510_55120701RegionSufficient for nuclear targeting
HgeneCPSF6chr12:69633486chr6:70926784ENST00000266679+11181_16120701RegionNecessary for nuclear paraspeckles localization
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110404_551202111RegionSufficient for nuclear speckle localization
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110405_551202111RegionNecessary for RNA-binding
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+110510_551202111RegionSufficient for nuclear targeting
HgeneCPSF6chr12:69633486chr6:70926784ENST00000435070+11081_161202111RegionNecessary for nuclear paraspeckles localization
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032269_324617679DomainNote=Collagen-like 1
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032325_356617679DomainNote=Collagen-like 2
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032358_403617679DomainNote=Collagen-like 3
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032416_472617679DomainNote=Collagen-like 4
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032473_516617679DomainNote=Collagen-like 5
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-303250_244617679DomainNote=Laminin G-like
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032587_643617679DomainNote=Collagen-like 6
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638269_324860922DomainNote=Collagen-like 1
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638325_356860922DomainNote=Collagen-like 2
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638358_403860922DomainNote=Collagen-like 3
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638416_472860922DomainNote=Collagen-like 4
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638473_516860922DomainNote=Collagen-like 5
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-363850_244860922DomainNote=Laminin G-like
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638587_643860922DomainNote=Collagen-like 6
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638655_712860922DomainNote=Collagen-like 7
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638713_755860922DomainNote=Collagen-like 8
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638790_847860922DomainNote=Collagen-like 9
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638848_899860922DomainNote=Collagen-like 10
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-303224_268617679RegionNote=Nonhelical region (NC4)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032269_405617679RegionNote=Triple-helical region (COL3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032406_417617679RegionNote=Nonhelical region (NC3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000320755-3032418_756617679RegionNote=Triple-helical region (COL2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-363824_268860922RegionNote=Nonhelical region (NC4)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638269_405860922RegionNote=Triple-helical region (COL3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638406_417860922RegionNote=Nonhelical region (NC3)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638418_756860922RegionNote=Triple-helical region (COL2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638757_786860922RegionNote=Nonhelical region (NC2)
TgeneCOL9A1chr12:69633486chr6:70926784ENST00000357250-3638787_901860922RegionNote=Triple-helical region (COL1)


Top

FusionGeneSequence for CPSF6_COL9A1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_81aa

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_81aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_245nt
ATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAA
ATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCT


* Fusion transcript sequences (Full-length transcript).
>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_2191nt
CTCGGAAGTGACGCAAGCGCCCCCCCACCGCCGCTAGATCCGCTGCTGCTGCCGCGGCGGGCAGACCTGCAGGAGGCGGCGGCGGCGGCG
GCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGG
CCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACC
TCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGACCCTTGAAAGGC
TTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAAAGATGATTACC
TTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCTATTCAGTAAGT
TCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGAATAAATTTATA
CTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAACAACTGTTTGG
TTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGACTAGTTATGAA
GAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTACATCTCCCGAAA
TGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTGTTAATATTTTG
AGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTAAAGGTTTGAGG
TAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTTCAATGAAAAGA
AGTTACTGAGCTTATTTAGATACATTAAACATTACTTAACTACTGGTTCTATAGGTGTATGTTTATAATATTAGTGTTTTTTCTACATAA
AGTAATTTAAAAAGCTGTTCCACAGAGGGTGTTACCCTGTGACAGATGCGTATGTGTGTGTGTGTGTGTGTGTGTGTGTTTTAGTGTGTA
TGGAGAGAGCTTCATGGACCTTTTCGAAATGTTAATTCCCTAGAAAGATGTGCAGCTGCATGCGCATCTATATTTTTGTATAGTATTTCA
GAGATTTCGTGGACTTTTTTAAGTCTAGCCTTGCTTTATTTCTAGGTTAAGAACCACTGCCTTCATTCCAATGGCTTGTTAGCTCCCTCC
TACTCAGAACTTTATTGTAAACATGATTTATGTTTCACCATTTCTTGTAAATTTTATAAATGCAGCTCAGCTAAAGCACTGTATTCTTAA
CAAGTATTTCCTGACCACTTAAGCACTTTATTATTATCTGTGTAATCATATTGGCTTGCTGTTTCATTAACATCTACTTAACTATCCAAC
AGACTTAATATATTCATTTTATATCACAGAGCCTGTGAGTAACCTGTGCTGGGGCATAAAACAATAGCTCAACATAGTATCTTTAGTTAG
TTTATGGAACTAAATTCTGTCAAGTCAAAGGAGAGTGAGCCCTAATATAATTTTTTATATATATTTTTCTCGTGTGTACTTTTATACATT
TTAAATTCTAGTCCTAGTTGTTTGGTTAAATCAATCATTATGTAATCTGTATTTGGATTTCTTTAAAACTGCTTACAGCATCTAGTTTTA
TGCTTCTAGCATGAATTTTGCTTAAGAAGATTCCAACTTTGCCATATAGATCAGTGCTATTTACATAGACTGAAAGAATGTTCTTTCCCT
TTTTTCAAATATGACTTTTGAAAATAAAGGTCTCTGTTATAGCTCCCTAAAACAATCCTTAAAAAAATGGCAAACTTTTTCAGGAGCTGT

>In-frame_CPSF6_ENST00000435070_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_1211nt
CTCGGAAGTGACGCAAGCGCCCCCCCACCGCCGCTAGATCCGCTGCTGCTGCCGCGGCGGGCAGACCTGCAGGAGGCGGCGGCGGCGGCG
GCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGG
CCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACC
TCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGACCCTTGAAAGGC
TTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAAAGATGATTACC
TTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCTATTCAGTAAGT
TCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGAATAAATTTATA
CTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAACAACTGTTTGG
TTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGACTAGTTATGAA
GAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTACATCTCCCGAAA
TGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTGTTAATATTTTG
AGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTAAAGGTTTGAGG
TAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTTCAATGAAAAGA

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_2128nt
GACCTGCAGGAGGCGGCGGCGGCGGCGGCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCG
GCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAAT
TCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATT
TAACAAAGGGCCTGACCCTTGAAAGGCTTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCA
TCCAAAGCTGGGGCAAAGATGATTACCTTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACAT
ATAGAAGAACGGTGCTATTCAGTAAGTTCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAAC
CAAACACCTCCCTTGAATAAATTTATACTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTG
TGCCAATAAACAAAAACAACTGTTTGGTTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTAT
ATAGAGGATTACTAGACTAGTTATGAAGAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGT
GATAAGAAAGGGCTACATCTCCCGAAATGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTA
CTTTACCCCAAACCTGTTAATATTTTGAGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGAT
GAGATTATTTATTTTAAAGGTTTGAGGTAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCT
TATAAATAATCATGTTCAATGAAAAGAAGTTACTGAGCTTATTTAGATACATTAAACATTACTTAACTACTGGTTCTATAGGTGTATGTT
TATAATATTAGTGTTTTTTCTACATAAAGTAATTTAAAAAGCTGTTCCACAGAGGGTGTTACCCTGTGACAGATGCGTATGTGTGTGTGT
GTGTGTGTGTGTGTGTTTTAGTGTGTATGGAGAGAGCTTCATGGACCTTTTCGAAATGTTAATTCCCTAGAAAGATGTGCAGCTGCATGC
GCATCTATATTTTTGTATAGTATTTCAGAGATTTCGTGGACTTTTTTAAGTCTAGCCTTGCTTTATTTCTAGGTTAAGAACCACTGCCTT
CATTCCAATGGCTTGTTAGCTCCCTCCTACTCAGAACTTTATTGTAAACATGATTTATGTTTCACCATTTCTTGTAAATTTTATAAATGC
AGCTCAGCTAAAGCACTGTATTCTTAACAAGTATTTCCTGACCACTTAAGCACTTTATTATTATCTGTGTAATCATATTGGCTTGCTGTT
TCATTAACATCTACTTAACTATCCAACAGACTTAATATATTCATTTTATATCACAGAGCCTGTGAGTAACCTGTGCTGGGGCATAAAACA
ATAGCTCAACATAGTATCTTTAGTTAGTTTATGGAACTAAATTCTGTCAAGTCAAAGGAGAGTGAGCCCTAATATAATTTTTTATATATA
TTTTTCTCGTGTGTACTTTTATACATTTTAAATTCTAGTCCTAGTTGTTTGGTTAAATCAATCATTATGTAATCTGTATTTGGATTTCTT
TAAAACTGCTTACAGCATCTAGTTTTATGCTTCTAGCATGAATTTTGCTTAAGAAGATTCCAACTTTGCCATATAGATCAGTGCTATTTA
CATAGACTGAAAGAATGTTCTTTCCCTTTTTTCAAATATGACTTTTGAAAATAAAGGTCTCTGTTATAGCTCCCTAAAACAATCCTTAAA

>In-frame_CPSF6_ENST00000456847_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_1148nt
GACCTGCAGGAGGCGGCGGCGGCGGCGGCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCG
GCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAAT
TCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATT
TAACAAAGGGCCTGACCCTTGAAAGGCTTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCA
TCCAAAGCTGGGGCAAAGATGATTACCTTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACAT
ATAGAAGAACGGTGCTATTCAGTAAGTTCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAAC
CAAACACCTCCCTTGAATAAATTTATACTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTG
TGCCAATAAACAAAAACAACTGTTTGGTTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTAT
ATAGAGGATTACTAGACTAGTTATGAAGAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGT
GATAAGAAAGGGCTACATCTCCCGAAATGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTA
CTTTACCCCAAACCTGTTAATATTTTGAGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGAT
GAGATTATTTATTTTAAAGGTTTGAGGTAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCT

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_2112nt
CGGCGGCGGCGGCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCA
GGTGACCCAGGCCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGA
CCCCCGGGACCTCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGAC
CCTTGAAAGGCTTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAA
AGATGATTACCTTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCT
ATTCAGTAAGTTCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGA
ATAAATTTATACTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAA
CAACTGTTTGGTTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGA
CTAGTTATGAAGAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTAC
ATCTCCCGAAATGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTG
TTAATATTTTGAGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTA
AAGGTTTGAGGTAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTT
CAATGAAAAGAAGTTACTGAGCTTATTTAGATACATTAAACATTACTTAACTACTGGTTCTATAGGTGTATGTTTATAATATTAGTGTTT
TTTCTACATAAAGTAATTTAAAAAGCTGTTCCACAGAGGGTGTTACCCTGTGACAGATGCGTATGTGTGTGTGTGTGTGTGTGTGTGTGT
TTTAGTGTGTATGGAGAGAGCTTCATGGACCTTTTCGAAATGTTAATTCCCTAGAAAGATGTGCAGCTGCATGCGCATCTATATTTTTGT
ATAGTATTTCAGAGATTTCGTGGACTTTTTTAAGTCTAGCCTTGCTTTATTTCTAGGTTAAGAACCACTGCCTTCATTCCAATGGCTTGT
TAGCTCCCTCCTACTCAGAACTTTATTGTAAACATGATTTATGTTTCACCATTTCTTGTAAATTTTATAAATGCAGCTCAGCTAAAGCAC
TGTATTCTTAACAAGTATTTCCTGACCACTTAAGCACTTTATTATTATCTGTGTAATCATATTGGCTTGCTGTTTCATTAACATCTACTT
AACTATCCAACAGACTTAATATATTCATTTTATATCACAGAGCCTGTGAGTAACCTGTGCTGGGGCATAAAACAATAGCTCAACATAGTA
TCTTTAGTTAGTTTATGGAACTAAATTCTGTCAAGTCAAAGGAGAGTGAGCCCTAATATAATTTTTTATATATATTTTTCTCGTGTGTAC
TTTTATACATTTTAAATTCTAGTCCTAGTTGTTTGGTTAAATCAATCATTATGTAATCTGTATTTGGATTTCTTTAAAACTGCTTACAGC
ATCTAGTTTTATGCTTCTAGCATGAATTTTGCTTAAGAAGATTCCAACTTTGCCATATAGATCAGTGCTATTTACATAGACTGAAAGAAT
GTTCTTTCCCTTTTTTCAAATATGACTTTTGAAAATAAAGGTCTCTGTTATAGCTCCCTAAAACAATCCTTAAAAAAATGGCAAACTTTT

>In-frame_CPSF6_ENST00000266679_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_1132nt
CGGCGGCGGCGGCGGCCGAGGCTGAAGGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCA
GGTGACCCAGGCCCTGCCAGCTATGGCAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGA
CCCCCGGGACCTCCTGGGCTTCCCGGTTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGAC
CCTTGAAAGGCTTACTGCTGCATGGCTGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAA
AGATGATTACCTTCAGCATGATTACAATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCT
ATTCAGTAAGTTCTCTTTCCTTTCCCTTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGA
ATAAATTTATACTCCTGTTCCCAGGATCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAA
CAACTGTTTGGTTTACCTCAGTTGCAGTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGA
CTAGTTATGAAGAAACCCCACTACATTCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTAC
ATCTCCCGAAATGATTTCTTTACGTCATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTG
TTAATATTTTGAGCGCTTCTATGTGAAAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTA
AAGGTTTGAGGTAACATCTCTGGTTGTACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTT

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000357250_chr6_70926784_-_2086nt
GGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGG
CAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGG
TTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGACCCTTGAAAGGCTTACTGCTGCATGGC
TGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAAAGATGATTACCTTCAGCATGATTACA
ATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCTATTCAGTAAGTTCTCTTTCCTTTCCC
TTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGAATAAATTTATACTCCTGTTCCCAGGA
TCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAACAACTGTTTGGTTTACCTCAGTTGCA
GTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGACTAGTTATGAAGAAACCCCACTACAT
TCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTACATCTCCCGAAATGATTTCTTTACGTC
ATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTGTTAATATTTTGAGCGCTTCTATGTGA
AAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTAAAGGTTTGAGGTAACATCTCTGGTTG
TACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTTCAATGAAAAGAAGTTACTGAGCTTAT
TTAGATACATTAAACATTACTTAACTACTGGTTCTATAGGTGTATGTTTATAATATTAGTGTTTTTTCTACATAAAGTAATTTAAAAAGC
TGTTCCACAGAGGGTGTTACCCTGTGACAGATGCGTATGTGTGTGTGTGTGTGTGTGTGTGTGTTTTAGTGTGTATGGAGAGAGCTTCAT
GGACCTTTTCGAAATGTTAATTCCCTAGAAAGATGTGCAGCTGCATGCGCATCTATATTTTTGTATAGTATTTCAGAGATTTCGTGGACT
TTTTTAAGTCTAGCCTTGCTTTATTTCTAGGTTAAGAACCACTGCCTTCATTCCAATGGCTTGTTAGCTCCCTCCTACTCAGAACTTTAT
TGTAAACATGATTTATGTTTCACCATTTCTTGTAAATTTTATAAATGCAGCTCAGCTAAAGCACTGTATTCTTAACAAGTATTTCCTGAC
CACTTAAGCACTTTATTATTATCTGTGTAATCATATTGGCTTGCTGTTTCATTAACATCTACTTAACTATCCAACAGACTTAATATATTC
ATTTTATATCACAGAGCCTGTGAGTAACCTGTGCTGGGGCATAAAACAATAGCTCAACATAGTATCTTTAGTTAGTTTATGGAACTAAAT
TCTGTCAAGTCAAAGGAGAGTGAGCCCTAATATAATTTTTTATATATATTTTTCTCGTGTGTACTTTTATACATTTTAAATTCTAGTCCT
AGTTGTTTGGTTAAATCAATCATTATGTAATCTGTATTTGGATTTCTTTAAAACTGCTTACAGCATCTAGTTTTATGCTTCTAGCATGAA
TTTTGCTTAAGAAGATTCCAACTTTGCCATATAGATCAGTGCTATTTACATAGACTGAAAGAATGTTCTTTCCCTTTTTTCAAATATGAC
TTTTGAAAATAAAGGTCTCTGTTATAGCTCCCTAAAACAATCCTTAAAAAAATGGCAAACTTTTTCAGGAGCTGTGACACATAATTAAAT

>In-frame_CPSF6_ENST00000551516_chr12_69633486_+_COL9A1_ENST00000370499_chr6_70926784_-_1106nt
GGAAGATGGCGGACGGCGTGGACCACATAGACATTTACGCGGATGTCGGCGAAGAGTTCAACCAGGTGACCCAGGCCCTGCCAGCTATGG
CAGAAATGGCCGAGACGGTGAGCGAGGCCCCCCAGGGGTGGCAGGAATTCCTGGAGTGCCTGGACCCCCGGGACCTCCTGGGCTTCCCGG
TTTCTGTGAGCCAGCCTCCTGCACCATGCAGGCTGGTCAGCGAGCATTTAACAAAGGGCCTGACCCTTGAAAGGCTTACTGCTGCATGGC
TGTCTGCATGAACCACGCCTGGTGAAGGAGCCTGGGTGAGAAACACCATCCAAAGCTGGGGCAAAGATGATTACCTTCAGCATGATTACA
ATGTATTACCTTCAGTATGATTACAGAAGTCCTACTTGACAATCACATATAGAAGAACGGTGCTATTCAGTAAGTTCTCTTTCCTTTCCC
TTGGAGGGAAGACAGCAGAGTCATCAGTTAAAAAAAAAAAAAGAAAACCAAACACCTCCCTTGAATAAATTTATACTCCTGTTCCCAGGA
TCTTGAGCTTTAGTGTGCTATACCTATGTGTCTTATCGTGGGCCACTGTGCCAATAAACAAAAACAACTGTTTGGTTTACCTCAGTTGCA
GTAGTTATTTTCATTTAGAAGTTGTTCTCAGATTATTGTTTCAGTTATATAGAGGATTACTAGACTAGTTATGAAGAAACCCCACTACAT
TCAATGGAATTGGTGCTTAAAATCTCATCGATGTGCTGTCTCTGGAGTGATAAGAAAGGGCTACATCTCCCGAAATGATTTCTTTACGTC
ATGTATTGGTTTCCTTCTTCACCTTGAACTTTTGTTGAACTGTATGTACTTTACCCCAAACCTGTTAATATTTTGAGCGCTTCTATGTGA
AAGCAAAGAAATAATTTTAATACTCTGGCATTCATAAATTTTATTGATGAGATTATTTATTTTAAAGGTTTGAGGTAACATCTCTGGTTG
TACCAAAGAAGAAATAAATATGGTTTCTTAATCTCTTGCATGTTTTCTTATAAATAATCATGTTCAATGAAAAGAAGTTACTGAGCTTAT


Top

FusionGenePPI for CPSF6_COL9A1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
CPSF6PLSCR1, GIN1, WWP1, EWSR1, ARMC7, KLHL12, NUDT21, UBAC1, WWP2, NCK2, RNPS1, CREBBP, PAPOLA, ITCH, NEDD4, WWOX, APBB1, TCERG1, MME, CLP1, ITSN2, HNRNPA1, CUL3, CAND1, UBQLN4, U2AF2, UBAP2L, NONO, WBP11, CPSF7, PUF60, CSTF2, POLR2I, NUP88, TCEA2, ZBTB8B, CSNK1A1, SAFB, MAX, STRN, TBC1D2, TTN, NUP107, BARD1, MDC1, SMURF1, NPM1, FN1, CSNK2A1, TP63, DAB2, CD81, LMNA, SRPK2, PRPF40A, WBP4, FXR2, FUS, PPIL1, TOLLIP, OTUB2, CUL7, OBSL1, CCDC8, EZH2, SUZ12, EED, RSRP1, LUC7L2, DDX17, DDX5, KHSRP, SMARCB1, TXNDC9, PCF11, SMARCC1, SMARCC2, SMEK1, NTRK1, XPO1, VPS26A, NF2, SNW1, JMJD6, RBBP6, PA2G4, TRAP1, SND1, ANXA5, MYL12B, SNRPB2, UBE2N, COQ2, DLD, HSD17B10, PARK7, G3BP1COL9A1COL2A1, MAG, CTPS2, COL6A2, COL6A1, COL4A2, PPP1R12C, VHL


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for CPSF6_COL9A1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for CPSF6_COL9A1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgeneCOL9A1C0029422Osteochondrodysplasias2CTD_human
TgeneCOL9A1C0018784Sensorineural Hearing Loss (disorder)1CTD_human;HPO
TgeneCOL9A1C0027092Myopia1CTD_human;HPO
TgeneCOL9A1C0035309Retinal Diseases1CTD_human