FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 3787

FusionGeneSummary for BAD_STX5

check button Fusion gene summary
Fusion gene informationFusion gene name: BAD_STX5
Fusion gene ID: 3787
HgeneTgene
Gene symbol

BAD

STX5

Gene ID

572

6811

Gene nameBCL2 associated agonist of cell deathsyntaxin 5
SynonymsBBC2|BCL2L8SED5|STX5A
Cytomap

11q13.1

11q12.3

Type of geneprotein-codingprotein-coding
Descriptionbcl2-associated agonist of cell deathBCL-X/BCL-2 binding proteinBCL2-antagonist of cell death proteinBCL2-binding component 6BCL2-binding proteinbcl-2-binding component 6bcl-2-like protein 8bcl-XL/Bcl-2-associated death promoterbcl2 antagonist of syntaxin-5syntaxin 5A
Modification date2018052320180523
UniProtAcc

Q92934

Q13190

Ensembl transtripts involved in fusion geneENST00000394532, ENST00000309032, 
ENST00000544785, ENST00000394531, 
ENST00000377897, ENST00000294179, 
ENST00000394690, ENST00000541317, 
Fusion gene scores* DoF score4 X 3 X 4=485 X 1 X 6=30
# samples 46
** MAII scorelog2(4/48*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(6/30*10)=1
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: BAD [Title/Abstract] AND STX5 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneBAD

GO:0006915

apoptotic process

19667065

HgeneBAD

GO:0043065

positive regulation of apoptotic process

9388232

HgeneBAD

GO:0043280

positive regulation of cysteine-type endopeptidase activity involved in apoptotic process

18402937

HgeneBAD

GO:0045862

positive regulation of proteolysis

18387192

HgeneBAD

GO:0046931

pore complex assembly

19667065|21081150

HgeneBAD

GO:0071316

cellular response to nicotine

18676776

HgeneBAD

GO:0097202

activation of cysteine-type endopeptidase activity

18387192

TgeneSTX5

GO:0042147

retrograde transport, endosome to Golgi

15215310

TgeneSTX5

GO:0090166

Golgi disassembly

16081076

TgeneSTX5

GO:1903358

regulation of Golgi organization

16081076


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDLUADTCGA-53-7813-01ABADchr11

64039085

-STX5chr11

62575100

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000394532ENST00000377897BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000394532ENST00000294179BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000394532ENST00000394690BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000394532ENST00000541317BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000309032ENST00000377897BADchr11

64039085

-STX5chr11

62575100

-
In-frameENST00000309032ENST00000294179BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000309032ENST00000394690BADchr11

64039085

-STX5chr11

62575100

-
Frame-shitENST00000309032ENST00000541317BADchr11

64039085

-STX5chr11

62575100

-
intron-3CDSENST00000544785ENST00000377897BADchr11

64039085

-STX5chr11

62575100

-
intron-3CDSENST00000544785ENST00000294179BADchr11

64039085

-STX5chr11

62575100

-
intron-3CDSENST00000544785ENST00000394690BADchr11

64039085

-STX5chr11

62575100

-
intron-3CDSENST00000544785ENST00000541317BADchr11

64039085

-STX5chr11

62575100

-
3UTR-3CDSENST00000394531ENST00000377897BADchr11

64039085

-STX5chr11

62575100

-
3UTR-3CDSENST00000394531ENST00000294179BADchr11

64039085

-STX5chr11

62575100

-
3UTR-3CDSENST00000394531ENST00000394690BADchr11

64039085

-STX5chr11

62575100

-
3UTR-3CDSENST00000394531ENST00000541317BADchr11

64039085

-STX5chr11

62575100

-

Top

FusionProtFeatures for BAD_STX5


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
BAD

Q92934

STX5

Q13190

Promotes cell death. Successfully competes for thebinding to Bcl-X(L), Bcl-2 and Bcl-W, thereby affecting the levelof heterodimerization of these proteins with BAX. Can reverse thedeath repressor activity of Bcl-X(L), but not that of Bcl-2 (Bysimilarity). Appears to act as a link between growth factorreceptor signaling and the apoptotic pathways. {ECO:0000250}. Mediates endoplasmic reticulum to Golgi transport.Together with p115/USO1 and GM130/GOLGA2, involved in vesicletethering and fusion at the cis-Golgi membrane to maintain thestacked and inter-connected structure of the Golgi apparatus.{ECO:0000250|UniProtKB:Q08851}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for BAD_STX5


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_BAD_ENST00000309032_chr11_64039085_-_STX5_ENST00000294179_chr11_62575100_-_53aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_BAD_ENST00000309032_chr11_64039085_-_STX5_ENST00000294179_chr11_62575100_-_160nt
GATCGACGAGAACGTGCTAGGAGCCCAGCTGGACGTTGAGGCCGCCCATTCAGAGATCCTCAAGTACTTCCAGTCTGTCACCTCCAACCG


* Fusion transcript sequences (Full-length transcript).
>In-frame_BAD_ENST00000309032_chr11_64039085_-_STX5_ENST00000294179_chr11_62575100_-_1157nt
CGGCAGGCCCGGGTCAGGGGCCTCGAGATCGGGCTTGGGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACT
CCAGCTCTGCAGAGAGGGGCCTGGGCCCCAGCCCCGCAGGGGACGGGCCCTCAGGCTCCGGCAAGCATCATCGCCAGGCCCCAGGCCTCC
TGTGGGACGCCAGTCACCAGCAGGAGCAGCCAACCAGCAGCAGCCATCATGGAGGCGCTGGGGCTGTGGAGATCCGGAGTCGCCACAGCT
CCTACCCCGCGGGGACGGAGGACGACGAAGGGATGGGGGAGGAGCCCAGCCCCTTTCGGGGCCGCTCGCGCTCGGCGCCCCCCAACCTCT
GGGCAGCACAGCGCTATGGCCGCGAGCTCCGGAGGATGAGTGACGAGTTTGTGGACTCCTTTAAGGATCGACGAGAACGTGCTAGGAGCC
CAGCTGGACGTTGAGGCCGCCCATTCAGAGATCCTCAAGTACTTCCAGTCTGTCACCTCCAACCGGTGGCTCATGGTCAAAATCTTCCTC
ATCCTCATTGTCTTCTTCATCATCTTTGTGGTCTTCCTTGCTTGAACCCTCTCTACTCTGAGGCACTCTGTTGGGGTTTGGGACCCTCCT
GGGAAGGCAAGTGGCCAGTGCTGCCACTGAGCCTGTGCAGGGTACTTGGGAGAAAGGCCCTGTTTCCCTGGAACTGCTAAGAATGACCAC
TGCCCCTGATCCCCCACCCCTTGCCTCTGGCCACCCTGTCCTCCCCCCACCACCCTCAGGCCTATGAAACACACAGGGTTCTAGATTTGA
ACTCTGCTGTGAAGTGACTGGAAGGGAGCAGAGGCCAGCTGGGGGCCAGTGGGGGAGGTTGTTTCCACTAGGAGATTTTTATAAACCCTC
TCCAGCCTCTCCCAAAGGAAGCGTTGGCAGCAAAGGGAGATGATGCCCTTACCCACCTTCCTGTGAGTGAAGAGAGGAAGCAGCCCCAGG
GACCAATTTTCCCAATTGACCTCTTTCTTCCTCTTTCACCATGTGAGGCAGGGAGCCCTGAGCCCTTCAGCTGCCTGCACAACCCCTGAC


Top

FusionGenePPI for BAD_STX5


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
BADBCL2A1, MCL1, SFN, EWSR1, BCL2L2, BCL2L1, BCL2, YWHAQ, PRKCI, PIM2, YWHAE, YWHAB, YWHAH, S100A10, AKT1, PRKACA, RPS6KA1, RPS6KA5, YWHAZ, YWHAG, SUMO2, PPP1CA, BAX, SNCA, VCP, RAF1, PAK1, BRAF, ARAF, CREB3L3, CDKN1A, PRDX2, KEAP1, STEAP3, GIMAP5, PRKD1, PRKCE, NDUFA12, LIMK1, SORT1, SYNCRIP, APTX, CBY1STX5NAPA, SEC22B, SNAP23, VAPB, APLP1, COPS6, IMMT, LRIF1, BAG6, HAP1, TP53, GOSR1, GOSR2, STX17, USO1, BET1L, YKT6, SEC22A, BET1, VTI1B, SNAP25, NSFL1C, NSF, LNX1, ASNA1, VCPIP1, TMED9, MAGEA6, STX4, TACC1, NAPB, CCDC155, STX6, SNAP29, STX7, USE1, SRPRB, STX12, RBM26, HMMR, C17orf70, TNPO3, SCFD1, CLEC12A, STX3, TMEM171, STX18, DTNBP1, CHST9, LPAR1, NUP160, LMNA, TCTN2, EVC2, TMEM17, TMEM216, CDH1, FAM196A, VAMP4, C15orf27, HAUS1, CSGALNACT2, IL4R, CCDC107, ACADS, CNGA3, ARFGAP1, TRPM8, DKK3, MANSC1, IL20RA, PDHA1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for BAD_STX5


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for BAD_STX5


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneBADC0033578Prostatic Neoplasms2CTD_human
HgeneBADC0007787Transient Ischemic Attack1CTD_human
HgeneBADC0023418leukemia1CTD_human