FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 4182

FusionGeneSummary for BIRC3_MALT1

check button Fusion gene summary
Fusion gene informationFusion gene name: BIRC3_MALT1
Fusion gene ID: 4182
HgeneTgene
Gene symbol

BIRC3

MALT1

Gene ID

330

10892

Gene namebaculoviral IAP repeat containing 3MALT1 paracaspase
SynonymsAIP1|API2|CIAP2|HAIP1|HIAP1|MALT2|MIHC|RNF49|c-IAP2IMD12|MLT|MLT1|PCASP1
Cytomap

11q22.2

18q21.32

Type of geneprotein-codingprotein-coding
Descriptionbaculoviral IAP repeat-containing protein 3IAP homolog CIAP-1RING finger protein 49RING-type E3 ubiquitin transferase BIRC3TNFR2-TRAF signaling complex proteinTNFR2-TRAF-signaling complex protein 1apoptosis inhibitor 2cellular inhibitor of apoptosmucosa-associated lymphoid tissue lymphoma translocation protein 1MALT lymphoma-associated translocationMALT1 proteasecaspase-like proteinmucosa associated lymphoid tissue lymphoma translocation gene 1paracaspaseparacaspase-1
Modification date2018052320180529
UniProtAcc

Q13489

Q9UDY8

Ensembl transtripts involved in fusion geneENST00000526421, ENST00000263464, 
ENST00000532808, 
ENST00000348428, 
ENST00000345724, 
Fusion gene scores* DoF score2 X 2 X 2=84 X 4 X 2=32
# samples 24
** MAII scorelog2(2/8*10)=1.32192809488736log2(4/32*10)=0.321928094887362
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: BIRC3 [Title/Abstract] AND MALT1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneBIRC3

GO:0031398

positive regulation of protein ubiquitination

21931591

TgeneMALT1

GO:0006508

proteolysis

18223652

TgeneMALT1

GO:0042981

regulation of apoptotic process

12819136

TgeneMALT1

GO:0050852

T cell receptor signaling pathway

15125833

TgeneMALT1

GO:0051168

nuclear export

16123224

TgeneMALT1

GO:0051259

protein complex oligomerization

15125833


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1AF123094BIRC3chr11

102201973

+MALT1chr18

56363598

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
intron-3CDSENST00000526421ENST00000348428BIRC3chr11

102201973

+MALT1chr18

56363598

+
intron-3CDSENST00000526421ENST00000345724BIRC3chr11

102201973

+MALT1chr18

56363598

+
In-frameENST00000263464ENST00000348428BIRC3chr11

102201973

+MALT1chr18

56363598

+
In-frameENST00000263464ENST00000345724BIRC3chr11

102201973

+MALT1chr18

56363598

+
In-frameENST00000532808ENST00000348428BIRC3chr11

102201973

+MALT1chr18

56363598

+
In-frameENST00000532808ENST00000345724BIRC3chr11

102201973

+MALT1chr18

56363598

+

Top

FusionProtFeatures for BIRC3_MALT1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
BIRC3

Q13489

MALT1

Q9UDY8

Multi-functional protein which regulates not onlycaspases and apoptosis, but also modulates inflammatory signalingand immunity, mitogenic kinase signaling and cell proliferation,as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates bothcanonical and non-canonical NF-kappa-B signaling by acting inopposite directions: acts as a positive regulator of the canonicalpathway and suppresses constitutive activation of non-canonicalNF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4,CASP3, CASP7, CASP8, IKBKE, TRAF1, and BCL10. Acts as an importantregulator of innate immune signaling via regulation of Toll-likereceptors (TLRs), Nodlike receptors (NLRs) and RIG-I likereceptors (RLRs), collectively referred to as pattern recognitionreceptors (PRRs). Protects cells from spontaneous formation of theripoptosome, a large multi-protein complex that has the capabilityto kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation byubiquitinating RIPK1 and CASP8. {ECO:0000269|PubMed:21931591,ECO:0000269|PubMed:23453969}. Enhances BCL10-induced activation of NF-kappa-B.Involved in nuclear export of BCL10. Binds to TRAF6, inducingTRAF6 oligomerization and activation of its ligase activity. Hasubiquitin ligase activity. MALT1-dependent BCL10 cleavage plays animportant role in T-cell antigen receptor-induced integrinadhesion. Involved in the induction of T helper 17 cells (Th17)differentiation. Cleaves RC3H1 and ZC3H12A in response to T-cellreceptor (TCR) stimulation which releases their cooperativelyrepressed targets to promote Th17 cell differentiation (Bysimilarity). {ECO:0000250|UniProtKB:Q2TBA3,ECO:0000269|PubMed:11262391, ECO:0000269|PubMed:14695475,ECO:0000269|PubMed:18264101}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for BIRC3_MALT1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_BIRC3_ENST00000263464_chr11_102201973_+_MALT1_ENST00000348428_chr18_56363598_+_8470nt
GGCCAGGCGACAGGTGTCGCTTGAAAAGACTGGGCTTGTCCTTGCTGGTGCATGCGTCGTCGGCCTCTGGGCAGCAGGTTTACAAAGGAG
GAAAACGACTTCTTCTAGATTTTTTTTTCAGTTTCTTCTATAAATCAAAACATCTCAAAATGGAGACCTAAAATCCTTAAAGGGACTTAG
TCTAATCTCGGGAGGTAGTTTTGTGCATGGGTAAACAAATTAAGTATTAACTGGTGTTTTACTATCCAAAGAATGCTAATTTTATAAACA
TGATCGAGTTATATAAGGTATACCATAATGAGTTTGATTTTGAATTTGATTTGTGGAAATAAAGGAAAAGTGATTCTAGCTGGGGCATAT
TGTTAAAGCATTTTTTTCAGAGTTGGCCAGGCAGTCTCCTACTGGCACATTCTCCCATTATGTAGAATAGAAATAGTACCTGTGTTTGGG
AAAGATTTTAAAATGAGTGACAGTTATTTGGAACAAAGAGCTAATAATCAATCCACTGCAAATTAAAGAAACATGCAGATGAAAGTTTTG
ACACATTAAAATACTTCTACAGTGACAAAGAAAAATCAAGAACAAAGCTTTTTGATATGTGCAACAAATTTAGAGGAAGTAAAAAGATAA
ATGTGATGATTGGTCAAGAAATTATCCAGTTATTTACAAGGCCACTGATATTTTAAACGTCCAAAAGTTTGTTTAAATGGGCTGTTACCG
CTGAGAATGATGAGGATGAGAATGATGGTTGAAGGTTACATTTTAGGAAATGAAGAAACTTAGAAAATTAATATAAAGACAGTGATGAAT
ACAAAGAAGATTTTTATAACAATGTGTAAAATTTTTGGCCAGGGAAAGGAATATTGAAGTTAGATACAATTACTTACCTTTGAGGGAAAT
AATTGTTGGTAATGAGATGTGATGTTTCTCCTGCCACCTGGAAACAAAGCATTGAAGTCTGCAGTTGAAAAGCCCAACGTCTGTGAGATC
CAGGAAACCATGCTTGCAAACCACTGGTAAAAAAAAAAAAAAAAAAAAAAAAAAGCCACAGTGACTTGCTTATTGGTCATTGCTAGTATT
ATCGACTCAGAACCTCTTTACTAATGGCTAGTAAATCATAATTGAGAAATTCTGAATTTTGACAAGGTCTCTGCTGTTGAAATGGTAAAT
TTATTATTTTTTTTGTCATGATAAATTCTGGTTCAAGGTATGCTATCCATGAAATAATTTCTGACCAAAACTAAATTGATGCAATTTGAT
TATCCATCTTAGCCTACAGATGGCATCTGGTAACTTTTGACTGTTTTAAAAAATAAATCCACTATCAGAGTAGATTTGATGTTGGCTTCA
GAAACATTTAGAAAAACAAAAGTTCAAAAATGTTTTCAGGAGGTGATAAGTTGAATAACTCTACAATGTTAGTTCTTTGAGGGGGACAAA
AAATTTAAAATCTTTGAAAGGTCTTATTTTACAGCCATATCTAAATTATCTTAAGAAAATTTTTAACAAAGGGAATGAAATATATATCAT
GATTCTGTTTTTCCAAAAGTAACCTGAATATAGCAATGAAGTTCAGTTTTGTTATTGGTAGTTTGGGCAGAGTCTCTTTTTGCAGCACCT
GTTGTCTACCATAATTACAGAGGACATTTCCATGTTCTAGCCAAGTATACTATTAGAATAAAAAAACTTAACATTGAGTTGCTTCAACAG
CATGAAACTGAGTCCAAAAGACCAAATGAACAAACACATTAATCTCTGATTATTTATTTTAAATAGAATATTTAATTGTGTAAGATCTAA
TAGTATCATTATACTTAAGCAATCATATTCCTGATGATCTATGGGAAATAACTATTATTTAATTAATATTGAAACCAGGTTTTAAGATGT
GTTAGCCAGTCCTGTTACTAGTAAATCTCTTTATTTGGAGAGAAATTTTAGATTGTTTTGTTCTCCTTATTAGAAGGATTGTAGAAAGAA
AAAAATGACTAATTGGAGAAAAATTGGGGATATATCATATTTCACTGAATTCAAAATGTCTTCAGTTGTAAATCTTACCATTATTTTACG
TACCTCTAAGAAATAAAAGTGCTTCTAATTAAAATATGATGTCATTAATTATGAAATACTTCTTGATAACAGAAGTTTTAAAATAGCCAT
CTTAGAATCAGTGAAATATGGTAATGTATTATTTTCCTCCTTTGAGTTAGGTCTTGTGCTTTTTTTTCCTGGCCACTAAATTTCACAATT
TCCAAAAAGCAAAATAAACATATTCTGAATATTTTTGCTGTGAAACACTTGACAGCAGAGCTTTCCACCATGAAAAGAAGCTTCATGAGT
CACACATTACATCTTTGGGTTGATTGAATGCCACTGAAACATTCTAGTAGCCTGGAGAAGTTGACCTACCTGTGGAGATGCCTGCCATTA
AATGGCATCCTGATGGCTTAATACACATCACTCTTCTGTGAAGGGTTTTAATTTTCAACACAGCTTACTCTGTAGCATCATGTTTACATT
GTATGTATAAAGATTATACAAAGGTGCAATTGTGTATTTCTTCCTTAAAATGTATCAGTATAGGATTTAGAATCTCCATGTTGAAACTCT
AAATGCATAGAAATAAAAATAATAAAAAATTTTTCATTTTGGCTTTTCAGCCTAGTATTAAAACTGATAAAAGCAAAGCCATGCACAAAA
CTACCTCCCTAGAGAAAGGCTAGTCCCTTTTCTTCCCCATTCATTTCATTATGAACATAGTAGAAAACAGCATATTCTTATCAAATTTGA
TGAAAAGCGCCAACACGTTTGAACTGAAATACGACTTGTCATGTGAACTGTACCGAATGTCTACGTATTCCACTTTTCCTGCTGGGGTTC
CTGTCTCAGAAAGGAGTCTTGCTCGTGCTGGTTTCTATTACACTGGTGTGAATGACAAGGTCAAATGCTTCTGTTGTGGCCTGATGCTGG
ATAACTGGAAAAGAGGAGACAGTCCTACTGAAAAGCATAAAAAGTTGTATCCTAGCTGCAGATTCGTTCAGAGTCTAAATTCCGTTAACA
ACTTGGAAGCTACCTCTCAGCCTACTTTTCCTTCTTCAGTAACAAATTCCACACACTCATTACTTCCGGGTACAGAAAACAGTGGATATT
TCCGTGGCTCTTATTCAAACTCTCCATCAAATCCTGTAAACTCCAGAGCAAATCAAGATTTTTCTGCCTTGATGAGAAGTTCCTACCACT
GTGCAATGAATAACGAAAATGCCAGATTACTTACTTTTCAGACATGGCCATTGACTTTTCTGTCGCCAACAGATCTGGCAAAAGCAGGCT
TTTACTACATAGGACCTGGAGACAGAGTGGCTTGCTTTGCCTGTGGTGGAAAATTGAGCAATTGGGAACCGAAGGATAATGCTATGTCAG
AACACCTGAGACATTTTCCCAAATGCCCATTTATAGAAAATCAGCTTCAAGACACTTCAAGATACACAGTTTCTAATCTGAGCATGCAGA
CACATGCAGCCCGCTTTAAAACATTCTTTAACTGGCCCTCTAGTGTTCTAGTTAATCCTGAGCAGCTTGCAAGTGCGGGTTTTTATTATG
TGGGTAACAGTGATGATGTCAAATGCTTTTGCTGTGATGGTGGACTCAGGTGTTGGGAATCTGGAGATGATCCATGGGTTCAACATGCCA
AGTGGTTTCCAAGGTGTGAGTACTTGATAAGAATTAAAGGACAGGAGTTCATCCGTCAAGTTCAAGCCAGTTACCCTCATCTACTTGAAC
AGCTGCTATCCACATCAGACAGCCCAGGAGATGAAAATGCAGAGTCATCAATTATCCATTTTGAACCTGGAGAAGACCATTCAGAAGATG
CAATCATGATGAATACTCCTGTGATTAATGCTGCCGTGGAAATGGGCTTTAGTAGAAGCCTGGTAAAACAGACAGTTCAGAGAAAAATCC
TAGCAACTGGAGAGAATTATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAA
GAGCAACTGAGGAAAAAGAATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTT
GCCGGGCAACTGGACATCCTTTTGTTCAATATCAGTGGTTCAAAATGAATAAAGAGATTCCAAATGGAAATACATCAGAGCTTATTTTTA
ATGCAGTGCATGTAAAAGATGCAGGCTTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTGGATG
TTTGCGACATCCCAGAGAGCTTCCAGAGAAGTGTTGATGGCGTCTCTGAATCCAAGTTGCAAATCTGTGTTGAACCAACTTCCCAAAAGC
TGATGCCAGGCAGCACATTGGTTTTACAGTGTGTTGCTGTTGGAAGCCCTATTCCTCACTACCAGTGGTTCAAAAATGAATTACCATTAA
CACATGAGACCAAAAAGCTATACATGGTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGAGACA
GTCAAGATAGCAAGAAGGTAGAAATCATCATAGGAAGAACAGATGAGGCAGTGGAGTGCACTGAAGATGAATTAAATAATCTTGGTCATC
CTGATAATAAAGAGCAAACAACTGACCAGCCTTTGGCGAAGGACAAGGTTGCCCTTTTGATAGGAAATATGAATTACCGGGAGCACCCCA
AGCTCAAAGCTCCTTTGGTGGATGTGTACGAATTGACTAACTTACTGAGACAGCTGGACTTCAAAGTGGTTTCACTGTTGGATCTTACTG
AATATGAGATGCGTAATGCTGTGGATGAGTTTTTACTCCTTTTAGACAAGGGAGTATATGGGTTATTATATTATGCAGGACATGGTTATG
AAAATTTTGGGAACAGCTTCATGGTCCCCGTTGATGCTCCAAATCCATATAGGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAAT
TGATGCAAGAAAAAGAAACTGGACTTAATGTGTTCTTATTGGATATGTGTAGGAAAAGAAATGACTACGATGATACCATTCCAATCTTGG
ATGCACTAAAAGTCACCGCCAATATTGTGTTTGGATATGCCACGTGTCAAGGAGCAGAAGCTTTTGAAATCCAGCATTCTGGATTGGCAA
ATGGAATCTTTATGAAATTTTTAAAAGACAGATTATTAGAAGATAAGAAAATCACTGTGTTACTGGATGAAGTTGCAGAAGATATGGGTA
AGTGTCACCTTACCAAAGGCAAACAGGCTCTAGAGATTCGAAGTAGTTTATCTGAGAAGAGAGCACTTACTGATCCAATACAGGGAACAG
AATATTCTGCTGAATCTCTTGTGCGGAATCTACAGTGGGCCAAGGCTCATGAACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTG
TTCAGATTCAATTAGGATTTGCAGCTGAGTTTTCCAATGTCATGATCATCTATACAAGTATAGTTTACAAACCACCGGAGATAATAATGT
GTGATGCCTACGTTACTGATTTTCCACTTGATCTAGATATTGATCCAAAAGATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTACT
TGGTATCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTT
TATCATATCAGTACTCAGGATTGGAAGATACTGTAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGC
ATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAG
GGCATTATCACTCATTGCAAGACCCATTCCATGGTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTC
ATTGCAGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTTCATGTCATTTTAGTAGAAGTAATGTGCCAGTAGAGACAA
CTGATGAAATACCATTTAGTTTCTCTGACAGGCTCAGAATTTCTGAAAAATGACCTCCTTGTTTTTGAAAGTTAGCATAATTTTAGATGC
CTGTGAAATAGTACTGCACTTACATAAAGTGAGACATTGTGAAAAGGCAAATTTGTATATGTAGAGAAAGAATAGTAGTAACTGTTTCAT
AGCAAACTTCAGGACTTTGAGATGTTGAAATTACATTATTTAATTACAGACTTCCTCTTTCTAAGATTTTGTGAATTGGTTGAATAGTTC
TATACAAATGAAGTATGGAGGTGTGTATGTTTATATGTATATAACAAAATATTTTCATTGTGACCACTCTGAAGTAAGAGCAATGGGAAT
GGCATTATTGTAGAATAAGTCATTGTATTTTTAACACCAGAAAGAACCTTGCCGATCACCAGGCATAACCTAATTTTATCCATGGAAGAA
ACACAGAAAGGCATCTAAGTTAGAGCTGGCACCAGAACTGAGACCTCCAGAAATCTATTCCAGTATTTTTTCCACTACACAACTGCCTTC
CTGACAGGTTCTGAGATAAGTGTTATGTTTGTAGATAGAGTGAAATATATTTATATATATATAAATATATACAGATACATATCTGTGTAT
TATCTCAAGGAATGTACAAACTTTAGTTTTTGATTATAAGGACTTCACTGCAAGTTTTAGTTAAGAGGTTTGTATATAAATCTGTTATAG
AACAGGCTGAAATTTCTTGTTCATAAGATTATGAAACCACATGAGAAGTGATAAAATGTTTGTTAAAGCTAGATAGAGGTTAAGAATCAA
GATATAATGGATAATTTTCATAGCTGCCTATCAGAATTTCCCAAATATTTAGCATCTTCCTTGATAATATGTATTTTCTTCTTGAATTTC
ACTGGCCTAATGAGATAATACTCTTATCTTTGGCTCTACCTAAAAGTTGGTTAAAAATGCAATTGGCATTAACAAGGAAAAATACTGAAT
TAGTAATTTTAAAAGTCTCACAAAGAAAATCCCAGGCCTAGATGGCTGCATTGTTGAATTCTGCCAAACATTAAAATTAGCACTAATTTT
TTGCACACTGTTTCTAAAAGTAGGAGAGGAAAGAACACTTCCCAACTTACTCTAGGTCAGTATTACCCTGATACTAGACTAGACATCACA
AGAAAACTATAAGCCAATATTCCTTATTAATACAAACACAAAAATCATTAACAAAAATATTAGCAAACTGAATCCAGCAACCTATAAAAA
GGATTCTATATCATGACCAAGTGGAATTTATCCCAGGAATTCAAGGTTGGTTCAACATCTAAAAATCAAATAAGCTAATATACAGTCAGT
TCTCATTATTCACAGTAATTATGTTCTACAGAATATTCTCCCATAAACACTGAATTAAATATGGAACAACTGCTTTTAGGAGAAAGTGTA
TTTGTGTATATGTGTGTATACATATGTTTATCTCACACACATTATGAGCTTGAATTCTTAATTCATCCTAGCAAATTCTACCTTATTTTA
CAGAAGTGAAAGTGAGGTATCAGAAGTGTTAAGTGACATGCCTGAGGCACCCCCCTAACAGGTGTCAGAGCTGAAATTCAAACCCCATCC
AGCTGGCCCCGGAGCCAGAGCTTCTTGTACTACACAGAATTGCCCCTGCCATTTCCACCCTCCAGTCATTTCTCTATGAGACTGAAGCAG
GAAGGCAGAGCATCATCTTGTTCAGCCTCAGCTGGGAACATGTGTACTGGGTGACTCAAATTTTTCACCCATTTACACATATCCACAAAT
GACTGCAAAAGTGCCACGGATATCAATTTGAGGGTTATAAATTTTAGCAAGTTGGTAAATTCACAAATACATAACCTTGAATAATGAGGA
TCAACTGTACCATATTTAATAAAGCACAAAACCCACACAGATTGTCTTATTACAGCATTTGATAAAATCCAAAACTCTTTCATAAAAACA
CTCAACAAACTTAGGAATAAAAGGAATCTTCCTAGATATGATAAATATAACATCTATGAAAAGCCCACACCTAACATTATACTTCATGGT
GATAGACTGAAGGCTGAATGTTTTCCCCTTAAGATTGGGAAGAAGGACAAGGATGTTCACTCGGCACTACTTCTATTCAGCATTGTACTT
GAAGTTCTAGCCACAGCAGTTAGGTTAGGAATTCAAGGTTTGTTCAACATCTAAAAATCAAATAAGCTAATAAAGAAAAGAGGTTTATAC
TGCAAAAGAAGTGAAACTATATGTATTCACAGTTGATACATAGTTGTATATAGAAAATGCTAAAGAATCCATAAAAAGTAATAAATGAGT

>In-frame_BIRC3_ENST00000263464_chr11_102201973_+_MALT1_ENST00000345724_chr18_56363598_+_6452nt
GGCCAGGCGACAGGTGTCGCTTGAAAAGACTGGGCTTGTCCTTGCTGGTGCATGCGTCGTCGGCCTCTGGGCAGCAGGTTTACAAAGGAG
GAAAACGACTTCTTCTAGATTTTTTTTTCAGTTTCTTCTATAAATCAAAACATCTCAAAATGGAGACCTAAAATCCTTAAAGGGACTTAG
TCTAATCTCGGGAGGTAGTTTTGTGCATGGGTAAACAAATTAAGTATTAACTGGTGTTTTACTATCCAAAGAATGCTAATTTTATAAACA
TGATCGAGTTATATAAGGTATACCATAATGAGTTTGATTTTGAATTTGATTTGTGGAAATAAAGGAAAAGTGATTCTAGCTGGGGCATAT
TGTTAAAGCATTTTTTTCAGAGTTGGCCAGGCAGTCTCCTACTGGCACATTCTCCCATTATGTAGAATAGAAATAGTACCTGTGTTTGGG
AAAGATTTTAAAATGAGTGACAGTTATTTGGAACAAAGAGCTAATAATCAATCCACTGCAAATTAAAGAAACATGCAGATGAAAGTTTTG
ACACATTAAAATACTTCTACAGTGACAAAGAAAAATCAAGAACAAAGCTTTTTGATATGTGCAACAAATTTAGAGGAAGTAAAAAGATAA
ATGTGATGATTGGTCAAGAAATTATCCAGTTATTTACAAGGCCACTGATATTTTAAACGTCCAAAAGTTTGTTTAAATGGGCTGTTACCG
CTGAGAATGATGAGGATGAGAATGATGGTTGAAGGTTACATTTTAGGAAATGAAGAAACTTAGAAAATTAATATAAAGACAGTGATGAAT
ACAAAGAAGATTTTTATAACAATGTGTAAAATTTTTGGCCAGGGAAAGGAATATTGAAGTTAGATACAATTACTTACCTTTGAGGGAAAT
AATTGTTGGTAATGAGATGTGATGTTTCTCCTGCCACCTGGAAACAAAGCATTGAAGTCTGCAGTTGAAAAGCCCAACGTCTGTGAGATC
CAGGAAACCATGCTTGCAAACCACTGGTAAAAAAAAAAAAAAAAAAAAAAAAAAGCCACAGTGACTTGCTTATTGGTCATTGCTAGTATT
ATCGACTCAGAACCTCTTTACTAATGGCTAGTAAATCATAATTGAGAAATTCTGAATTTTGACAAGGTCTCTGCTGTTGAAATGGTAAAT
TTATTATTTTTTTTGTCATGATAAATTCTGGTTCAAGGTATGCTATCCATGAAATAATTTCTGACCAAAACTAAATTGATGCAATTTGAT
TATCCATCTTAGCCTACAGATGGCATCTGGTAACTTTTGACTGTTTTAAAAAATAAATCCACTATCAGAGTAGATTTGATGTTGGCTTCA
GAAACATTTAGAAAAACAAAAGTTCAAAAATGTTTTCAGGAGGTGATAAGTTGAATAACTCTACAATGTTAGTTCTTTGAGGGGGACAAA
AAATTTAAAATCTTTGAAAGGTCTTATTTTACAGCCATATCTAAATTATCTTAAGAAAATTTTTAACAAAGGGAATGAAATATATATCAT
GATTCTGTTTTTCCAAAAGTAACCTGAATATAGCAATGAAGTTCAGTTTTGTTATTGGTAGTTTGGGCAGAGTCTCTTTTTGCAGCACCT
GTTGTCTACCATAATTACAGAGGACATTTCCATGTTCTAGCCAAGTATACTATTAGAATAAAAAAACTTAACATTGAGTTGCTTCAACAG
CATGAAACTGAGTCCAAAAGACCAAATGAACAAACACATTAATCTCTGATTATTTATTTTAAATAGAATATTTAATTGTGTAAGATCTAA
TAGTATCATTATACTTAAGCAATCATATTCCTGATGATCTATGGGAAATAACTATTATTTAATTAATATTGAAACCAGGTTTTAAGATGT
GTTAGCCAGTCCTGTTACTAGTAAATCTCTTTATTTGGAGAGAAATTTTAGATTGTTTTGTTCTCCTTATTAGAAGGATTGTAGAAAGAA
AAAAATGACTAATTGGAGAAAAATTGGGGATATATCATATTTCACTGAATTCAAAATGTCTTCAGTTGTAAATCTTACCATTATTTTACG
TACCTCTAAGAAATAAAAGTGCTTCTAATTAAAATATGATGTCATTAATTATGAAATACTTCTTGATAACAGAAGTTTTAAAATAGCCAT
CTTAGAATCAGTGAAATATGGTAATGTATTATTTTCCTCCTTTGAGTTAGGTCTTGTGCTTTTTTTTCCTGGCCACTAAATTTCACAATT
TCCAAAAAGCAAAATAAACATATTCTGAATATTTTTGCTGTGAAACACTTGACAGCAGAGCTTTCCACCATGAAAAGAAGCTTCATGAGT
CACACATTACATCTTTGGGTTGATTGAATGCCACTGAAACATTCTAGTAGCCTGGAGAAGTTGACCTACCTGTGGAGATGCCTGCCATTA
AATGGCATCCTGATGGCTTAATACACATCACTCTTCTGTGAAGGGTTTTAATTTTCAACACAGCTTACTCTGTAGCATCATGTTTACATT
GTATGTATAAAGATTATACAAAGGTGCAATTGTGTATTTCTTCCTTAAAATGTATCAGTATAGGATTTAGAATCTCCATGTTGAAACTCT
AAATGCATAGAAATAAAAATAATAAAAAATTTTTCATTTTGGCTTTTCAGCCTAGTATTAAAACTGATAAAAGCAAAGCCATGCACAAAA
CTACCTCCCTAGAGAAAGGCTAGTCCCTTTTCTTCCCCATTCATTTCATTATGAACATAGTAGAAAACAGCATATTCTTATCAAATTTGA
TGAAAAGCGCCAACACGTTTGAACTGAAATACGACTTGTCATGTGAACTGTACCGAATGTCTACGTATTCCACTTTTCCTGCTGGGGTTC
CTGTCTCAGAAAGGAGTCTTGCTCGTGCTGGTTTCTATTACACTGGTGTGAATGACAAGGTCAAATGCTTCTGTTGTGGCCTGATGCTGG
ATAACTGGAAAAGAGGAGACAGTCCTACTGAAAAGCATAAAAAGTTGTATCCTAGCTGCAGATTCGTTCAGAGTCTAAATTCCGTTAACA
ACTTGGAAGCTACCTCTCAGCCTACTTTTCCTTCTTCAGTAACAAATTCCACACACTCATTACTTCCGGGTACAGAAAACAGTGGATATT
TCCGTGGCTCTTATTCAAACTCTCCATCAAATCCTGTAAACTCCAGAGCAAATCAAGATTTTTCTGCCTTGATGAGAAGTTCCTACCACT
GTGCAATGAATAACGAAAATGCCAGATTACTTACTTTTCAGACATGGCCATTGACTTTTCTGTCGCCAACAGATCTGGCAAAAGCAGGCT
TTTACTACATAGGACCTGGAGACAGAGTGGCTTGCTTTGCCTGTGGTGGAAAATTGAGCAATTGGGAACCGAAGGATAATGCTATGTCAG
AACACCTGAGACATTTTCCCAAATGCCCATTTATAGAAAATCAGCTTCAAGACACTTCAAGATACACAGTTTCTAATCTGAGCATGCAGA
CACATGCAGCCCGCTTTAAAACATTCTTTAACTGGCCCTCTAGTGTTCTAGTTAATCCTGAGCAGCTTGCAAGTGCGGGTTTTTATTATG
TGGGTAACAGTGATGATGTCAAATGCTTTTGCTGTGATGGTGGACTCAGGTGTTGGGAATCTGGAGATGATCCATGGGTTCAACATGCCA
AGTGGTTTCCAAGGTGTGAGTACTTGATAAGAATTAAAGGACAGGAGTTCATCCGTCAAGTTCAAGCCAGTTACCCTCATCTACTTGAAC
AGCTGCTATCCACATCAGACAGCCCAGGAGATGAAAATGCAGAGTCATCAATTATCCATTTTGAACCTGGAGAAGACCATTCAGAAGATG
CAATCATGATGAATACTCCTGTGATTAATGCTGCCGTGGAAATGGGCTTTAGTAGAAGCCTGGTAAAACAGACAGTTCAGAGAAAAATCC
TAGCAACTGGAGAGAATTATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAA
GAGCAACTGAGGAAAAAGAATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTT
GCCGGGCAACTGGACATCCTTTTGTTCAATATCAGTGGTTCAAAATGAATAAAGAGATTCCAAATGGAAATACATCAGAGCTTATTTTTA
ATGCAGTGCATGTAAAAGATGCAGGCTTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTGGATG
TTTGCGACATCCCAGAGAGCTTCCAGAGAAGTGTTGATGGCGTCTCTGAATCCAAGTTGCAAATCTGTGTTGAACCAACTTCCCAAAAGC
TGATGCCAGGCAGCACATTGGTTTTACAGTGTGTTGCTGTTGGAAGCCCTATTCCTCACTACCAGTGGTTCAAAAATGAATTACCATTAA
CACATGAGACCAAAAAGCTATACATGGTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGAGACA
GTCAAGATAGCAAGAAGGTAGAAATCATCATAGATGAATTAAATAATCTTGGTCATCCTGATAATAAAGAGCAAACAACTGACCAGCCTT
TGGCGAAGGACAAGGTTGCCCTTTTGATAGGAAATATGAATTACCGGGAGCACCCCAAGCTCAAAGCTCCTTTGGTGGATGTGTACGAAT
TGACTAACTTACTGAGACAGCTGGACTTCAAAGTGGTTTCACTGTTGGATCTTACTGAATATGAGATGCGTAATGCTGTGGATGAGTTTT
TACTCCTTTTAGACAAGGGAGTATATGGGTTATTATATTATGCAGGACATGGTTATGAAAATTTTGGGAACAGCTTCATGGTCCCCGTTG
ATGCTCCAAATCCATATAGGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAATTGATGCAAGAAAAAGAAACTGGACTTAATGTGT
TCTTATTGGATATGTGTAGGAAAAGAAATGACTACGATGATACCATTCCAATCTTGGATGCACTAAAAGTCACCGCCAATATTGTGTTTG
GATATGCCACGTGTCAAGGAGCAGAAGCTTTTGAAATCCAGCATTCTGGATTGGCAAATGGAATCTTTATGAAATTTTTAAAAGACAGAT
TATTAGAAGATAAGAAAATCACTGTGTTACTGGATGAAGTTGCAGAAGATATGGGTAAGTGTCACCTTACCAAAGGCAAACAGGCTCTAG
AGATTCGAAGTAGTTTATCTGAGAAGAGAGCACTTACTGATCCAATACAGGGAACAGAATATTCTGCTGAATCTCTTGTGCGGAATCTAC
AGTGGGCCAAGGCTCATGAACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTGTTCAGATTCAATTAGGATTTGCAGCTGAGTTTT
CCAATGTCATGATCATCTATACAAGTATAGTTTACAAACCACCGGAGATAATAATGTGTGATGCCTACGTTACTGATTTTCCACTTGATC
TAGATATTGATCCAAAAGATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTACTTGGTATCAAAGGATCTTCCCAAGCATTGCCTCT
ATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTG
TAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAA
CTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATG
GTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAGATGCATTTATTTCAA
GTTTCGCTCACCATGCTTCATGTCATTTTAGTAGAAGTAATGTGCCAGTAGAGACAACTGATGAAATACCATTTAGTTTCTCTGACAGGC
TCAGAATTTCTGAAAAATGACCTCCTTGTTTTTGAAAGTTAGCATAATTTTAGATGCCTGTGAAATAGTACTGCACTTACATAAAGTGAG
ACATTGTGAAAAGGCAAATTTGTATATGTAGAGAAAGAATAGTAGTAACTGTTTCATAGCAAACTTCAGGACTTTGAGATGTTGAAATTA
CATTATTTAATTACAGACTTCCTCTTTCTAAGATTTTGTGAATTGGTTGAATAGTTCTATACAAATGAAGTATGGAGGTGTGTATGTTTA

>In-frame_BIRC3_ENST00000532808_chr11_102201973_+_MALT1_ENST00000348428_chr18_56363598_+_5842nt
GGGCAGCAGGTTTACAAAGGAGGAAAACGACTTCTTCTAGATTTTTTTTTCAGTTTCTTCTATAAATCAAAACTACCTCCCTAGAGAAAG
GCTAGTCCCTTTTCTTCCCCATTCATTTCATTATGAACATAGTAGAAAACAGCATATTCTTATCAAATTTGATGAAAAGCGCCAACACGT
TTGAACTGAAATACGACTTGTCATGTGAACTGTACCGAATGTCTACGTATTCCACTTTTCCTGCTGGGGTTCCTGTCTCAGAAAGGAGTC
TTGCTCGTGCTGGTTTCTATTACACTGGTGTGAATGACAAGGTCAAATGCTTCTGTTGTGGCCTGATGCTGGATAACTGGAAAAGAGGAG
ACAGTCCTACTGAAAAGCATAAAAAGTTGTATCCTAGCTGCAGATTCGTTCAGAGTCTAAATTCCGTTAACAACTTGGAAGCTACCTCTC
AGCCTACTTTTCCTTCTTCAGTAACAAATTCCACACACTCATTACTTCCGGGTACAGAAAACAGTGGATATTTCCGTGGCTCTTATTCAA
ACTCTCCATCAAATCCTGTAAACTCCAGAGCAAATCAAGATTTTTCTGCCTTGATGAGAAGTTCCTACCACTGTGCAATGAATAACGAAA
ATGCCAGATTACTTACTTTTCAGACATGGCCATTGACTTTTCTGTCGCCAACAGATCTGGCAAAAGCAGGCTTTTACTACATAGGACCTG
GAGACAGAGTGGCTTGCTTTGCCTGTGGTGGAAAATTGAGCAATTGGGAACCGAAGGATAATGCTATGTCAGAACACCTGAGACATTTTC
CCAAATGCCCATTTATAGAAAATCAGCTTCAAGACACTTCAAGATACACAGTTTCTAATCTGAGCATGCAGACACATGCAGCCCGCTTTA
AAACATTCTTTAACTGGCCCTCTAGTGTTCTAGTTAATCCTGAGCAGCTTGCAAGTGCGGGTTTTTATTATGTGGGTAACAGTGATGATG
TCAAATGCTTTTGCTGTGATGGTGGACTCAGGTGTTGGGAATCTGGAGATGATCCATGGGTTCAACATGCCAAGTGGTTTCCAAGGTGTG
AGTACTTGATAAGAATTAAAGGACAGGAGTTCATCCGTCAAGTTCAAGCCAGTTACCCTCATCTACTTGAACAGCTGCTATCCACATCAG
ACAGCCCAGGAGATGAAAATGCAGAGTCATCAATTATCCATTTTGAACCTGGAGAAGACCATTCAGAAGATGCAATCATGATGAATACTC
CTGTGATTAATGCTGCCGTGGAAATGGGCTTTAGTAGAAGCCTGGTAAAACAGACAGTTCAGAGAAAAATCCTAGCAACTGGAGAGAATT
ATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAAGAGCAACTGAGGAAAAAG
AATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTTGCCGGGCAACTGGACATC
CTTTTGTTCAATATCAGTGGTTCAAAATGAATAAAGAGATTCCAAATGGAAATACATCAGAGCTTATTTTTAATGCAGTGCATGTAAAAG
ATGCAGGCTTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTGGATGTTTGCGACATCCCAGAGA
GCTTCCAGAGAAGTGTTGATGGCGTCTCTGAATCCAAGTTGCAAATCTGTGTTGAACCAACTTCCCAAAAGCTGATGCCAGGCAGCACAT
TGGTTTTACAGTGTGTTGCTGTTGGAAGCCCTATTCCTCACTACCAGTGGTTCAAAAATGAATTACCATTAACACATGAGACCAAAAAGC
TATACATGGTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGAGACAGTCAAGATAGCAAGAAGG
TAGAAATCATCATAGGAAGAACAGATGAGGCAGTGGAGTGCACTGAAGATGAATTAAATAATCTTGGTCATCCTGATAATAAAGAGCAAA
CAACTGACCAGCCTTTGGCGAAGGACAAGGTTGCCCTTTTGATAGGAAATATGAATTACCGGGAGCACCCCAAGCTCAAAGCTCCTTTGG
TGGATGTGTACGAATTGACTAACTTACTGAGACAGCTGGACTTCAAAGTGGTTTCACTGTTGGATCTTACTGAATATGAGATGCGTAATG
CTGTGGATGAGTTTTTACTCCTTTTAGACAAGGGAGTATATGGGTTATTATATTATGCAGGACATGGTTATGAAAATTTTGGGAACAGCT
TCATGGTCCCCGTTGATGCTCCAAATCCATATAGGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAATTGATGCAAGAAAAAGAAA
CTGGACTTAATGTGTTCTTATTGGATATGTGTAGGAAAAGAAATGACTACGATGATACCATTCCAATCTTGGATGCACTAAAAGTCACCG
CCAATATTGTGTTTGGATATGCCACGTGTCAAGGAGCAGAAGCTTTTGAAATCCAGCATTCTGGATTGGCAAATGGAATCTTTATGAAAT
TTTTAAAAGACAGATTATTAGAAGATAAGAAAATCACTGTGTTACTGGATGAAGTTGCAGAAGATATGGGTAAGTGTCACCTTACCAAAG
GCAAACAGGCTCTAGAGATTCGAAGTAGTTTATCTGAGAAGAGAGCACTTACTGATCCAATACAGGGAACAGAATATTCTGCTGAATCTC
TTGTGCGGAATCTACAGTGGGCCAAGGCTCATGAACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTGTTCAGATTCAATTAGGAT
TTGCAGCTGAGTTTTCCAATGTCATGATCATCTATACAAGTATAGTTTACAAACCACCGGAGATAATAATGTGTGATGCCTACGTTACTG
ATTTTCCACTTGATCTAGATATTGATCCAAAAGATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTACTTGGTATCAAAGGATCTTC
CCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAG
GATTGGAAGATACTGTAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGA
AGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGC
AAGACCCATTCCATGGTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAG
ATGCATTTATTTCAAGTTTCGCTCACCATGCTTCATGTCATTTTAGTAGAAGTAATGTGCCAGTAGAGACAACTGATGAAATACCATTTA
GTTTCTCTGACAGGCTCAGAATTTCTGAAAAATGACCTCCTTGTTTTTGAAAGTTAGCATAATTTTAGATGCCTGTGAAATAGTACTGCA
CTTACATAAAGTGAGACATTGTGAAAAGGCAAATTTGTATATGTAGAGAAAGAATAGTAGTAACTGTTTCATAGCAAACTTCAGGACTTT
GAGATGTTGAAATTACATTATTTAATTACAGACTTCCTCTTTCTAAGATTTTGTGAATTGGTTGAATAGTTCTATACAAATGAAGTATGG
AGGTGTGTATGTTTATATGTATATAACAAAATATTTTCATTGTGACCACTCTGAAGTAAGAGCAATGGGAATGGCATTATTGTAGAATAA
GTCATTGTATTTTTAACACCAGAAAGAACCTTGCCGATCACCAGGCATAACCTAATTTTATCCATGGAAGAAACACAGAAAGGCATCTAA
GTTAGAGCTGGCACCAGAACTGAGACCTCCAGAAATCTATTCCAGTATTTTTTCCACTACACAACTGCCTTCCTGACAGGTTCTGAGATA
AGTGTTATGTTTGTAGATAGAGTGAAATATATTTATATATATATAAATATATACAGATACATATCTGTGTATTATCTCAAGGAATGTACA
AACTTTAGTTTTTGATTATAAGGACTTCACTGCAAGTTTTAGTTAAGAGGTTTGTATATAAATCTGTTATAGAACAGGCTGAAATTTCTT
GTTCATAAGATTATGAAACCACATGAGAAGTGATAAAATGTTTGTTAAAGCTAGATAGAGGTTAAGAATCAAGATATAATGGATAATTTT
CATAGCTGCCTATCAGAATTTCCCAAATATTTAGCATCTTCCTTGATAATATGTATTTTCTTCTTGAATTTCACTGGCCTAATGAGATAA
TACTCTTATCTTTGGCTCTACCTAAAAGTTGGTTAAAAATGCAATTGGCATTAACAAGGAAAAATACTGAATTAGTAATTTTAAAAGTCT
CACAAAGAAAATCCCAGGCCTAGATGGCTGCATTGTTGAATTCTGCCAAACATTAAAATTAGCACTAATTTTTTGCACACTGTTTCTAAA
AGTAGGAGAGGAAAGAACACTTCCCAACTTACTCTAGGTCAGTATTACCCTGATACTAGACTAGACATCACAAGAAAACTATAAGCCAAT
ATTCCTTATTAATACAAACACAAAAATCATTAACAAAAATATTAGCAAACTGAATCCAGCAACCTATAAAAAGGATTCTATATCATGACC
AAGTGGAATTTATCCCAGGAATTCAAGGTTGGTTCAACATCTAAAAATCAAATAAGCTAATATACAGTCAGTTCTCATTATTCACAGTAA
TTATGTTCTACAGAATATTCTCCCATAAACACTGAATTAAATATGGAACAACTGCTTTTAGGAGAAAGTGTATTTGTGTATATGTGTGTA
TACATATGTTTATCTCACACACATTATGAGCTTGAATTCTTAATTCATCCTAGCAAATTCTACCTTATTTTACAGAAGTGAAAGTGAGGT
ATCAGAAGTGTTAAGTGACATGCCTGAGGCACCCCCCTAACAGGTGTCAGAGCTGAAATTCAAACCCCATCCAGCTGGCCCCGGAGCCAG
AGCTTCTTGTACTACACAGAATTGCCCCTGCCATTTCCACCCTCCAGTCATTTCTCTATGAGACTGAAGCAGGAAGGCAGAGCATCATCT
TGTTCAGCCTCAGCTGGGAACATGTGTACTGGGTGACTCAAATTTTTCACCCATTTACACATATCCACAAATGACTGCAAAAGTGCCACG
GATATCAATTTGAGGGTTATAAATTTTAGCAAGTTGGTAAATTCACAAATACATAACCTTGAATAATGAGGATCAACTGTACCATATTTA
ATAAAGCACAAAACCCACACAGATTGTCTTATTACAGCATTTGATAAAATCCAAAACTCTTTCATAAAAACACTCAACAAACTTAGGAAT
AAAAGGAATCTTCCTAGATATGATAAATATAACATCTATGAAAAGCCCACACCTAACATTATACTTCATGGTGATAGACTGAAGGCTGAA
TGTTTTCCCCTTAAGATTGGGAAGAAGGACAAGGATGTTCACTCGGCACTACTTCTATTCAGCATTGTACTTGAAGTTCTAGCCACAGCA
GTTAGGTTAGGAATTCAAGGTTTGTTCAACATCTAAAAATCAAATAAGCTAATAAAGAAAAGAGGTTTATACTGCAAAAGAAGTGAAACT

>In-frame_BIRC3_ENST00000532808_chr11_102201973_+_MALT1_ENST00000345724_chr18_56363598_+_3824nt
GGGCAGCAGGTTTACAAAGGAGGAAAACGACTTCTTCTAGATTTTTTTTTCAGTTTCTTCTATAAATCAAAACTACCTCCCTAGAGAAAG
GCTAGTCCCTTTTCTTCCCCATTCATTTCATTATGAACATAGTAGAAAACAGCATATTCTTATCAAATTTGATGAAAAGCGCCAACACGT
TTGAACTGAAATACGACTTGTCATGTGAACTGTACCGAATGTCTACGTATTCCACTTTTCCTGCTGGGGTTCCTGTCTCAGAAAGGAGTC
TTGCTCGTGCTGGTTTCTATTACACTGGTGTGAATGACAAGGTCAAATGCTTCTGTTGTGGCCTGATGCTGGATAACTGGAAAAGAGGAG
ACAGTCCTACTGAAAAGCATAAAAAGTTGTATCCTAGCTGCAGATTCGTTCAGAGTCTAAATTCCGTTAACAACTTGGAAGCTACCTCTC
AGCCTACTTTTCCTTCTTCAGTAACAAATTCCACACACTCATTACTTCCGGGTACAGAAAACAGTGGATATTTCCGTGGCTCTTATTCAA
ACTCTCCATCAAATCCTGTAAACTCCAGAGCAAATCAAGATTTTTCTGCCTTGATGAGAAGTTCCTACCACTGTGCAATGAATAACGAAA
ATGCCAGATTACTTACTTTTCAGACATGGCCATTGACTTTTCTGTCGCCAACAGATCTGGCAAAAGCAGGCTTTTACTACATAGGACCTG
GAGACAGAGTGGCTTGCTTTGCCTGTGGTGGAAAATTGAGCAATTGGGAACCGAAGGATAATGCTATGTCAGAACACCTGAGACATTTTC
CCAAATGCCCATTTATAGAAAATCAGCTTCAAGACACTTCAAGATACACAGTTTCTAATCTGAGCATGCAGACACATGCAGCCCGCTTTA
AAACATTCTTTAACTGGCCCTCTAGTGTTCTAGTTAATCCTGAGCAGCTTGCAAGTGCGGGTTTTTATTATGTGGGTAACAGTGATGATG
TCAAATGCTTTTGCTGTGATGGTGGACTCAGGTGTTGGGAATCTGGAGATGATCCATGGGTTCAACATGCCAAGTGGTTTCCAAGGTGTG
AGTACTTGATAAGAATTAAAGGACAGGAGTTCATCCGTCAAGTTCAAGCCAGTTACCCTCATCTACTTGAACAGCTGCTATCCACATCAG
ACAGCCCAGGAGATGAAAATGCAGAGTCATCAATTATCCATTTTGAACCTGGAGAAGACCATTCAGAAGATGCAATCATGATGAATACTC
CTGTGATTAATGCTGCCGTGGAAATGGGCTTTAGTAGAAGCCTGGTAAAACAGACAGTTCAGAGAAAAATCCTAGCAACTGGAGAGAATT
ATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAAGAGCAACTGAGGAAAAAG
AATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTTGCCGGGCAACTGGACATC
CTTTTGTTCAATATCAGTGGTTCAAAATGAATAAAGAGATTCCAAATGGAAATACATCAGAGCTTATTTTTAATGCAGTGCATGTAAAAG
ATGCAGGCTTTTATGTCTGTCGAGTTAATAACAATTTCACCTTTGAATTCAGCCAGTGGTCACAGCTGGATGTTTGCGACATCCCAGAGA
GCTTCCAGAGAAGTGTTGATGGCGTCTCTGAATCCAAGTTGCAAATCTGTGTTGAACCAACTTCCCAAAAGCTGATGCCAGGCAGCACAT
TGGTTTTACAGTGTGTTGCTGTTGGAAGCCCTATTCCTCACTACCAGTGGTTCAAAAATGAATTACCATTAACACATGAGACCAAAAAGC
TATACATGGTGCCTTATGTGGATTTGGAACACCAAGGAACCTACTGGTGTCATGTATATAATGATCGAGACAGTCAAGATAGCAAGAAGG
TAGAAATCATCATAGATGAATTAAATAATCTTGGTCATCCTGATAATAAAGAGCAAACAACTGACCAGCCTTTGGCGAAGGACAAGGTTG
CCCTTTTGATAGGAAATATGAATTACCGGGAGCACCCCAAGCTCAAAGCTCCTTTGGTGGATGTGTACGAATTGACTAACTTACTGAGAC
AGCTGGACTTCAAAGTGGTTTCACTGTTGGATCTTACTGAATATGAGATGCGTAATGCTGTGGATGAGTTTTTACTCCTTTTAGACAAGG
GAGTATATGGGTTATTATATTATGCAGGACATGGTTATGAAAATTTTGGGAACAGCTTCATGGTCCCCGTTGATGCTCCAAATCCATATA
GGTCTGAAAATTGTCTGTGTGTACAAAATATACTGAAATTGATGCAAGAAAAAGAAACTGGACTTAATGTGTTCTTATTGGATATGTGTA
GGAAAAGAAATGACTACGATGATACCATTCCAATCTTGGATGCACTAAAAGTCACCGCCAATATTGTGTTTGGATATGCCACGTGTCAAG
GAGCAGAAGCTTTTGAAATCCAGCATTCTGGATTGGCAAATGGAATCTTTATGAAATTTTTAAAAGACAGATTATTAGAAGATAAGAAAA
TCACTGTGTTACTGGATGAAGTTGCAGAAGATATGGGTAAGTGTCACCTTACCAAAGGCAAACAGGCTCTAGAGATTCGAAGTAGTTTAT
CTGAGAAGAGAGCACTTACTGATCCAATACAGGGAACAGAATATTCTGCTGAATCTCTTGTGCGGAATCTACAGTGGGCCAAGGCTCATG
AACTTCCAGAAAGTATGTGTCTTAAGTTTGACTGTGGTGTTCAGATTCAATTAGGATTTGCAGCTGAGTTTTCCAATGTCATGATCATCT
ATACAAGTATAGTTTACAAACCACCGGAGATAATAATGTGTGATGCCTACGTTACTGATTTTCCACTTGATCTAGATATTGATCCAAAAG
ATGCAAATAAAGGCACACCTGAAGAAACTGGCAGCTACTTGGTATCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCAC
TGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTAGAGGACAAGCAGGAAG
TGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATG
GTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATGGTGTTTACCATTCACATC
CTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTT
CATGTCATTTTAGTAGAAGTAATGTGCCAGTAGAGACAACTGATGAAATACCATTTAGTTTCTCTGACAGGCTCAGAATTTCTGAAAAAT
GACCTCCTTGTTTTTGAAAGTTAGCATAATTTTAGATGCCTGTGAAATAGTACTGCACTTACATAAAGTGAGACATTGTGAAAAGGCAAA
TTTGTATATGTAGAGAAAGAATAGTAGTAACTGTTTCATAGCAAACTTCAGGACTTTGAGATGTTGAAATTACATTATTTAATTACAGAC
TTCCTCTTTCTAAGATTTTGTGAATTGGTTGAATAGTTCTATACAAATGAAGTATGGAGGTGTGTATGTTTATATGTATATAACAAAATA


Top

FusionGenePPI for BIRC3_MALT1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
BIRC3HTRA2, CASP9, RIPK2, DIABLO, TRAF2, TRAF1, CASP3, CASP7, BCL10, BIRC3, RAF1, TNFRSF1A, UBE2D2, RIPK1, XAF1, UBE2N, BIRC5, UBE2L3, UBE2D1, UBE2D3, UBE2I, UBE2Q2, TRAF3, TRAF6, MAVS, RIPK3, RIPK4, UBXN1, USP19, TRIM32, NOD2, COMMD1, UBC, IKBKG, CASP1, BIRC2, XIAP, E2F1, GSK3B, SEPT4, UBE2V1, IKBKE, TANK, TAB1, RNF31, RBCK1, UBA1, UBR4, WDR1, WDR61, DCAF7, WDR82, USP15, USP7, USP9X, OTUB1, DZIP3, CD40LG, SNX7, SUMO1, RCHY1, CYFIP2, TNFAIP3, EGFR, PACS2, IRF1, SPHK1, MBTPS1, HAX1, CASP8, CASP10, IKBKB, NFKB1, REL, IRF5, EGLN3, LIMA1, TLR3, PELI1, GLMN, YOD1MALT1BCL10, UBE2G2, TRAF6, TRAF2, NFKBIA, CSNK1A1, IKBKG, COPS5, GPS1, CAMK2G, MALT1, RELB, DIABLO, CARD11, USP2, TAB2, MAP3K7, HECTD3, SQSTM1, PRKCQ, DAB2, USP9X, KDM1A, CARM1, PRMT6, SUV39H1, STUB1, RNF31, TNFAIP3, UBE2V2, UBE2N, XPO1, RBCK1, PRKCD, TRIB1, IKBKB, CARD14


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for BIRC3_MALT1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for BIRC3_MALT1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneBIRC3C0005695Bladder Neoplasm1CTD_human
HgeneBIRC3C0015695Fatty Liver1CTD_human
HgeneBIRC3C0019693HIV Infections1CTD_human
HgeneBIRC3C0023418leukemia1CTD_human
HgeneBIRC3C0023893Liver Cirrhosis, Experimental1CTD_human
TgeneMALT1C0079744Diffuse Large B-Cell Lymphoma1CTD_human
TgeneMALT1C3809583IMMUNODEFICIENCY 121ORPHANET;UNIPROT