|
||||||
|
 | |
| |
| |
| |
| |
|
Fusion gene ID: 33424 |
FusionGeneSummary for SET_MST1R |
 Fusion gene summary |
| Fusion gene information | Fusion gene name: SET_MST1R | Fusion gene ID: 33424 | Hgene | Tgene | Gene symbol | SET | MST1R | Gene ID | 6418 | 4486 |
| Gene name | SET nuclear proto-oncogene | macrophage stimulating 1 receptor | |
| Synonyms | 2PP2A|I2PP2A|IGAAD|IPP2A2|PHAPII|TAF-I|TAF-IBETA | CD136|CDw136|NPCA3|PTK8|RON | |
| Cytomap | 9q34.11 | 3p21.31 | |
| Type of gene | protein-coding | protein-coding | |
| Description | protein SETHLA-DR-associated protein IISET nuclear oncogeneSET translocation (myeloid leukemia-associated)Template-Activating Factor-I, chromatin remodelling factorinhibitor of granzyme A-activated DNaseinhibitor-2 of protein phosphatase-2Aphosphat | macrophage-stimulating protein receptorMSP receptorPTK8 protein tyrosine kinase 8c-met-related tyrosine kinasep185-Ron | |
| Modification date | 20180522 | 20180523 | |
| UniProtAcc | Q01105 | Q04912 | |
| Ensembl transtripts involved in fusion gene | ENST00000372692, ENST00000409104, ENST00000322030, ENST00000372688, ENST00000477806, | ENST00000296474, ENST00000344206, | |
| Fusion gene scores | * DoF score | 3 X 3 X 2=18 | 2 X 2 X 2=8 |
| # samples | 3 | 2 | |
| ** MAII score | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(2/8*10)=1.32192809488736 | |
| Context | PubMed: SET [Title/Abstract] AND MST1R [Title/Abstract] AND fusion [Title/Abstract] | ||
| Functional or gene categories assigned by FusionGDB annotation | |||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | SET | GO:0045892 | negative regulation of transcription, DNA-templated | 19343227 |
| Tgene | MST1R | GO:0009615 | response to virus | 12676986 |
| Tgene | MST1R | GO:0043406 | positive regulation of MAP kinase activity | 12676986 |
| Tgene | MST1R | GO:0051897 | positive regulation of protein kinase B signaling | 12676986 |
| Fusion gene information from three resources (ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018)) * All genome coordinats were lifted-over on hg19. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| Data type | Source | Cancer type | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| ChiTaRS3.1 | BE932152 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| * LD: Li Ding group's fusion gene list RV: Roel Verhaak group's fusion gene list ChiTaRs fusion database |
| Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ORF | Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| In-frame | ENST00000372692 | ENST00000296474 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| Frame-shift | ENST00000372692 | ENST00000344206 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| In-frame | ENST00000409104 | ENST00000296474 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| Frame-shift | ENST00000409104 | ENST00000344206 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| In-frame | ENST00000322030 | ENST00000296474 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| Frame-shift | ENST00000322030 | ENST00000344206 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| In-frame | ENST00000372688 | ENST00000296474 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| Frame-shift | ENST00000372688 | ENST00000344206 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| 3UTR-3CDS | ENST00000477806 | ENST00000296474 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
| 3UTR-3CDS | ENST00000477806 | ENST00000344206 | SET | chr9 | 131454279 | + | MST1R | chr3 | 49924911 | - |
Top |
FusionProtFeatures for SET_MST1R |
| Main function of each fusion partner protein. (from UniProt) |
| Hgene | Tgene |
| SET | MST1R |
| Multitasking protein, involved in apoptosis,transcription, nucleosome assembly and histone chaperoning.Isoform 2 anti-apoptotic activity is mediated by inhibition of theGZMA-activated DNase, NME1. In the course of cytotoxic T-lymphocyte (CTL)-induced apoptosis, GZMA cleaves SET, disruptingits binding to NME1 and releasing NME1 inhibition. Isoform 1 andisoform 2 are potent inhibitors of protein phosphatase 2A. Isoform1 and isoform 2 inhibit EP300/CREBBP and PCAF-mediated acetylationof histones (HAT) and nucleosomes, most probably by masking theaccessibility of lysines of histones to the acetylases. Thepredominant target for inhibition is histone H4. HAT inhibitionleads to silencing of HAT-dependent transcription and preventsactive demethylation of DNA. Both isoforms stimulate DNAreplication of the adenovirus genome complexed with viral coreproteins; however, isoform 2 specific activity is higher.{ECO:0000269|PubMed:11555662, ECO:0000269|PubMed:12628186}. | Receptor tyrosine kinase that transduces signals fromthe extracellular matrix into the cytoplasm by binding to MST1ligand. Regulates many physiological processes including cellsurvival, migration and differentiation. Ligand binding at thecell surface induces autophosphorylation of RON on itsintracellular domain that provides docking sites for downstreamsignaling molecules. Following activation by ligand, interactswith the PI3-kinase subunit PIK3R1, PLCG1 or the adapter GAB1.Recruitment of these downstream effectors by RON leads to theactivation of several signaling cascades including the RAS-ERK,PI3 kinase-AKT, or PLCgamma-PKC. RON signaling activates the woundhealing response by promoting epithelial cell migration,proliferation as well as survival at the wound site. Plays also arole in the innate immune response by regulating the migration andphagocytic activity of macrophages. Alternatively, RON can alsopromote signals such as cell migration and proliferation inresponse to growth factors other than MST1 ligand.{ECO:0000269|PubMed:18836480, ECO:0000269|PubMed:7939629,ECO:0000269|PubMed:9764835}. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at . * Minus value of BPloci means that the break pointn is located before the CDS. |
| - In-frame and retained protein feature among the 13 regional features. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| - In-frame and not-retained protein feature among the 13 regional features. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Top |
FusionGeneSequence for SET_MST1R |
| For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences. (nt: nucleotides, aa: amino acids) |
| * Fusion amino acid sequences. |
| * Fusion transcript sequences (only coding sequence (CDS) region). |
| * Fusion transcript sequences (Full-length transcript). |
| >In-frame_SET_ENST00000372692_chr9_131454279_+_MST1R_ENST00000296474_chr3_49924911_-_554nt GTGCCCCTGCAGAGCGAGGCAGAGAGCAACTAAAAGAAATTTCTCCTGATTGGAGGGTGGGTGGGATGAGGCTGGGGGAGGGGGCCGGGG TGTGTGTCCCACTGTCATGTAAATATCCCTTCCAGGCAGGGCGGCTCCAGTGCAGATTTAAGCCGCTGGCACCTGGGGCAGTCTCAGTGT TCAGCCTGCTTCCGGACGGGCGAGGAGACTCGTGGTCTGGTTCTGGGACTTCCCTAACAGCATGGCCCCTAAACGCCAGTCTCCACTCCC GCCTCAAAAGAAGAAACCAAGACCACCTCCTGCTCTGGGACCGGAGGAGACATCGGCCTCTGCAGGCTTGCCGAAGAAGGGAGAAAAAGA ACAGCAAGAAGCGATTGAACACATTGATGAAGTACAAAATGAAATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGA ACAGAAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCGCCAAAATCCCAAATTTTTGGGTAACAACATTTGT >In-frame_SET_ENST00000409104_chr9_131454279_+_MST1R_ENST00000296474_chr3_49924911_-_332nt AAGAAGCACTGAGGAGGAGTCCTACCTCAGGGCTCAGTGTGGACCTGTTGGCACTTTTACTGGGTCTCAGTCCCTTTTCCTCCACATGGG ATGCAGAGACCTCCTGCCCAGCTTGAAACCTACCTTGCTGGAAAAAGAACAGCAAGAAGCGATTGAACACATTGATGAAGTACAAAATGA AATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGAACAGAAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAG >In-frame_SET_ENST00000322030_chr9_131454279_+_MST1R_ENST00000296474_chr3_49924911_-_631nt CGCCGTAGGAGGAGGTGGAGGAGGAGGCGGCTCGGGAGAGCGAGCAGCGAGCTGGCTGGATCGCCGAGCGCGAGTGAGGGAGCCGAGCCG CCCGCCGCCGCCGCCTCCGCCTCCCCTCCGCGAACAGGAGCCCGGGCCGGGGCCCGGCACGCCGCCCCAGCCCGTCCCTCGGCGTCAGGC CGCGAGGGTAGCGCGCGCGAGCGAGCGAGGGGGAGGGAGAGCGAGCGAGCGCCGGGAGGAGGCGGCCGGACCGAGCGGGCGCCCGCGCGT GTGGCGTGAGGGGAAGCCGCTTGCCCGCCCCCTTCGCCTTCCCTTCTCTCCCCCTCCCCGCTCCCCCCCCGACCGCGGAGCAGCACCATG TCGGCGCCGGCGGCCAAAGTCAGTAAAAAGGAGCTCAACTCCAACCACGACGGGGCCGACGAGACCTCAGAAAAAGAACAGCAAGAAGCG ATTGAACACATTGATGAAGTACAAAATGAAATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGAACAGAAATATAAC AAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCGCCAAAATCCCAAATTTTTGGGTAACAACATTTGTCAACCATCCACAA >In-frame_SET_ENST00000372688_chr9_131454279_+_MST1R_ENST00000296474_chr3_49924911_-_241nt ATGATGCCTCGCTCCCATCAGCCGCCGCCGCCGCCACATGAAAAAGAACAGCAAGAAGCGATTGAACACATTGATGAAGTACAAAATGAA ATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGAACAGAAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGG |
Top |
FusionGenePPI for SET_MST1R |
| Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in . |
| Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160) |
| Hgene | Hgene's interactors | Tgene | Tgene's interactors |
| - Retained PPIs in in-frame fusion. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Still interaction with |
| - Lost PPIs in in-frame fusion. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
| - Retained PPIs, but lost function due to frame-shift fusion. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
Top |
RelatedDrugs for SET_MST1R |
| Drugs targeting genes involved in this fusion gene. (DrugBank Version 5.1.0 2018-04-02) |
| Partner | Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SET_MST1R |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | SET | C0027540 | Necrosis | 1 | CTD_human |
| Hgene | SET | C0027626 | Neoplasm Invasiveness | 1 | CTD_human |
| Tgene | MST1R | C0029463 | Osteosarcoma | 1 | CTD_human |
| Tgene | MST1R | C4277682 | Chemical and Drug Induced Liver Injury | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|