FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 7435

FusionGeneSummary for CLMN_VTI1B

check button Fusion gene summary
Fusion gene informationFusion gene name: CLMN_VTI1B
Fusion gene ID: 7435
HgeneTgene
Gene symbol

CLMN

VTI1B

Gene ID

79789

10490

Gene namecalminvesicle transport through interaction with t-SNAREs 1B
Synonyms-VTI1|VTI1-LIKE|VTI1L|VTI2|v-SNARE|vti1-rp1
Cytomap

14q32.13

14q24.1

Type of geneprotein-codingprotein-coding
Descriptioncalmincalmin (calponin-like, transmembrane)calponin-like transmembrane domain proteinvesicle transport through interaction with t-SNAREs homolog 1Bvesicle transport v-SNARE protein Vti1-like 1vesicle-associated soluble NSF attachment protein receptor
Modification date2018052320180523
UniProtAcc

Q96JQ2

Q9UEU0

Ensembl transtripts involved in fusion geneENST00000298912, ENST00000557215, 
ENST00000556441, 
ENST00000554659, 
Fusion gene scores* DoF score5 X 2 X 5=505 X 5 X 3=75
# samples 55
** MAII scorelog2(5/50*10)=0log2(5/75*10)=-0.584962500721156
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: CLMN [Title/Abstract] AND VTI1B [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneVTI1B

GO:1903076

regulation of protein localization to plasma membrane

18570918


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVLIHCTCGA-CC-5263-01ACLMNchr14

95786048

-VTI1Bchr14

68120215

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000298912ENST00000554659CLMNchr14

95786048

-VTI1Bchr14

68120215

-
intron-3CDSENST00000557215ENST00000554659CLMNchr14

95786048

-VTI1Bchr14

68120215

-
intron-3CDSENST00000556441ENST00000554659CLMNchr14

95786048

-VTI1Bchr14

68120215

-

Top

FusionProtFeatures for CLMN_VTI1B


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
CLMN

Q96JQ2

VTI1B

Q9UEU0

V-SNARE that mediates vesicle transport pathways throughinteractions with t-SNAREs on the target membrane. Theseinteractions are proposed to mediate aspects of the specificity ofvesicle trafficking and to promote fusion of the lipid bilayers.May be concerned with increased secretion of cytokines associatedwith cellular senescence. {ECO:0000269|PubMed:23217709}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-36230_232180233Topological domainVesicular
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-36209_229180233TransmembraneHelical%3B Anchor for type IV membrane protein

- In-frame and not-retained protein feature among the 13 regional features.
>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneCLMNchr14:95786048chr14:68120215ENST00000298912-113187_291271003DomainCalponin-homology (CH) 2
HgeneCLMNchr14:95786048chr14:68120215ENST00000298912-11332_139271003DomainCalponin-homology (CH) 1
HgeneCLMNchr14:95786048chr14:68120215ENST00000298912-1131_288271003RegionNote=Actin-binding
HgeneCLMNchr14:95786048chr14:68120215ENST00000298912-113977_997271003TransmembraneHelical%3B Anchor for type IV membrane protein
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-36161_198180233Coiled coilOntology_term=ECO:0000255
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-3635_98180233Coiled coilOntology_term=ECO:0000255
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-362_208180233Topological domainCytoplasmic


Top

FusionGeneSequence for CLMN_VTI1B


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_CLMN_ENST00000298912_chr14_95786048_-_VTI1B_ENST00000554659_chr14_68120215_-_80aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_CLMN_ENST00000298912_chr14_95786048_-_VTI1B_ENST00000554659_chr14_68120215_-_241nt
ATGGCTGCACACGAGTGGGACTGGTTCCAACGCGAGGAGCTCATCGGGCAGATTAGCGACATCCGAGTGCAGAACCTGCAAGCTGGTAAA
CACAAGTGAAAACTTGAGCAAAAGTCGGAAGATTCTCCGTTCAATGTCCAGAAAAGTGACAACCAACAAGCTGCTGCTTTCCATTATCAT


* Fusion transcript sequences (Full-length transcript).
>In-frame_CLMN_ENST00000298912_chr14_95786048_-_VTI1B_ENST00000554659_chr14_68120215_-_4665nt
GACTCCAGCTCCGCGGCGCCCTCGCCGGGTGCGTGCCGCTCGCGCGCCCGCCAGCCAGGCTCTCCGCGCCCGCCGCCCGCGCCGCGCTGG
CCCGGGCTCTCCCGCCCGCGCTTCATGGCTGCACACGAGTGGGACTGGTTCCAACGCGAGGAGCTCATCGGGCAGATTAGCGACATCCGA
GTGCAGAACCTGCAAGCTGGTAAACACAAGTGAAAACTTGAGCAAAAGTCGGAAGATTCTCCGTTCAATGTCCAGAAAAGTGACAACCAA
CAAGCTGCTGCTTTCCATTATCATCTTACTGGAGCTCGCCATCCTGGGAGGCCTGGTTTACTACAAATTCTTTCGCAGCCATTGAACTTC
TATAGGGAAGGGTTTGTGGACCAGAACTTTGACCTTGTGAATGCATGATGTTAGGGATGTGGATAGAATAAGCATATTGCTGCTGTGGGC
TGACAGTTCAAGGATGCACTGTATAGCCAGGCTGTGGGAGGAGGGAGGAAAGATGAAAAACCACTTAAATGTGAAGGAACAACAGCAACA
AGACCAGTATGATATACCAAGGTAATAAATGCTGTTTATGACTTCTTTAAATTTACATAGTACTGTAGCATATTAATACCCTGTGAACTG
CAAAAAACCAAATACATTTACAGTAGTATTGGTCACCAAAATAGAGGGGAAACTTTACAATTGTGAGAATGTGTAAATGTTCTCATTAAG
GCAGTATTGACCCAGACAACCATTTAGTATTCATCTATCCCCTCAATGCCTCATAATTCTGGAATGCCTGTTGTGAAACATGTCAGTGCA
CAGTGTCTCCTAAATTCTCACACGTGCTTGATTTTCTGATTCATCTGGTGAACTGGGAGTAGGAAGTTGGTCATAGACAATATGCCCTCC
TTCTCTTGTCTGACCAAAGCTTGAAGCAATCACATCTACTGCCAGGTTAGCTGTAGTCTTCGCCTCTTCCTCTGAGGTGGCCAACTGAGG
ATTGACTTCAACAAGATCCAGTGCTGATAGCAACCCTGGAAGAACAAAGTGTGACAAAACCTCAGGTTCCCTTGCTGCTACTCTCAGTGA
GGGTCATCCCACTGGGACAGGGAGAACAAGCCAAAGTAAAAACAAGAGTCCATTTTATAGTAGAAAATACCTATTTTTAGGAAGCCCCTT
GCACCTCATCCTCTTGGCCATGAATTTAAGTTAAAACACTGTTGTGCTATAGTAGATTAAAAGAAACCTTTTAAGATAATGAAATAAACC
ATCCCTGTTCAACTAACATAACAGGCATAATTGTCAGGCGTTCTGGAAAAGGAAAAGGCTTGGTGTTGGGTGGGGGAGGTTTTCATCCTG
CTTGTTGGCAAAATGTATGCCACCTCCAGTATGACTAGGAACCTTCCAGATGCCTGCCTGGAAATGAATCAAGTATGAAGGCAGAGGAAA
TCTGCCACTTGCACTAGCCAAACTGCATTCCCACTTTTGAACTCTAATGTGTTATCTGTATCTGTTAGAGCACCACACCATATGCCCTGA
AATGTAGTTATTACTGCAAACTTCATTCTCACCCCTGCAGGCCTGAGCTCTGGAGGCAGGTTCCACATCTAACAACATCTTTTTGTCTCC
CAGCAGACTGACCCAGTGTCTTGTACTTGATCAAGAGAAAATTCAGCCATATGTTAATTATTTTATCTGGACTTCAGTTACCTTCTGTTA
AGGTTTGAGAACTTGTGTCAAAGTTCTCGGTAGTGTTCCTTTGGCCTGGAGCAAGTGGAAGGGAAGCTTAAACCAGAAGAACCTATCCAG
ACCTGCTACTATGCTCACCCCTCTAAATGCCTCACTTCTCTATAGAATTTAACTTTTTAGTTGGTTATTCTGGATGAAGGGTGATCTGAA
CAAGCTAGTATTCAGGAATACAAGTATCTAAGAATATTTAGGGTGGCCATAAAGTCTGGAAACACAGGCAAATGTACCTAATGGTTTATT
GATATTACACTATAGTACATGATGTGCTGAATGCCATCATGTCCGTTCAGCATCTTCCCTTATTAGCAATGCATAGTTGAGTGTACAGTG
CCAAACTGCAACCAACAGGTGTATTACTGTAGCATTTCCATCATTTCCTGCACATGGACCTGTGTTCCTGATTTGTCTCTGATTTCCACT
GACTAAACCTGCACCTTTAGCATATCCCAGAAGTGGTCATCAAAGTTTGCACTATTAGAAATATATACATGACTTATGTTTCCAGACTAT
TGCCACCCTATAAATTAAGCAAACTGCTTTATGTATCTAGTTGACAGCATTATAACAGTGCAGTGGCACAATCATGGCTCACTGCAGCCT
CAACCTCCCAAGTAGTTGGGACACCTGGCTAATTATTTTTTGTAGAAACGGGGTCACACTATGTTGCCCACGCTGGTCTTGAACCCCTGG
GGTCAAGTAATCCTCTTGCCTTGGCCTCCCAGAGTACTGGGATTATAGGTATGAACCACTGTGCCTAGCCCCATGAGTGTCTTTTGGAGT
AAAATATTGTAGCATAGGAACAAAGAGACAAGCCATGCCATATATAAGTGCTAGAGGTTATTAACCCCTGCTCTAAGTGGTGTTTTTAGG
AAGCAAAGCAGAGAATTGAACCCCCAAGTTCTCTGGCCAATAACCTAAGGACCACTGGCAACATCTAAGATTGCAGATCTGAGAATTAGA
CCAGTACTGCCTGCCTTTTTGTACTGCCTAAGGTTCTGGCAGGCTGTGGCGCTAAGGAGACCATTTCTCAATGTGAGTTTCTATCCCAGC
TAGTCAAGGGTTCTCTATAGCCCTGAACCTTTCAATCTGGGGTCTCTATCTATACCCTAGTTCCATCAGATGGTTACTGAAGCAGTATGA
TTTGGTAGTTCTTTAAATTTTGGAATGAAAGGTCATTTGAAGTAGCTTTAAAACCAGAAGCTTTCTGACAGAAATGGAAACTGTTTGCAA
ACAAGTATGAGTTTTGGAAAAGTAGCCAGTCTTGATAACGTAGAATTCATCTTAGTACTCTTTCCATCAGCCATTCTCATCTAACTGTAT
CCCCCTTATTAGAAATCCTTTCAGGCTCTAGTACAAGACCTACCCTACATAAAGGACCCAAGATATTGTCCAGTTTGCAGATTTCTTCAA
GAGATCAGCTTTAGCTCCAAATTCACAACTCCCAATGAACCAATCTCTTAGAGTGCAAATTACAGCCTTGCACTCTTATCTTATCTTGCC
TTCTTATCTTAATCTGCCTTTAGATAACTCAAAGAACTGCATCAGTTTGACAATTTATTCTTGTATTTAATTGTTTAAATATACAATTTT
TTACTCATTATTACCTTAGTGTAATTTGGTAAGAGCCATGTCCAAGCATGACTCTAAAGGACTATATCCTTTTTATTAGCATGGCCATAT
AATTTTTAGCTACAAAAGTTTAAGCAAAAACAAACTCTGCAATGATGTGGAATAGCAGAAAAGATCCTTTGCAGGCAAGAGACTCTAGCA
TATTTACCTATGTAGTTAACAGGCTGCAGACCTGGTTGCTACATACCTGTATTGTGTATTTCCTCAGCAATATACATGCCTTCTCGATAG
GTTAGTCCCCCGACAACAGGAGTTCCTGTGGCTGGAGCCAGTGTAGGGTCAAATGCATCAATATCAAAACTCAAATGGATTGGTCTTTGT
CTCCTAAAAAGGAAGAGGATAAAATAATACTTAAAATAATACTTAACTGGTTGTCCTTGGACACTCATCCTTCTTATGGTTGCAACTCCT
TGATTTTGTTGCTATTAGTCCTAGTACTTTGTTAATAAAGCTGTTAATACATTTCCAGGCTTCCTATTCTTGGAAGTTACTGAGATTGGC
AATATTAACTTCCTACATACCACTTCATGATACTGCCATTTGTTCTGCATACCTCAGACAGACTAACTCCAATGTATATTTCTGCCTTAC
ACTGGGTATTAGAACCTCTTATACTAATAACTGTCAATAGAGAGATTTCTTCACTTCTAGATGAGATTGGGCTCTCATCTAGAGACAATT
TAATTAGACAATTTAAATTAGTCTAATTTAAATTGGCTTGATGTAAGTTATGGTTGCTCTTATTCTCTGAACGTAACAGCAGCTGAAGTG
AACTCTAATTTTAGGTCTGCAGTTTTAACATCTTCCATTTCTAACTTCATTATAGCCCCAGTGTCCAAAGGCTGAAGCTAACAACTAAGT
TTCTTAACAGCTTATGAAATGACATACTACCAGATAACAATTCTGACATTAATCACCCAGAAGTAAAGACTTGGTATTGGGAAAATGCTC
TTAAAATTACCATTTGATTAGTATTCATCTGCCATCTTTCTACACTGCCAAGATTTGCTTAATATAAAACTCAGATGAAACAATCGTGAG
GCTGGGAAGAATGGGACAGTTGAAACAATAAATGCTTGTCATCTCAGAAGATAAGCATTAAAGATGGAGATAAAGAAAAATTCATGAGAC
AGAAGATCTAGGCAATGATTTAGAGGAAACCTCCTCCCAAAAACCCCAGAGGAAGAATATGACCTGTGTTTCAAATTTTGCCTTTCTGAA


Top

FusionGenePPI for CLMN_VTI1B


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
CLMNPPP1CC, CDH1, TCTEX1D2VTI1BSTX8, STX5, VAMP4, STX7, NSF, ATP6V1B1, STX4, PTPN5, SYNE4, TRIM59, KRTAP10-7, LDLRAD1, CAND2, EIF2B5, RNF13, EIF2B1, CCDC9, EIF2B4, IPO7, NAPA, IPO9, STX18, EIF4A3, NBAS, NAPG, CWC27, CWC22, STX6, HEPHL1, CALML3, ACIN1, ECD, AP3B1, S100A3, STX12, AP3M1, VPS45, SESTD1, PPP1R15B, UBTF, EIF2B2, STXBP5, EIF2B3, VSIG8, DSG4, FHL2, ARL10, STX10, VAMP3, CASC3, ACP2, C19orf25, PPP2R5E, CLEC12A, CEP170, TNFSF13B, HAUS7, SLC39A4, DTNBP1, EVA1C, CREB3, CLTC, GTSE1, DUSP22, MED21, CLINT1, GDPD5, AP1S2, STXBP6, TRDN, SCN3B, STAMBPL1, SEC22B, STX11, HAUS1, RABGEF1, CDH5, ASPH, TBC1D15, PRPSAP2, STAMBP, MANSC1, EXOC1, DCTN2, LMNA


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-362_23180233CLINT1
TgeneVTI1Bchr14:95786048chr14:68120215ENST00000554659-3669_73180233CLINT1


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for CLMN_VTI1B


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for CLMN_VTI1B


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource