FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 32413

FusionGeneSummary for RUNX1_YTHDF2

check button Fusion gene summary
Fusion gene informationFusion gene name: RUNX1_YTHDF2
Fusion gene ID: 32413
HgeneTgene
Gene symbol

RUNX1

YTHDF2

Gene ID

861

51441

Gene namerunt related transcription factor 1YTH N6-methyladenosine RNA binding protein 2
SynonymsAML1|AML1-EVI-1|AMLCR1|CBF2alpha|CBFA2|EVI-1|PEBP2aB|PEBP2alphaCAHL|HGRG8|NY-REN-2
Cytomap

21q22.12

1p35.3

Type of geneprotein-codingprotein-coding
Descriptionrunt-related transcription factor 1AML1-EVI-1 fusion proteinPEA2-alpha BPEBP2-alpha BSL3-3 enhancer factor 1 alpha B subunitSL3/AKV core-binding factor alpha B subunitacute myeloid leukemia 1 proteincore-binding factor, runt domain, alpha subunit 2YTH domain-containing family protein 29430020E02RikCLL-associated antigen KW-14YTH N(6)-methyladenosine RNA binding protein 2YTH domain family, member 2high-glucose-regulated protein 8renal carcinoma antigen NY-REN-2
Modification date2018052720180519
UniProtAcc

Q01196

Q9Y5A9

Ensembl transtripts involved in fusion geneENST00000344691, ENST00000325074, 
ENST00000437180, ENST00000300305, 
ENST00000399240, ENST00000486278, 
ENST00000494829, ENST00000358356, 
ENST00000542507, ENST00000373812, 
ENST00000541996, ENST00000478283, 
Fusion gene scores* DoF score23 X 25 X 7=40257 X 3 X 5=105
# samples 538
** MAII scorelog2(53/4025*10)=-2.92492451843878
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(8/105*10)=-0.39231742277876
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: RUNX1 [Title/Abstract] AND YTHDF2 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationTumor suppressor gene involved fusion gene, retained protein feature but frameshift.
DDR (DNA damage repair) gene involved fusion gene, in-frame but not retained their domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneRUNX1

GO:0030097

hemopoiesis

21873977

HgeneRUNX1

GO:0045893

positive regulation of transcription, DNA-templated

10207087|14970218

HgeneRUNX1

GO:0045944

positive regulation of transcription by RNA polymerase II

9199349|10207087|14970218|21873977

TgeneYTHDF2

GO:1903679

positive regulation of cap-independent translational initiation

26458103


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1EU093085RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000344691ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000344691ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000344691ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000344691ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000325074ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000325074ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000325074ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000325074ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000437180ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
In-frameENST00000437180ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000437180ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000437180ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000300305ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000300305ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000300305ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000300305ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000399240ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000399240ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000399240ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000399240ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000486278ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000486278ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000486278ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000486278ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
intron-3CDSENST00000494829ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
intron-3CDSENST00000494829ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
intron-3CDSENST00000494829ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
intron-3UTRENST00000494829ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000358356ENST00000542507RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000358356ENST00000373812RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
Frame-shitENST00000358356ENST00000541996RUNX1chr21

36231770

-YTHDF2chr1

29095441

+
5CDS-3UTRENST00000358356ENST00000478283RUNX1chr21

36231770

-YTHDF2chr1

29095441

+

Top

FusionProtFeatures for RUNX1_YTHDF2


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
RUNX1

Q01196

YTHDF2

Q9Y5A9

Specifically recognizes and binds N6-methyladenosine(m6A)-containing RNAs, and regulates mRNA stability(PubMed:24284625, PubMed:26046440, PubMed:26318451). M6A is amodification present at internal sites of mRNAs and some non-coding RNAs and plays a role in mRNA stability and processing(PubMed:22575960, PubMed:24284625, PubMed:25412658,PubMed:25412661). Acts as a regulator of mRNA stability: bindingto m6A-containing mRNAs results in the localization to mRNA decaysites, such as processing bodies (P-bodies), leading to mRNAdegradation (PubMed:24284625, PubMed:26046440). Requiredmaternally to regulate oocyte maturation: probably acts by bindingto m6A-containing mRNAs, thereby regulating maternal transcriptdosage during oocyte maturation, which is essential for thecompetence of oocytes to sustain early zygotic development (Bysimilarity). Also involved in haematopoietic stem cellsspecification: acts by binding to m6A-containing mRNAs, leading todecrease Notch dignaling and promote endothelial to haematopoietictransition (By similarity). Also acts as a promoter of cap-independent mRNA translation following heat shock stress: uponstress, relocalizes to the nucleus and specifically binds mRNAswith some m6A methylation mark at their 5'-UTR, protectingdemethylation of mRNAs by FTO, thereby promoting cap-independentmRNA translation (PubMed:26458103). May inhibit replication ofkaposis sarcoma-associated herpesvirus (KSHV); its role is howeverunclear and additional evidences are needed to confirm suchresults (PubMed:29109479). {ECO:0000250|UniProtKB:E7F1H9,ECO:0000250|UniProtKB:Q91YT7, ECO:0000269|PubMed:22575960,ECO:0000269|PubMed:24284625, ECO:0000269|PubMed:25412658,ECO:0000269|PubMed:25412661, ECO:0000269|PubMed:26046440,ECO:0000269|PubMed:26318451, ECO:0000269|PubMed:26458103,ECO:0000269|PubMed:29109479}. (Microbial infection) Promotes viral gene expression andreplication of polyomavirus SV40: acts by binding to N6-methyladenosine (m6A)-containing viral RNAs (PubMed:29447282).{ECO:0000269|PubMed:29447282}. (Microbial infection) Promotes viral gene expression andvirion production of kaposis sarcoma-associated herpesvirus (KSHV)at some stage of the KSHV life cycle (in iSLK.219 and iSLK.BAC16cells) (PubMed:29659627). Acts by binding to N6-methyladenosine(m6A)-containing viral RNAs (PubMed:29659627).{ECO:0000269|PubMed:29659627}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for RUNX1_YTHDF2


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_RUNX1_ENST00000437180_chr21_36231770_-_YTHDF2_ENST00000373812_chr1_29095441_+_43aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_RUNX1_ENST00000437180_chr21_36231770_-_YTHDF2_ENST00000373812_chr1_29095441_+_129nt
ATTGTGAATCTGATCGAGGAGACTGGCCACTTCAATGTCACCAACACCACCTTCGACTTCGACCTCTTCTCCCTGGACGAGACCACCGTG


* Fusion transcript sequences (Full-length transcript).
>In-frame_RUNX1_ENST00000437180_chr21_36231770_-_YTHDF2_ENST00000373812_chr1_29095441_+_1650nt
CTTTGGGCCTCATAAACAACCACAGAACCACAAGTTGGGTAGCCTGGCAGTGTCAGAAGTCTGAACCCAGCATAGTGGTCAGCAGGCAGG
ACGAATCACACTGAATGCAAACCACAGGGTTTCGCAGCGTGGTAAAAGAAATCATTGAGTCCCCCGCCTTCAGAAGAGGGTGCATTTTCA
GGAGGAAGCGATGGCTTCAGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGTGCTTCATGAGAGAATGCATACTTGGAATGAATCC
TTCTAGAGACGTCCACGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTGAGCCCAGGCAAGATGAGCGAGGCGTTGCC
GCTGGGCGCCCCGGACGCCGGCGCTGCCCTGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGG
CGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAA
GGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGC
TACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCAT
CACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGAACGTC
AAGGTCGTGGGAAATAAAAGGCAGTTCTACACAGACTGCAGCAACGGTTGCATCTGCATATCCTAAGAGGAAAAAATGACCTTCAAGAGA
ATTAGGACTTTTTTCTTAATTTCACTGACTTCAGAGACGATTGCAGACTTGCAGTTTAAGTATTGGAATTTCACAAAAGACATAGGACTT
AACTGGAAAATGAAAAAAAAAAGAAAAAGAAAAAACTAAACAAAAAATCCCTCTAGGTAGTTTAGGTGAAAAATGTCCCTTTTATTTTGG
CTTTGGTTGTGATTTCAGAGCATAATGCTATGTTTTTTTGTCTTTTTACTATGTTTTTCGGATTTTTAAGTCCGTAAGTGCATACAGTTT
TCTCTAATTTTTAAACCCTTTCCTCCTCCCATTTTGACATTTGCACTTGGAGAACACTTGAGTTGTGAAGGTTTTGGGCATCCACCCCAG
AAAGTGGGAATTTGATTTTATCCTTCCGAACTGGAAGAACATTTTTATGAAGAATTTTTGTCTAGGAGAATATAACAGTGTTACCCAAGG
TTGTGTCTTTAAGGGTGGTTCATTTTCTCTGACCTTTTGTTACTCAAAGTAAAGTACTAGGAGTCCTAAGAAATGTTCTGTTCTTGTACA
TTATACTGATTAAGTCAGGATTAATTTGATTTCAAAGCTGAGAACAGTGGTAAAAACTCGTTTACAGAAATGCATTTTGGAAGAGAAAAA
TACTGTAAAACGTGTCGTGAATGTTTCTTCAGTTTCTTGTTCAGCCAATGAGGAAAGGGCATTGCCTTTCTTTTTACCATTAATCACTTC


Top

FusionGenePPI for RUNX1_YTHDF2


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
RUNX1SUV39H1, KAT6B, CBFB, AES, PAX5, YAP1, JUN, FOS, SMAD3, SMAD1, SMAD2, SMAD5, VDR, ELF4, ELF2, CEBPB, TLE1, CBFA2T2, TRAF6, FHL2, MYOD1, HIPK2, EP300, HDAC1, HDAC3, KAT6A, TCF12, TCF3, RUNX1T1, NCOR1, SIAH1, UBE2L6, RUNX1, PML, RARA, HDAC2, SIN3A, NR4A2, TRIM33, STUB1, SMARCA4, SMARCB1, SMARCC1, CDK1, TAL1, COPRS, KMT2A, RBM14, SPEN, DNMT1, ELAVL1, CBFA2T3, PRMT1, HLA-DMA, CREBBP, UXT, CTBP2, NOTCH1, MYC, NCOR2, FOXP3, SOX2, CTBP1, HDAC11, RAG1, SPI1, ELF1, CDK6, KLF6, NFATC1, NFATC2, ZNF131, BRCA1, CDK9, FANCD2YTHDF2HNRNPA1, HNRNPH1, MEPCE, POT1, ELAVL1, CUL3, CAND1, SMAD3, APP, ESR1, EPAS1, FN1, VCAM1, HIPK4, FBXO6, TARDBP, EIF3A, EIF3H, RPA3, RPA2, RPA1, RNF2, BMI1, RPS6KB2, AGL, HMBS, ASPSCR1, SEPT7, SFPQ, USP13, USP5, NTRK1, B9D2, DCTN1, CEP19, XPO1, RPL10, MCM2, OTUB1, G3BP1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for RUNX1_YTHDF2


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for RUNX1_YTHDF2


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneRUNX1C0023467Leukemia, Myelocytic, Acute2CTD_human;HPO
HgeneRUNX1C0023485Precursor B-Cell Lymphoblastic Leukemia-Lymphoma2CTD_human
HgeneRUNX1C0003873Rheumatoid Arthritis1CTD_human
HgeneRUNX1C0017636Glioblastoma1CTD_human
HgeneRUNX1C0033578Prostatic Neoplasms1CTD_human
HgeneRUNX1C0349639Juvenile Myelomonocytic Leukemia1CTD_human
HgeneRUNX1C1832388Platelet Disorder, Familial, with Associated Myeloid Malignancy1CTD_human;ORPHANET;UNIPROT
HgeneRUNX1C1961102Precursor Cell Lymphoblastic Leukemia Lymphoma1CTD_human