FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 34521

FusionGeneSummary for SLC44A5_PLEKHA7

check button Fusion gene summary
Fusion gene informationFusion gene name: SLC44A5_PLEKHA7
Fusion gene ID: 34521
HgeneTgene
Gene symbol

SLC44A5

PLEKHA7

Gene ID

204962

144100

Gene namesolute carrier family 44 member 5pleckstrin homology domain containing A7
SynonymsCTL5-
Cytomap

1p31.1

11p15.2-p15.1

Type of geneprotein-codingprotein-coding
Descriptioncholine transporter-like protein 5pleckstrin homology domain-containing family A member 7PH domain-containing family A member 7pleckstrin homology domain containing, family A member 2pleckstrin homology domain containing, family A member 7pleckstrin homology domain-containing family A
Modification date2018051920180522
UniProtAcc

Q8NCS7

Q6IQ23

Ensembl transtripts involved in fusion geneENST00000370859, ENST00000370855, 
ENST00000535611, ENST00000469525, 
ENST00000531066, ENST00000355661, 
ENST00000448080, ENST00000532079, 
ENST00000332954, 
Fusion gene scores* DoF score4 X 4 X 3=486 X 5 X 3=90
# samples 46
** MAII scorelog2(4/48*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(6/90*10)=-0.584962500721156
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: SLC44A5 [Title/Abstract] AND PLEKHA7 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DB455667SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000370859ENST00000531066SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
In-frameENST00000370859ENST00000355661SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
In-frameENST00000370859ENST00000448080SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5CDS-intronENST00000370859ENST00000532079SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5CDS-5UTRENST00000370859ENST00000332954SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
In-frameENST00000370855ENST00000531066SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
In-frameENST00000370855ENST00000355661SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
In-frameENST00000370855ENST00000448080SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5CDS-intronENST00000370855ENST00000532079SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5CDS-5UTRENST00000370855ENST00000332954SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
intron-3CDSENST00000535611ENST00000531066SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
intron-3CDSENST00000535611ENST00000355661SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
intron-3CDSENST00000535611ENST00000448080SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
intron-intronENST00000535611ENST00000532079SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
intron-5UTRENST00000535611ENST00000332954SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5UTR-3CDSENST00000469525ENST00000531066SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5UTR-3CDSENST00000469525ENST00000355661SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5UTR-3CDSENST00000469525ENST00000448080SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5UTR-intronENST00000469525ENST00000532079SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-
5UTR-5UTRENST00000469525ENST00000332954SLC44A5chr1

76007120

-PLEKHA7chr11

16812752

-

Top

FusionProtFeatures for SLC44A5_PLEKHA7


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
SLC44A5

Q8NCS7

PLEKHA7

Q6IQ23

Required for zonula adherens biogenesis and maintenance.Acts via its interaction with KIAA1543/Nezha, which anchorsmicrotubules at their minus-ends to zonula adherens, leading tothe recruitment of KIFC3 kinesin to the junctional site.{ECO:0000269|PubMed:19041755}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-18231067_10949151122Coiled coilOntology_term=ECO:0000255
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-18231067_10949151123Coiled coilOntology_term=ECO:0000255

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-2241_384720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224264_2654720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224287_3254720Topological domainExtracellular
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224347_3514720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224373_3744720Topological domainExtracellular
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224396_4604720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224482_5154720Topological domainExtracellular
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224537_6104720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-22460_2424720Topological domainExtracellular
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224632_6494720Topological domainExtracellular
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224671_7194720Topological domainCytoplasmic
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224243_2634720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224266_2864720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224326_3464720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224352_3724720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224375_3954720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-22439_594720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224461_4814720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224516_5364720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224611_6314720TransmembraneHelical
HgeneSLC44A5chr1:76007120chr11:16812752ENST00000370855-224650_6704720TransmembraneHelical
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-1823700_8019151122Coiled coilOntology_term=ECO:0000255
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-1823700_8019151123Coiled coilOntology_term=ECO:0000255
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-1823567_5999151122Compositional biasNote=Pro-rich
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-1823845_9429151122Compositional biasNote=Pro-rich
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-1823567_5999151123Compositional biasNote=Pro-rich
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-1823845_9429151123Compositional biasNote=Pro-rich
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-1823164_2829151122DomainPH
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-182354_879151122DomainWW 2
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-18239_429151122DomainWW 1
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-1823164_2829151123DomainPH
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-182354_879151123DomainWW 2
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-18239_429151123DomainWW 1


Top

FusionGeneSequence for SLC44A5_PLEKHA7


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_SLC44A5_ENST00000370859_chr1_76007120_-_PLEKHA7_ENST00000531066_chr11_16812752_-_1933nt
ACAGTAGTGAATCGTAGCATGTTAGAGTTAGAAGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAG
CAACTCAAGTTTGCAGTGATTCAGGCCTACTTCTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGGAAGATGAAGCACCTCCCAGG
CCCCCACTCCCCGAACTCTACAGCCCAGAGGACCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACATCT
GTGCGGGGCCTCAAGCGGCAGTCAGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTGCGG
TCGTATGTCAGTGAGCCTGAGCTGGCGACCCTCAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTACCAG
ACGCTGCCAGGCAGAGGGCTCTCAGGGTCCACGTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGTCTC
AATGCCGAAAGCAGCAAGGCGACCTTCCCTAGACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATGAGT
GCAGAGGAGCAGCTGGAGCGCATGAAGCGACACCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACGGGC
CTGCCCTCATCTCGCTACCTCAGCCGGCCGCTCCCTGGAGATCTTGGCTCATGGAAGCGTGAGCAGGACTTTGACCTGCAGTTGCTGGAA
CGGGTCGTGCAAGGGGAAAAAAAGGACAAGGAGGAGAATGGCTGGTTGAAAGTGCAGGCCATGCCTGTCACTGAGTTGGACCTGGAGCCT
CAAGACTATGACTTGGACATCAGCAGAGAGCTGTCCAAACCAGAGAAGGTGTCAATCCCTGAGCGCTACGTGGAGCTAGATCCCGAAGAG
CCACCCAGCCTTGAGGAGCTGCAGGCGCGGTACCGCAAAGCCGAGAAGATCCGCAACATCCTCGCCCGGTCAAGCATGTGCAACCTACAG
CCGACCTCAGGCCAGGACCAGAACAGTGTGGCTGACCTGGACTTGCAGCTGCAGGAGCAGGAGCGCATCATCAACATCTCCTACGCCCTG
GCCTCCGAGGCCTCCCAGCGTAGCAAGCAGGTGGCAGCCCAGGCAGTGACTGACCCGTGACCCAGCATGCAAAGAAGCCTGGAGCCAGGG
GCCCAGTGGAACCAGCTTCCTCCAAGGAGATGACCTTTCTGCCCCCAAGGAAACCCCTTCCAGCTGAGCAGGGAATCCGGCCGGAGGAAG
GAGCAGCTTACCGACTGCGGGTGTTCACCACAGGCCAGGCCCTAATATGCACCCACTAGTTTAGCTCAGACTCCTCTCTACATATGAATG
GCAAAGGCACTTTTGATATACACTGTAAAATACACTGTATTTTAGAATCGGAATCTATTTTCTAATGTTCCCCTCAAGGGCTGAGTGGCA
GGAAGGTTGAGGATGCAGGACTTTGCAGCTGCACGTACAGATTCAGGTACTTCTGGGTGACAGGTGTTGTGGGGGCAGGAAGGGCGGGGC
AAGCCGAGGCTAGTCCAACTTCCAATGACCTCAGGAGAAAGTGAGATTTAAAGAGGTGTTCCCAGTAGACTCCAGCAAGAGGCTGGTTGG
CGTGCTGTCTGGGAGAAGAGGGGCCCTTGGCTGCAGAGATCAGCTGTCCCTGACCTGATGACCAGCTCTGTGTGAAACTCCACGAGGATC
ACACGTGGAGCCCAAGTCTGTGCCTTGCCCCTTGGGTTTGGCTTAGGGGCAACAGTGTGTTCAAGAGGACTGGGGCCCACAACCTGCCCC

>In-frame_SLC44A5_ENST00000370859_chr1_76007120_-_PLEKHA7_ENST00000355661_chr11_16812752_-_2383nt
ACAGTAGTGAATCGTAGCATGTTAGAGTTAGAAGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAG
CAACTCAAGTTTGCAGTGATTCAGGCCTACTTCTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGGAAGATGAAGCACCTCCCAGG
CCCCCACTCCCCGAACTCTACAGCCCAGAGGACCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACATCT
GTGCGGGGCCTCAAGCGGCAGTCAGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTGCGG
TCGTATGTCAGTGAGCCTGAGCTGGCGACCCTCAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTACCAG
ACGCTGCCAGGCAGAGGGCTCTCAGGGTCCACGTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGTCTC
AATGCCGAAAGCAGCAAGGCGACCTTCCCTAGACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATGAGT
GCAGAGGAGCAGCTGGAGCGCATGAAGCGACACCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACGGGC
CTGCCCTCATCTCGCTACCTCAGCCGGCCGCTCCCTGGAGATCTTGGCTCAGTATGTTAGGAGGGGCCAGGCAGCGGGGCAGGGACAGGG
AGCCGAGTGCCCCTCAGAGTCCCCCAAACACAAGCACATCACACCTCCCAGTGAGAGAGCTGTCCATTGACCTACATGGTTCAGAGAACA
CCCCACGGGGCTGTTTGTCCACGACCCAGGCTGGACGAATGCCTGGTCAGAGGGTGACCTGAACCAGAGCTGGAGTGAGGATCAAACAGG
CCCAGGAGCCTGAGGAAATACCCAGTCAGTCCTCCCAGCCGCGATGGAGAGGGGCCTTTGCAGGCGTTCGGAATCTCGGCTGAATTCAGG
ACCTGGGAATACAGGGTTCAGAGAGGAGAGGAGGAAGATGGTGACATGATTTGGTTAGAAGCACAAGCAAACTGATCAGCCTCCCAGACC
TGCCAGCAGATGCTGTGTGAGGGTGATGGAGCACGGGGTCACACCCCTGCCCCAAGGGCCACTGGTCTCCCTGGGCTTGCAGTGCAGAGG
CCTCAGGGTGTCTGGGATTGCTGGGGAGGCCTGTGCTGCCCCCTGGTGGCGCTTCCTGGCGCTGCGCCCTGTCCACAGTCACCTTAGGTC
CCTTTGGAAACATTCCATTTGACTTTTCCCTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCA
TTGCACAAGCTCCTTTGCTTTTAGTGTTACCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGA
ACATGCTCTAACTGGCCTGTGCTACTTATTACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACT
CACCTTTCTGCTGCCCTCTTCATGCAGGCCTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGC
CTGACGCCACAGTCATTGGCAGAGGTCTGGGCATTATTAATTTATAAAAATCCATGCTTTACACCTGGACAGTAGACAGGGACTTCAGAG
ATTGCACGTTTGAATACATTCTCCCAAGACTGAGGTTGTTCGGTTTTAATTCCTGTAGTCCAATCACACAATTTCTTATGGAAAACCTTT
TGTGTTTCTGGTATTTAATAACTTGAAGGGATAGCAAAATATACTGTGTATTCAGAGGGCCTCTCTGCAGCTGCTAGCTCAGACACCAAA
GGGGTAAGGCCCAGGACATTCATATCTTTAAAAGCTGCAAACCTGGTAACCTTTAAACTTTTAAAACAAATGTCATATGGGGTAACACTG
ACCTTTTATAATTTGATGTCTCAAATGTAGAGATTATCTAAAAATCGTAACTTGAATACCTTGTAATTTTTCTCTTAAAAAAGAAGACTT
GTGTAAGTCTCTGCATCAACGCCAATAAACATGTTGCTTAATAATAATGGATTGGCGTGGTTCTTCCCCAGGATACCTTATAGAGTCTAG
TGAACTTTTCCTGTTTGTGGAAACAATCAGGCTGGGTTTAAATGAGGACTTGTCTCTATTTGGAGCATTTGTGAGCGTGTAAGGAAATGA

>In-frame_SLC44A5_ENST00000370859_chr1_76007120_-_PLEKHA7_ENST00000448080_chr11_16812752_-_2202nt
ACAGTAGTGAATCGTAGCATGTTAGAGTTAGAAGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAG
CAACTCAAGTTTGCAGTGATTCAGGCCTACTTCTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGCAGGAAGATGAAGCACCTCCC
AGGCCCCCACTCCCCGAACTCTACAGCCCAGAGGACCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACA
TCTGTGCGGGGCCTCAAGCGGCAGTCAGACGAGAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTG
CGGTCGTATGTCAGTGAGCCTGAGCTGGCGACCCTCAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTAC
CAGACGCTGCCAGGCAGAGGGCTCTCAGGGTCCACGTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGT
CTCAATGCCGAAAGCAGCAAGGCGACCTTCCCTAGACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATG
AGTGCAGAGGAGCAGCTGGAGCGCATGAAGCGACACCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACG
GGCCTGCCCTCATCTCGCTACCTCAGCCGGCCGCTCCCTGGAGATCTTGGCTCAGTATGTTAGGAGGGGCCAGGCAGCGGGGCAGGGACA
GGGAGCCGAGTGCCCCTCAGAGTCCCCCAAACACAAGCACATCACACCTCCCAGTGAGAGAGCTGTCCATTGACCTACATGGTTCAGAGA
ACACCCCACGGGGCTGTTTGTCCACGACCCAGGCTGGACGAATGCCTGGTCAGAGGGTGACCTGAACCAGAGCTGGAGTGAGGATCAAAC
AGGCCCAGGAGCCTGAGGAAATACCCAGTCAGTCCTCCCAGCCGCGATGGAGAGGGGCCTTTGCAGGCGTTCGGAATCTCGGCTGAATTC
AGGACCTGGGAATACAGGGTTCAGAGAGGAGAGGAGGAAGATGGTGACATGATTTGGTTAGAAGCACAAGCAAACTGATCAGCCTCCCAG
ACCTGCCAGCAGATGCTGTGTGAGGGTGATGGAGCACGGGGTCACACCCCTGCCCCAAGGGCCACTGGTCTCCCTGGGCTTGCAGTGCAG
AGGCCTCAGGGTGTCTGGGATTGCTGGGGAGGCCTGTGCTGCCCCCTGGTGGCGCTTCCTGGCGCTGCGCCCTGTCCACAGTCACCTTAG
GTCCCTTTGGAAACATTCCATTTGACTTTTCCCTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAAT
TCATTGCACAAGCTCCTTTGCTTTTAGTGTTACCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCAT
TGAACATGCTCTAACTGGCCTGTGCTACTTATTACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTG
ACTCACCTTTCTGCTGCCCTCTTCATGCAGGCCTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGC
TGCCTGACGCCACAGTCATTGGCAGAGGTCTGGGCATTATTAATTTATAAAAATCCATGCTTTACACCTGGACAGTAGACAGGGACTTCA
GAGATTGCACGTTTGAATACATTCTCCCAAGACTGAGGTTGTTCGGTTTTAATTCCTGTAGTCCAATCACACAATTTCTTATGGAAAACC
TTTTGTGTTTCTGGTATTTAATAACTTGAAGGGATAGCAAAATATACTGTGTATTCAGAGGGCCTCTCTGCAGCTGCTAGCTCAGACACC
AAAGGGGTAAGGCCCAGGACATTCATATCTTTAAAAGCTGCAAACCTGGTAACCTTTAAACTTTTAAAACAAATGTCATATGGGGTAACA
CTGACCTTTTATAATTTGATGTCTCAAATGTAGAGATTATCTAAAAATCGTAACTTGAATACCTTGTAATTTTTCTCTTAAAAAAGAAGA

>In-frame_SLC44A5_ENST00000370855_chr1_76007120_-_PLEKHA7_ENST00000531066_chr11_16812752_-_1901nt
AGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAGCAACTCAAGTTTGCAGTGATTCAGGCCTACTT
CTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGGAAGATGAAGCACCTCCCAGGCCCCCACTCCCCGAACTCTACAGCCCAGAGGA
CCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACATCTGTGCGGGGCCTCAAGCGGCAGTCAGACGAGAG
GAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTGCGGTCGTATGTCAGTGAGCCTGAGCTGGCGACCCT
CAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTACCAGACGCTGCCAGGCAGAGGGCTCTCAGGGTCCAC
GTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGTCTCAATGCCGAAAGCAGCAAGGCGACCTTCCCTAG
ACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATGAGTGCAGAGGAGCAGCTGGAGCGCATGAAGCGACA
CCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACGGGCCTGCCCTCATCTCGCTACCTCAGCCGGCCGCT
CCCTGGAGATCTTGGCTCATGGAAGCGTGAGCAGGACTTTGACCTGCAGTTGCTGGAACGGGTCGTGCAAGGGGAAAAAAAGGACAAGGA
GGAGAATGGCTGGTTGAAAGTGCAGGCCATGCCTGTCACTGAGTTGGACCTGGAGCCTCAAGACTATGACTTGGACATCAGCAGAGAGCT
GTCCAAACCAGAGAAGGTGTCAATCCCTGAGCGCTACGTGGAGCTAGATCCCGAAGAGCCACCCAGCCTTGAGGAGCTGCAGGCGCGGTA
CCGCAAAGCCGAGAAGATCCGCAACATCCTCGCCCGGTCAAGCATGTGCAACCTACAGCCGACCTCAGGCCAGGACCAGAACAGTGTGGC
TGACCTGGACTTGCAGCTGCAGGAGCAGGAGCGCATCATCAACATCTCCTACGCCCTGGCCTCCGAGGCCTCCCAGCGTAGCAAGCAGGT
GGCAGCCCAGGCAGTGACTGACCCGTGACCCAGCATGCAAAGAAGCCTGGAGCCAGGGGCCCAGTGGAACCAGCTTCCTCCAAGGAGATG
ACCTTTCTGCCCCCAAGGAAACCCCTTCCAGCTGAGCAGGGAATCCGGCCGGAGGAAGGAGCAGCTTACCGACTGCGGGTGTTCACCACA
GGCCAGGCCCTAATATGCACCCACTAGTTTAGCTCAGACTCCTCTCTACATATGAATGGCAAAGGCACTTTTGATATACACTGTAAAATA
CACTGTATTTTAGAATCGGAATCTATTTTCTAATGTTCCCCTCAAGGGCTGAGTGGCAGGAAGGTTGAGGATGCAGGACTTTGCAGCTGC
ACGTACAGATTCAGGTACTTCTGGGTGACAGGTGTTGTGGGGGCAGGAAGGGCGGGGCAAGCCGAGGCTAGTCCAACTTCCAATGACCTC
AGGAGAAAGTGAGATTTAAAGAGGTGTTCCCAGTAGACTCCAGCAAGAGGCTGGTTGGCGTGCTGTCTGGGAGAAGAGGGGCCCTTGGCT
GCAGAGATCAGCTGTCCCTGACCTGATGACCAGCTCTGTGTGAAACTCCACGAGGATCACACGTGGAGCCCAAGTCTGTGCCTTGCCCCT
TGGGTTTGGCTTAGGGGCAACAGTGTGTTCAAGAGGACTGGGGCCCACAACCTGCCCCCAGGCTTCCTCCAGCAAAAGGCTCTTGTCAGA

>In-frame_SLC44A5_ENST00000370855_chr1_76007120_-_PLEKHA7_ENST00000355661_chr11_16812752_-_2351nt
AGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAGCAACTCAAGTTTGCAGTGATTCAGGCCTACTT
CTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGGAAGATGAAGCACCTCCCAGGCCCCCACTCCCCGAACTCTACAGCCCAGAGGA
CCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACATCTGTGCGGGGCCTCAAGCGGCAGTCAGACGAGAG
GAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTGCGGTCGTATGTCAGTGAGCCTGAGCTGGCGACCCT
CAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTACCAGACGCTGCCAGGCAGAGGGCTCTCAGGGTCCAC
GTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGTCTCAATGCCGAAAGCAGCAAGGCGACCTTCCCTAG
ACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATGAGTGCAGAGGAGCAGCTGGAGCGCATGAAGCGACA
CCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACGGGCCTGCCCTCATCTCGCTACCTCAGCCGGCCGCT
CCCTGGAGATCTTGGCTCAGTATGTTAGGAGGGGCCAGGCAGCGGGGCAGGGACAGGGAGCCGAGTGCCCCTCAGAGTCCCCCAAACACA
AGCACATCACACCTCCCAGTGAGAGAGCTGTCCATTGACCTACATGGTTCAGAGAACACCCCACGGGGCTGTTTGTCCACGACCCAGGCT
GGACGAATGCCTGGTCAGAGGGTGACCTGAACCAGAGCTGGAGTGAGGATCAAACAGGCCCAGGAGCCTGAGGAAATACCCAGTCAGTCC
TCCCAGCCGCGATGGAGAGGGGCCTTTGCAGGCGTTCGGAATCTCGGCTGAATTCAGGACCTGGGAATACAGGGTTCAGAGAGGAGAGGA
GGAAGATGGTGACATGATTTGGTTAGAAGCACAAGCAAACTGATCAGCCTCCCAGACCTGCCAGCAGATGCTGTGTGAGGGTGATGGAGC
ACGGGGTCACACCCCTGCCCCAAGGGCCACTGGTCTCCCTGGGCTTGCAGTGCAGAGGCCTCAGGGTGTCTGGGATTGCTGGGGAGGCCT
GTGCTGCCCCCTGGTGGCGCTTCCTGGCGCTGCGCCCTGTCCACAGTCACCTTAGGTCCCTTTGGAAACATTCCATTTGACTTTTCCCTG
TTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCATTGCACAAGCTCCTTTGCTTTTAGTGTTACCG
CTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGAACATGCTCTAACTGGCCTGTGCTACTTATTAC
CGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACTCACCTTTCTGCTGCCCTCTTCATGCAGGCCTA
CTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGCCTGACGCCACAGTCATTGGCAGAGGTCTGGGC
ATTATTAATTTATAAAAATCCATGCTTTACACCTGGACAGTAGACAGGGACTTCAGAGATTGCACGTTTGAATACATTCTCCCAAGACTG
AGGTTGTTCGGTTTTAATTCCTGTAGTCCAATCACACAATTTCTTATGGAAAACCTTTTGTGTTTCTGGTATTTAATAACTTGAAGGGAT
AGCAAAATATACTGTGTATTCAGAGGGCCTCTCTGCAGCTGCTAGCTCAGACACCAAAGGGGTAAGGCCCAGGACATTCATATCTTTAAA
AGCTGCAAACCTGGTAACCTTTAAACTTTTAAAACAAATGTCATATGGGGTAACACTGACCTTTTATAATTTGATGTCTCAAATGTAGAG
ATTATCTAAAAATCGTAACTTGAATACCTTGTAATTTTTCTCTTAAAAAAGAAGACTTGTGTAAGTCTCTGCATCAACGCCAATAAACAT
GTTGCTTAATAATAATGGATTGGCGTGGTTCTTCCCCAGGATACCTTATAGAGTCTAGTGAACTTTTCCTGTTTGTGGAAACAATCAGGC
TGGGTTTAAATGAGGACTTGTCTCTATTTGGAGCATTTGTGAGCGTGTAAGGAAATGAGTGTTTTCTTTGTGAATCATTAAATTGATTTT

>In-frame_SLC44A5_ENST00000370855_chr1_76007120_-_PLEKHA7_ENST00000448080_chr11_16812752_-_2170nt
AGGTTCAGTGTTGATGGAGTTATTGAAGAAATGATGGAGTAAGAGACTCTTTTCTAAGCAACTCAAGTTTGCAGTGATTCAGGCCTACTT
CTGAAGAGACAGCCTTTTATCTCAATGAATGACACAGCAGGAAGATGAAGCACCTCCCAGGCCCCCACTCCCCGAACTCTACAGCCCAGA
GGACCAGCCCCCGGCTGTGCCGCCTCTGCCAAGAGAGGCCACCATCATCCGGCACACATCTGTGCGGGGCCTCAAGCGGCAGTCAGACGA
GAGGAAGCGAGACCGGGAGCTGGGGCAGTGTGTGAATGGGGATTCCAGGGTGGAGCTGCGGTCGTATGTCAGTGAGCCTGAGCTGGCGAC
CCTCAGCGGGGACATGGCCCAGCCCTCCCTAGGACTTGTGGGCCCTGAGAGCAGGTACCAGACGCTGCCAGGCAGAGGGCTCTCAGGGTC
CACGTCAAGGCTCCAGCAGTCGTCCACCATTGCTCCCTACGTCACACTCCGGAGGGGTCTCAATGCCGAAAGCAGCAAGGCGACCTTCCC
TAGACCTAAGAGTGCCTTGGAGCGCCTGTACTCAGGGGATCACCAGCGAGGCAAGATGAGTGCAGAGGAGCAGCTGGAGCGCATGAAGCG
ACACCAGAAGGCCCTGGTCCGAGAGCGCAAGAGGACACTGGGCCAAGGGGAGAGGACGGGCCTGCCCTCATCTCGCTACCTCAGCCGGCC
GCTCCCTGGAGATCTTGGCTCAGTATGTTAGGAGGGGCCAGGCAGCGGGGCAGGGACAGGGAGCCGAGTGCCCCTCAGAGTCCCCCAAAC
ACAAGCACATCACACCTCCCAGTGAGAGAGCTGTCCATTGACCTACATGGTTCAGAGAACACCCCACGGGGCTGTTTGTCCACGACCCAG
GCTGGACGAATGCCTGGTCAGAGGGTGACCTGAACCAGAGCTGGAGTGAGGATCAAACAGGCCCAGGAGCCTGAGGAAATACCCAGTCAG
TCCTCCCAGCCGCGATGGAGAGGGGCCTTTGCAGGCGTTCGGAATCTCGGCTGAATTCAGGACCTGGGAATACAGGGTTCAGAGAGGAGA
GGAGGAAGATGGTGACATGATTTGGTTAGAAGCACAAGCAAACTGATCAGCCTCCCAGACCTGCCAGCAGATGCTGTGTGAGGGTGATGG
AGCACGGGGTCACACCCCTGCCCCAAGGGCCACTGGTCTCCCTGGGCTTGCAGTGCAGAGGCCTCAGGGTGTCTGGGATTGCTGGGGAGG
CCTGTGCTGCCCCCTGGTGGCGCTTCCTGGCGCTGCGCCCTGTCCACAGTCACCTTAGGTCCCTTTGGAAACATTCCATTTGACTTTTCC
CTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCATTGCACAAGCTCCTTTGCTTTTAGTGTTA
CCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGAACATGCTCTAACTGGCCTGTGCTACTTAT
TACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACTCACCTTTCTGCTGCCCTCTTCATGCAGGC
CTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGCCTGACGCCACAGTCATTGGCAGAGGTCTG
GGCATTATTAATTTATAAAAATCCATGCTTTACACCTGGACAGTAGACAGGGACTTCAGAGATTGCACGTTTGAATACATTCTCCCAAGA
CTGAGGTTGTTCGGTTTTAATTCCTGTAGTCCAATCACACAATTTCTTATGGAAAACCTTTTGTGTTTCTGGTATTTAATAACTTGAAGG
GATAGCAAAATATACTGTGTATTCAGAGGGCCTCTCTGCAGCTGCTAGCTCAGACACCAAAGGGGTAAGGCCCAGGACATTCATATCTTT
AAAAGCTGCAAACCTGGTAACCTTTAAACTTTTAAAACAAATGTCATATGGGGTAACACTGACCTTTTATAATTTGATGTCTCAAATGTA
GAGATTATCTAAAAATCGTAACTTGAATACCTTGTAATTTTTCTCTTAAAAAAGAAGACTTGTGTAAGTCTCTGCATCAACGCCAATAAA


Top

FusionGenePPI for SLC44A5_PLEKHA7


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
SLC44A5RNF181, CLDND1, MOSPD2, REEP4, UPK1A, NME2P1, ATG9A, TMEM63APLEKHA7USP20, YWHAQ, LATS2, YWHAB, TSPAN33, FGL1, NINL, CDH1, EGFR, CDC14A, KCTD3, KIF13B, ZBTB21, KSR1, GIGYF1, LRFN1, DENND1A, CGN, SH3PXD2A, SRGAP2, EIF4E2, RTKN, SIPA1L1, MAST3, PPM1H, LIMA1, MAGI1, TESK2, DCLK1, ZNF638, DENND4C, SRSF12, SYDE1, HDAC4, AGAP1, NF1, CDC25B, CDK16, CBY1, MAPKAP1, FAM110B, USP21, NADK, CDC25C, FAM53C, ANKRD34A, GIGYF2, CAMSAP2, TIAM1, KIAA1804, RASAL2, INPP5E


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000355661-1823538_6969151122CTNND1
TgenePLEKHA7chr1:76007120chr11:16812752ENST00000448080-1823538_6969151123CTNND1


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for SLC44A5_PLEKHA7


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for SLC44A5_PLEKHA7


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgenePLEKHA7C0017605Angle Closure Glaucoma2CTD_human