FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 7880

FusionGeneSummary for COL1A1_PDGFB

check button Fusion gene summary
Fusion gene informationFusion gene name: COL1A1_PDGFB
Fusion gene ID: 7880
HgeneTgene
Gene symbol

COL1A1

PDGFB

Gene ID

1277

5155

Gene namecollagen type I alpha 1 chainplatelet derived growth factor subunit B
SynonymsEDSARTH1|EDSC|OI1|OI2|OI3|OI4IBGC5|PDGF-2|PDGF2|SIS|SSV|c-sis
Cytomap

17q21.33

22q13.1

Type of geneprotein-codingprotein-coding
Descriptioncollagen alpha-1(I) chainalpha-1 type I collagenalpha1(I) procollagencollagen alpha 1 chain type Icollagen alpha-1(I) chain preproproteincollagen of skin, tendon and bone, alpha-1 chaincollagen, type I, alpha 1pro-alpha-1 collagen type 1type I proplatelet-derived growth factor subunit BPDGF subunit BPDGF, B chainbecaplerminplatelet-derived growth factor 2platelet-derived growth factor B chainplatelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)plate
Modification date2018052720180523
UniProtAcc

P02452

P01127

Ensembl transtripts involved in fusion geneENST00000225964, ENST00000331163, 
ENST00000381551, 
Fusion gene scores* DoF score28 X 47 X 4=52642 X 4 X 1=8
# samples 5215
** MAII scorelog2(52/5264*10)=-3.33957596070679
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(15/8*10)=4.22881869049588
Context

PubMed: COL1A1 [Title/Abstract] AND PDGFB [Title/Abstract] AND fusion [Title/Abstract]

COL1A1-PDGFB gene fusion demonstrates a common histogenetic origin for dermatofibrosarcoma protuberans and its granular cell variant. (pmid: 12131162)
Functional or gene categories assigned by FusionGDB annotationOncogene involved fusion gene, in-frame and retained their domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneCOL1A1

GO:0010718

positive regulation of epithelial to mesenchymal transition

20018240

HgeneCOL1A1

GO:0030335

positive regulation of cell migration

20018240

HgeneCOL1A1

GO:0034504

protein localization to nucleus

20018240

HgeneCOL1A1

GO:0045893

positive regulation of transcription, DNA-templated

20018240

HgeneCOL1A1

GO:0090263

positive regulation of canonical Wnt signaling pathway

20018240

TgenePDGFB

GO:0001938

positive regulation of endothelial cell proliferation

9685360

TgenePDGFB

GO:0002548

monocyte chemotaxis

17991872

TgenePDGFB

GO:0006468

protein phosphorylation

17942966

TgenePDGFB

GO:0008284

positive regulation of cell proliferation

2439522|2836953|7073684

TgenePDGFB

GO:0009611

response to wounding

2538439

TgenePDGFB

GO:0010512

negative regulation of phosphatidylinositol biosynthetic process

2538439

TgenePDGFB

GO:0010544

negative regulation of platelet activation

2538439

TgenePDGFB

GO:0010628

positive regulation of gene expression

23554459|24008408

TgenePDGFB

GO:0010629

negative regulation of gene expression

23554459|25089138

TgenePDGFB

GO:0014068

positive regulation of phosphatidylinositol 3-kinase signaling

10734101|11788434|17942966

TgenePDGFB

GO:0014911

positive regulation of smooth muscle cell migration

9409235

TgenePDGFB

GO:0018105

peptidyl-serine phosphorylation

16530387

TgenePDGFB

GO:0018108

peptidyl-tyrosine phosphorylation

10734101|16530387

TgenePDGFB

GO:0030335

positive regulation of cell migration

11788434|21245381

TgenePDGFB

GO:0031954

positive regulation of protein autophosphorylation

12070119|16530387

TgenePDGFB

GO:0032091

negative regulation of protein binding

22619279

TgenePDGFB

GO:0032147

activation of protein kinase activity

16530387

TgenePDGFB

GO:0032148

activation of protein kinase B activity

16530387

TgenePDGFB

GO:0035655

interleukin-18-mediated signaling pathway

21321938

TgenePDGFB

GO:0035793

positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway

19019919

TgenePDGFB

GO:0043406

positive regulation of MAP kinase activity

9685360|11788434|16530387|17942966

TgenePDGFB

GO:0043536

positive regulation of blood vessel endothelial cell migration

9685360

TgenePDGFB

GO:0043552

positive regulation of phosphatidylinositol 3-kinase activity

16530387

TgenePDGFB

GO:0045737

positive regulation of cyclin-dependent protein serine/threonine kinase activity

16530387

TgenePDGFB

GO:0045840

positive regulation of mitotic nuclear division

10644978|10734101|17942966

TgenePDGFB

GO:0045892

negative regulation of transcription, DNA-templated

16530387|25089138

TgenePDGFB

GO:0045893

positive regulation of transcription, DNA-templated

16530387|17324121

TgenePDGFB

GO:0048008

platelet-derived growth factor receptor signaling pathway

2439522|2536956|2836953|19088079|21245381|23554459

TgenePDGFB

GO:0048146

positive regulation of fibroblast proliferation

2439522|10644978|17324121

TgenePDGFB

GO:0048661

positive regulation of smooth muscle cell proliferation

21321938

TgenePDGFB

GO:0050731

positive regulation of peptidyl-tyrosine phosphorylation

21245381

TgenePDGFB

GO:0050921

positive regulation of chemotaxis

9409235|19019919

TgenePDGFB

GO:0060326

cell chemotaxis

16014047|17991872|21245381

TgenePDGFB

GO:0061098

positive regulation of protein tyrosine kinase activity

16530387

TgenePDGFB

GO:0070374

positive regulation of ERK1 and ERK2 cascade

11788434|16530387|17942966

TgenePDGFB

GO:0071363

cellular response to growth factor stimulus

21245381

TgenePDGFB

GO:0072126

positive regulation of glomerular mesangial cell proliferation

11788434|16014047

TgenePDGFB

GO:0090280

positive regulation of calcium ion import

19019919

TgenePDGFB

GO:1900127

positive regulation of hyaluronan biosynthetic process

17324121

TgenePDGFB

GO:1902894

negative regulation of pri-miRNA transcription by RNA polymerase II

26493107

TgenePDGFB

GO:1902895

positive regulation of pri-miRNA transcription by RNA polymerase II

19088079

TgenePDGFB

GO:1904707

positive regulation of vascular smooth muscle cell proliferation

12070119|19088079|23554459

TgenePDGFB

GO:1904754

positive regulation of vascular associated smooth muscle cell migration

12070119|19088079|23554459

TgenePDGFB

GO:1905064

negative regulation of vascular smooth muscle cell differentiation

19088079

TgenePDGFB

GO:1905176

positive regulation of vascular smooth muscle cell dedifferentiation

19088079

TgenePDGFB

GO:2000379

positive regulation of reactive oxygen species metabolic process

19019919

TgenePDGFB

GO:2000573

positive regulation of DNA biosynthetic process

10644978|10734101|11788434|12070119|16530387|17942966|19019919

TgenePDGFB

GO:2000591

positive regulation of metanephric mesenchymal cell migration

10734101


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1X98710COL1A1chr17

48274370

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15915COL1A1chr17

48265236

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15917COL1A1chr17

48271303

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15921COL1A1chr17

48275521

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15919COL1A1chr17

48267039

-PDGFBchr22

39631879

-
ChiTaRS3.1X98708COL1A1chr17

48269835

-PDGFBchr22

39631882

-
ChiTaRS3.1X98709COL1A1chr17

48275309

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15914COL1A1chr17

48264844

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15913COL1A1chr17

48267361

-PDGFBchr22

39631879

-
ChiTaRS3.1Y16346COL1A1chr17

48266737

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15920COL1A1chr17

48264844

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15918COL1A1chr17

48268743

-PDGFBchr22

39631879

-
ChiTaRS3.1Y15916COL1A1chr17

48268177

-PDGFBchr22

39631881

-
ChiTaRS3.1Y08643COL1A1chr17

48264844

-PDGFBchr22

39631879

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000225964ENST00000331163COL1A1chr17

48274370

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48274370

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48265236

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48265236

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48271303

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48271303

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48275521

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48275521

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48267039

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48267039

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48269835

-PDGFBchr22

39631882

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48269835

-PDGFBchr22

39631882

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48275309

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48275309

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48264844

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48264844

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48267361

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48267361

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48266737

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48266737

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48268743

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48268743

-PDGFBchr22

39631879

-
In-frameENST00000225964ENST00000331163COL1A1chr17

48268177

-PDGFBchr22

39631881

-
In-frameENST00000225964ENST00000381551COL1A1chr17

48268177

-PDGFBchr22

39631881

-

Top

FusionProtFeatures for COL1A1_PDGFB


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
COL1A1

P02452

PDGFB

P01127

Growth factor that plays an essential role in theregulation of embryonic development, cell proliferation, cellmigration, survival and chemotaxis. Potent mitogen for cells ofmesenchymal origin (PubMed:26599395). Required for normalproliferation and recruitment of pericytes and vascular smoothmuscle cells in the central nervous system, skin, lung, heart andplacenta. Required for normal blood vessel development, and fornormal development of kidney glomeruli. Plays an important role inwound healing. Signaling is modulated by the formation ofheterodimers with PDGFA (By similarity).{ECO:0000250|UniProtKB:P31240, ECO:0000269|PubMed:26599395}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-465138_9611411465DomainVWFC
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-455138_9611231465DomainVWFC
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-395138_969431465DomainVWFC
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-385138_968891465DomainVWFC
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-365138_968531465DomainVWFC
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-335138_967811465DomainVWFC
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-325138_967451465DomainVWFC
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-295138_966611465DomainVWFC
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-255138_965891465DomainVWFC
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-115138_962681465DomainVWFC
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-85138_962141465DomainVWFC
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-75138_961961465DomainVWFC
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-46511093_109511411465MotifCell attachment site
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-4651745_74711411465MotifCell attachment site
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-45511093_109511231465MotifCell attachment site
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-4551745_74711231465MotifCell attachment site
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-3951745_7479431465MotifCell attachment site
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-3851745_7478891465MotifCell attachment site
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-3651745_7478531465MotifCell attachment site
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-3351745_7477811465MotifCell attachment site
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-3251745_7477451465MotifCell attachment site
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-4651162_17811411465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-4551162_17811231465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-3951162_1789431465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-3851162_1788891465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-3651162_1788531465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-3351162_1787811465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-3251162_1787451465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-2951162_1786611465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-2551162_1785891465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-1151162_1782681465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-851162_1782141465RegionNote=Nonhelical region (N-terminal)
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-751162_1781961465RegionNote=Nonhelical region (N-terminal)

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-46511229_146411411465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-45511229_146411231465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-39511229_14649431465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-38511229_14648891465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-36511229_14648531465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-33511229_14647811465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-32511229_14647451465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-29511229_14646611465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-25511229_14645891465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-11511229_14642681465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-8511229_14642141465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-7511229_14641961465DomainFibrillar collagen NC1
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-39511093_10959431465MotifCell attachment site
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-38511093_10958891465MotifCell attachment site
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-36511093_10958531465MotifCell attachment site
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-33511093_10957811465MotifCell attachment site
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-32511093_10957451465MotifCell attachment site
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-29511093_10956611465MotifCell attachment site
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-2951745_7476611465MotifCell attachment site
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-25511093_10955891465MotifCell attachment site
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-2551745_7475891465MotifCell attachment site
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-11511093_10952681465MotifCell attachment site
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-1151745_7472681465MotifCell attachment site
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-8511093_10952141465MotifCell attachment site
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-851745_7472141465MotifCell attachment site
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-7511093_10951961465MotifCell attachment site
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-751745_7471961465MotifCell attachment site
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-46511193_121811411465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48264844chr22:39631879ENST00000225964-4651179_119211411465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-45511193_121811231465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48265236chr22:39631879ENST00000225964-4551179_119211231465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-39511193_12189431465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48266737chr22:39631879ENST00000225964-3951179_11929431465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-38511193_12188891465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48267039chr22:39631879ENST00000225964-3851179_11928891465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-36511193_12188531465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48267361chr22:39631879ENST00000225964-3651179_11928531465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-33511193_12187811465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48268177chr22:39631881ENST00000225964-3351179_11927811465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-32511193_12187451465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48268743chr22:39631879ENST00000225964-3251179_11927451465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-29511193_12186611465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48269835chr22:39631882ENST00000225964-2951179_11926611465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-25511193_12185891465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48271303chr22:39631879ENST00000225964-2551179_11925891465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-11511193_12182681465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48274370chr22:39631879ENST00000225964-1151179_11922681465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-8511193_12182141465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48275309chr22:39631879ENST00000225964-851179_11922141465RegionNote=Triple-helical region
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-7511193_12181961465RegionNote=Nonhelical region (C-terminal)
HgeneCOL1A1chr17:48275521chr22:39631879ENST00000225964-751179_11921961465RegionNote=Triple-helical region


Top

FusionGeneSequence for COL1A1_PDGFB


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000331163_chr22_39631882_-_0aa

>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000381551_chr22_39631882_-_0aa

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000331163_chr22_39631881_-_0aa

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000381551_chr22_39631881_-_0aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000331163_chr22_39631882_-_0nt

>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000381551_chr22_39631882_-_0nt

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000331163_chr22_39631881_-_0nt

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000381551_chr22_39631881_-_0nt


* Fusion transcript sequences (Full-length transcript).
>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000331163_chr22_39631882_-_4748nt
AGCAGACGGGAGTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCA
CAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGC
ACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAG
ACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACT
GCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCG
AGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTC
CCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAAT
CAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCT
TCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAG
ATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCC
TCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCA
GCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTG
CTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTG
CTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTG
CTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCT
TCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCA
GCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAG
CTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTG
TTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTG
AAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGGTCCCGCCGGTC
AAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAG
AGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGAC
CCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTC
CTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCT
TTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCTGAACATGACCCGCTCCCACTCTGGAG
GCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCA
CCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCT
CCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGA
AGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCC
GAAGCCCGGGGGGTTCCCAGGAGCAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGG
GCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGG
CAGGGTTATTTAATATGGTATTTGCTGTATTGCCCCCATGGGGTCCTTGGAGTGATAATATTGTTTCCCTCGTCCGTCTGTCTCGATGCC
TGATTCGGACGGCCAATGGTGCTTCCCCCACCCCTCCACGTGTCCGTCCACCCTTCCATCAGCGGGTCTCCTCCCAGCGGCCTCCGGCGT
CTTGCCCAGCAGCTCAAGAAGAAAAAGAAGGACTGAACTCCATCGCCATCTTCTTCCCTTAACTCCAAGAACTTGGGATAAGAGTGTGAG
AGAGACTGATGGGGTCGCTCTTTGGGGGAAACGGGCTCCTTCCCCTGCACCTGGCCTGGGCCACACCTGAGCGCTGTGGACTGTCCTGAG
GAGCCCTGAGGACCTCTCAGCATAGCCTGCCTGATCCCTGAACCCCTGGCCAGCTCTGAGGGGAGGCACCTCCAGGCAGGCCAGGCTGCC
TCGGACTCCATGGCTAAGACCACAGACGGGCACACAGACTGGAGAAAACCCCTCCCACGGTGCCCAAACACCAGTCACCTCGTCTCCCTG
GTGCCTCTGTGCACAGTGGCTTCTTTTCGTTTTCGTTTTGAAGACGTGGACTCCTCTTGGTGGGTGTGGCCAGCACACCAAGTGGCTGGG
TGCCCTCTCAGGTGGGTTAGAGATGGAGTTTGCTGTTGAGGTGGCTGTAGATGGTGACCTGGGTATCCCCTGCCTCCTGCCACCCCTTCC
TCCCCACACTCCACTCTGATTCACCTCTTCCTCTGGTTCCTTTCATCTCTCTACCTCCACCCTGCATTTTCCTCTTGTCCTGGCCCTTCA
GTCTGCTCCACCAAGGGGCTCTTGAACCCCTTATTAAGGCCCCAGATGATCCCAGTCACTCCTCTCTAGGGCAGAAGACTAGAGGCCAGG
GCAGCAAGGGACCTGCTCATCATATTCCAACCCAGCCACGACTGCCATGTAAGGTTGTGCAGGGTGTGTACTGCACAAGGACATTGTATG
CAGGGAGCACTGTTCACATCATAGATAAAGCTGATTTGTATATTTATTATGACAATTTCTGGCAGATGTAGGTAAAGAGGAAAAGGATCC
TTTTCCTAATTCACACAAAGACTCCTTGTGGACTGGCTGTGCCCCTGATGCAGCCTGTGGCTTGGAGTGGCCAAATAGGAGGGAGACTGT
GGTAGGGGCAGGGAGGCAACACTGCTGTCCACATGACCTCCATTTCCCAAAGTCCTCTGCTCCAGCAACTGCCCTTCCAGGTGGGTGTGG
GACACCTGGGAGAAGGTCTCCAAGGGAGGGTGCAGCCCTCTTGCCCGCACCCCTCCCTGCTTGCACACTTCCCCATCTTTGATCCTTCTG
AGCTCCACCTCTGGTGGCTCCTCCTAGGAAACCAGCTCGTGGGCTGGGAATGGGGGAGAGAAGGGAAAAGATCCCCAAGACCCCCTGGGG
TGGGATCTGAGCTCCCACCTCCCTTCCCACCTACTGCACTTTCCCCCTTCCCGCCTTCCAAAACCTGCTTCCTTCAGTTTGTAAAGTCGG
TGATTATATTTTTGGGGGCTTTCCTTTTATTTTTTAAATGTAAAATTTATTTATATTCCGTATTTAAAGTTGTAAAAAAAAATAACCACA
AAACAAAACCAAATGAATCCGCCGGAGGTCTGTCTGTTGGCATCGTGCGTGACAATTAACCTTTCTGCCTTGGCAGGATGTGCCGACAGC
TTGCGGCGTGTTCCTCTCACTCTGGGAGCCTCAGGCGTGATCTCACACACTGGCGTGCACATACACACACACACACATACATGCTCACAC
ATGCGTGCACATACACGCAGGCCTGCAACTTGGGGGAGGCCTCTGTCTGGCGGGAAGAAGAGACACACAGGCTACTCTGTTGGTCTTGGT

>In-frame_COL1A1_ENST00000225964_chr17_48269835_-_PDGFB_ENST00000381551_chr22_39631882_-_3172nt
AGCAGACGGGAGTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCA
CAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGC
ACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAG
ACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACT
GCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCG
AGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTC
CCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAAT
CAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCT
TCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAG
ATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCC
TCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCA
GCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTG
CTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTG
CTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTG
CTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCT
TCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCA
GCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAG
CTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTG
TTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTG
AAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGGTCCCGCCGGTC
AAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAG
AGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGAC
CCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTC
CTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCT
TTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCTGAACATGACCCGCTCCCACTCTGGAG
GCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCA
CCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCT
CCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGA
AGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCC
GAAGCCCGGGGGGTTCCCAGGAGCAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGG
GCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGG
CAGGGTTATTTAATATGGTATTTGCTGTATTGCCCCCATGGGGTCCTTGGAGTGATAATATTGTTTCCCTCGTCCGTCTGTCTCGATGCC
TGATTCGGACGGCCAATGGTGCTTCCCCCACCCCTCCACGTGTCCGTCCACCCTTCCATCAGCGGGTCTCCTCCCAGCGGCCTCCGGCGT
CTTGCCCAGCAGCTCAAGAAGAAAAAGAAGGACTGAACTCCATCGCCATCTTCTTCCCTTAACTCCAAGAACTTGGGATAAGAGTGTGAG
AGAGACTGATGGGGTCGCTCTTTGGGGGAAACGGGCTCCTTCCCCTGCACCTGGCCTGGGCCACACCTGAGCGCTGTGGACTGTCCTGAG

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000331163_chr22_39631881_-_5108nt
AGCAGACGGGAGTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCA
CAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGC
ACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAG
ACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACT
GCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCG
AGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTC
CCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAAT
CAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCT
TCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAG
ATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCC
TCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCA
GCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTG
CTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTG
CTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTG
CTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCT
TCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCA
GCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAG
CTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTG
TTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTG
AAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGGTCCCGCCGGTC
AAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAG
AGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGAC
CCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTC
CTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGTGTTCCTGGAGACCTTGGCGCCCCTGGCCCCTCTGGAGCAAGAGGCGAGAGAGGTT
TCCCTGGCGAGCGTGGTGTGCAAGGTCCCCCTGGTCCTGCTGGTCCCCGAGGGGCCAACGGTGCTCCCGGCAACGATGGTGCTAAGGGTG
ATGCTGGTGCCCCTGGAGCTCCCGGTAGCCAGGGCGCCCCTGGCCTTCAGGGAATGCCTGGTGAACGTGGTGCAGCTGGTCTTCCAGGGC
CTAAGGGTGACAGAGGTGATGCTGGTCCCAAAGGTGCTGATGGCTCTCCTGGCAAAGATGGCGTCCGTGGTCTGACTGGCCCCATTGGTC
CTCCTGGCCCTGCTGGTGCCCCTGGTGACAAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCT
TTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCTGAACATGACCCGCTCCCACTCTGGAG
GCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCA
CCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCT
CCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGA
AGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCC
GAAGCCCGGGGGGTTCCCAGGAGCAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGG
GCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGG
CAGGGTTATTTAATATGGTATTTGCTGTATTGCCCCCATGGGGTCCTTGGAGTGATAATATTGTTTCCCTCGTCCGTCTGTCTCGATGCC
TGATTCGGACGGCCAATGGTGCTTCCCCCACCCCTCCACGTGTCCGTCCACCCTTCCATCAGCGGGTCTCCTCCCAGCGGCCTCCGGCGT
CTTGCCCAGCAGCTCAAGAAGAAAAAGAAGGACTGAACTCCATCGCCATCTTCTTCCCTTAACTCCAAGAACTTGGGATAAGAGTGTGAG
AGAGACTGATGGGGTCGCTCTTTGGGGGAAACGGGCTCCTTCCCCTGCACCTGGCCTGGGCCACACCTGAGCGCTGTGGACTGTCCTGAG
GAGCCCTGAGGACCTCTCAGCATAGCCTGCCTGATCCCTGAACCCCTGGCCAGCTCTGAGGGGAGGCACCTCCAGGCAGGCCAGGCTGCC
TCGGACTCCATGGCTAAGACCACAGACGGGCACACAGACTGGAGAAAACCCCTCCCACGGTGCCCAAACACCAGTCACCTCGTCTCCCTG
GTGCCTCTGTGCACAGTGGCTTCTTTTCGTTTTCGTTTTGAAGACGTGGACTCCTCTTGGTGGGTGTGGCCAGCACACCAAGTGGCTGGG
TGCCCTCTCAGGTGGGTTAGAGATGGAGTTTGCTGTTGAGGTGGCTGTAGATGGTGACCTGGGTATCCCCTGCCTCCTGCCACCCCTTCC
TCCCCACACTCCACTCTGATTCACCTCTTCCTCTGGTTCCTTTCATCTCTCTACCTCCACCCTGCATTTTCCTCTTGTCCTGGCCCTTCA
GTCTGCTCCACCAAGGGGCTCTTGAACCCCTTATTAAGGCCCCAGATGATCCCAGTCACTCCTCTCTAGGGCAGAAGACTAGAGGCCAGG
GCAGCAAGGGACCTGCTCATCATATTCCAACCCAGCCACGACTGCCATGTAAGGTTGTGCAGGGTGTGTACTGCACAAGGACATTGTATG
CAGGGAGCACTGTTCACATCATAGATAAAGCTGATTTGTATATTTATTATGACAATTTCTGGCAGATGTAGGTAAAGAGGAAAAGGATCC
TTTTCCTAATTCACACAAAGACTCCTTGTGGACTGGCTGTGCCCCTGATGCAGCCTGTGGCTTGGAGTGGCCAAATAGGAGGGAGACTGT
GGTAGGGGCAGGGAGGCAACACTGCTGTCCACATGACCTCCATTTCCCAAAGTCCTCTGCTCCAGCAACTGCCCTTCCAGGTGGGTGTGG
GACACCTGGGAGAAGGTCTCCAAGGGAGGGTGCAGCCCTCTTGCCCGCACCCCTCCCTGCTTGCACACTTCCCCATCTTTGATCCTTCTG
AGCTCCACCTCTGGTGGCTCCTCCTAGGAAACCAGCTCGTGGGCTGGGAATGGGGGAGAGAAGGGAAAAGATCCCCAAGACCCCCTGGGG
TGGGATCTGAGCTCCCACCTCCCTTCCCACCTACTGCACTTTCCCCCTTCCCGCCTTCCAAAACCTGCTTCCTTCAGTTTGTAAAGTCGG
TGATTATATTTTTGGGGGCTTTCCTTTTATTTTTTAAATGTAAAATTTATTTATATTCCGTATTTAAAGTTGTAAAAAAAAATAACCACA
AAACAAAACCAAATGAATCCGCCGGAGGTCTGTCTGTTGGCATCGTGCGTGACAATTAACCTTTCTGCCTTGGCAGGATGTGCCGACAGC
TTGCGGCGTGTTCCTCTCACTCTGGGAGCCTCAGGCGTGATCTCACACACTGGCGTGCACATACACACACACACACATACATGCTCACAC
ATGCGTGCACATACACGCAGGCCTGCAACTTGGGGGAGGCCTCTGTCTGGCGGGAAGAAGAGACACACAGGCTACTCTGTTGGTCTTGGT

>In-frame_COL1A1_ENST00000225964_chr17_48268177_-_PDGFB_ENST00000381551_chr22_39631881_-_3532nt
AGCAGACGGGAGTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCA
CAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGC
ACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAG
ACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACT
GCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCG
AGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTC
CCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAAT
CAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCT
TCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAG
ATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCC
TCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCA
GCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTG
CTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTG
CTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTG
CTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCT
TCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCA
GCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAG
CTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTG
TTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTG
AAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGGTCCCGCCGGTC
AAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAG
AGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGAC
CCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTC
CTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGTGTTCCTGGAGACCTTGGCGCCCCTGGCCCCTCTGGAGCAAGAGGCGAGAGAGGTT
TCCCTGGCGAGCGTGGTGTGCAAGGTCCCCCTGGTCCTGCTGGTCCCCGAGGGGCCAACGGTGCTCCCGGCAACGATGGTGCTAAGGGTG
ATGCTGGTGCCCCTGGAGCTCCCGGTAGCCAGGGCGCCCCTGGCCTTCAGGGAATGCCTGGTGAACGTGGTGCAGCTGGTCTTCCAGGGC
CTAAGGGTGACAGAGGTGATGCTGGTCCCAAAGGTGCTGATGGCTCTCCTGGCAAAGATGGCGTCCGTGGTCTGACTGGCCCCATTGGTC
CTCCTGGCCCTGCTGGTGCCCCTGGTGACAAGGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATCCGCTCCT
TTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCTGAACATGACCCGCTCCCACTCTGGAG
GCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCA
CCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCT
CCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGA
AGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCC
GAAGCCCGGGGGGTTCCCAGGAGCAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGG
GCAAGCACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGG
CAGGGTTATTTAATATGGTATTTGCTGTATTGCCCCCATGGGGTCCTTGGAGTGATAATATTGTTTCCCTCGTCCGTCTGTCTCGATGCC
TGATTCGGACGGCCAATGGTGCTTCCCCCACCCCTCCACGTGTCCGTCCACCCTTCCATCAGCGGGTCTCCTCCCAGCGGCCTCCGGCGT
CTTGCCCAGCAGCTCAAGAAGAAAAAGAAGGACTGAACTCCATCGCCATCTTCTTCCCTTAACTCCAAGAACTTGGGATAAGAGTGTGAG
AGAGACTGATGGGGTCGCTCTTTGGGGGAAACGGGCTCCTTCCCCTGCACCTGGCCTGGGCCACACCTGAGCGCTGTGGACTGTCCTGAG


Top

FusionGenePPI for COL1A1_PDGFB


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
COL1A1IGFBP3, TXN, ITGA2, ITGB1, NID1, NID2, SPARC, PRELP, PKD1, VWF, THBS1, MMP2, COL7A1, MATN2, MAG, ELAVL1, ATP13A2, C12orf57, RNH1, BARD1, BRCA1, UBC, CAPN1, COL1A1, COL1A2, PDGFA, PDGFB, GIPC2, UBXN11, DNM3, CD200R1, TMTC4, ERAL1, CAMKMT, TMEM180, OTUB1, EGFR, COLGALT2, P4HA2, PLOD1, LIN9, TIMM44, RASGEF1B, TLE3, YAF2, LPAR1, CYLD, MCPH1PDGFBPDGFRA, LRP1, SPARC, PDAP1, THBS1, PDGFB, HSPG2, MDFI, ADIPOQ, COL1A1, COL1A2, COL2A1, COL3A1, COL4A1, COL5A1, COL6A1, NRP1, LYVE1, PDGFRB, FAT3, DDX54, C11orf57, ZC3H4, MRPS18C, GPR98, RPL26L1, MRPS35, MRPS9, PTCD3, NSA2, MRPS33, RPL36AL, MRPL30, BRIX1, UTP23, FAT1, C1QBP, NOC2L, BMS1, NOC3L, MDM2, RPF2, MRPL47, MYCBP2, MRPS5, MRPL45, FREM2, MRPS31, NOC4L, DKC1, RPS3, MALSU1, DHX30, UTP3, MRPL27, RPL15, GNL2, RRP12, GLTSCR2, BUD13, RBM28, FAT4, MYBBP1A, RPS15, RBM34, GLYR1, MRPL51, CEBPZ, PPAN-P2RY11, TEX10, EBNA1BP2, KIAA0020, SRRM1, KRI1, MRPL13, MRPS24


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for COL1A1_PDGFB


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
HgeneCOL1A1P02452DB00048Collagenase clostridium histolyticumCollagen alpha-1(I) chainbiotechapproved|investigational
HgeneCOL1A1P02452DB13133Von Willebrand Factor HumanCollagen alpha-1(I) chainbiotechapproved|investigational

Top

RelatedDiseases for COL1A1_PDGFB


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneCOL1A1C0268358Osteogenesis imperfecta, dominant perinatal lethal39CTD_human;ORPHANET;UNIPROT
HgeneCOL1A1C0268362Osteogenesis imperfecta type III (disorder)18CTD_human;ORPHANET;UNIPROT
HgeneCOL1A1C0268363Osteogenesis imperfecta type IV (disorder)14CTD_human;ORPHANET;UNIPROT
HgeneCOL1A1C0023931Lobstein's Disease12ORPHANET;UNIPROT
HgeneCOL1A1C0023890Liver Cirrhosis4CTD_human
HgeneCOL1A1C0023893Liver Cirrhosis, Experimental3CTD_human
HgeneCOL1A1C4225429Ehlers-Danlos syndrome classic type2UNIPROT
HgeneCOL1A1C0000786Spontaneous abortion1CTD_human
HgeneCOL1A1C0002949Aneurysm, Dissecting1CTD_human
HgeneCOL1A1C0003504Aortic Valve Insufficiency1CTD_human
HgeneCOL1A1C0004364Autoimmune Diseases1CTD_human
HgeneCOL1A1C0006663Calcinosis1CTD_human
HgeneCOL1A1C0008311Cholangitis1CTD_human
HgeneCOL1A1C0016059Fibrosis1CTD_human
HgeneCOL1A1C0018824Heart valve disease1CTD_human
HgeneCOL1A1C0020497Cortical Congenital Hyperostosis1CTD_human;ORPHANET;UNIPROT
HgeneCOL1A1C0020538Hypertensive disease1CTD_human
HgeneCOL1A1C0022548Keloid1CTD_human
HgeneCOL1A1C0027726Nephrotic Syndrome1CTD_human
HgeneCOL1A1C0029172Oral Submucous Fibrosis1CTD_human
HgeneCOL1A1C0029434Osteogenesis Imperfecta1CTD_human
HgeneCOL1A1C0149721Left Ventricular Hypertrophy1CTD_human
HgeneCOL1A1C1619692Nephrogenic Fibrosing Dermopathy1CTD_human
TgenePDGFBC0004782Basal Ganglia Diseases1CTD_human
TgenePDGFBC0006663Calcinosis1CTD_human
TgenePDGFBC0016059Fibrosis1CTD_human
TgenePDGFBC0017566Gingival Hyperplasia1CTD_human
TgenePDGFBC0034069Pulmonary Fibrosis1CTD_human
TgenePDGFBC0035309Retinal Diseases1CTD_human
TgenePDGFBC0040028Thrombocythemia, Essential1CTD_human
TgenePDGFBC0393590Fahr's syndrome (disorder)1CTD_human;ORPHANET
TgenePDGFBC2239176Liver carcinoma1CTD_human
TgenePDGFBC3809645BASAL GANGLIA CALCIFICATION, IDIOPATHIC, 51UNIPROT