FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 32321

FusionGeneSummary for RSU1_ZMYND11

check button Fusion gene summary
Fusion gene informationFusion gene name: RSU1_ZMYND11
Fusion gene ID: 32321
HgeneTgene
Gene symbol

RSU1

ZMYND11

Gene ID

6251

10771

Gene nameRas suppressor protein 1zinc finger MYND-type containing 11
SynonymsRSP-1BRAM1|BS69|MRD30
Cytomap

10p13

10p15.3

Type of geneprotein-codingprotein-coding
Descriptionras suppressor protein 1ras suppressor protein 1 variant 1ras suppressor protein 1 variant 2ras suppressor protein 1 variant 3ras suppressor protein 1 variant 5rsu-1zinc finger MYND domain-containing protein 11adenovirus 5 E1A-binding proteinbone morphogenetic protein receptor-associated molecule 1
Modification date2018052220180522
UniProtAcc

Q15404

Q15326

Ensembl transtripts involved in fusion geneENST00000377921, ENST00000345264, 
ENST00000602389, ENST00000464074, 
ENST00000381602, ENST00000397962, 
ENST00000309776, ENST00000509513, 
ENST00000397959, ENST00000381591, 
ENST00000403354, ENST00000381607, 
ENST00000402736, ENST00000602682, 
ENST00000381604, ENST00000381584, 
ENST00000558098, ENST00000545619, 
ENST00000535374, ENST00000473115, 
Fusion gene scores* DoF score6 X 4 X 6=1446 X 5 X 6=180
# samples 67
** MAII scorelog2(6/144*10)=-1.26303440583379
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(7/180*10)=-1.36257007938471
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: RSU1 [Title/Abstract] AND ZMYND11 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneZMYND11

GO:0051607

defense response to virus

26845565


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDPRADTCGA-G9-7525-01ARSU1chr10

16824033

-ZMYND11chr10

294276

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000377921ENST00000381602RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000397962RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000309776RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000509513RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000397959RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000381591RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000403354RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000381607RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000402736RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000602682RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000381604RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000381584RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000558098RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000545619RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000377921ENST00000535374RSU1chr10

16824033

-ZMYND11chr10

294276

+
5CDS-3UTRENST00000377921ENST00000473115RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000381602RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000397962RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000309776RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000509513RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000397959RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000381591RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000403354RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000381607RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000402736RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000602682RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000381604RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000381584RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000558098RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000545619RSU1chr10

16824033

-ZMYND11chr10

294276

+
Frame-shitENST00000345264ENST00000535374RSU1chr10

16824033

-ZMYND11chr10

294276

+
5CDS-3UTRENST00000345264ENST00000473115RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000381602RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000397962RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000309776RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000509513RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000397959RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000381591RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000403354RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000381607RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000402736RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000602682RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000381604RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000381584RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000558098RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000545619RSU1chr10

16824033

-ZMYND11chr10

294276

+
In-frameENST00000602389ENST00000535374RSU1chr10

16824033

-ZMYND11chr10

294276

+
5CDS-3UTRENST00000602389ENST00000473115RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000381602RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000397962RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000309776RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000509513RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000397959RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000381591RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000403354RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000381607RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000402736RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000602682RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000381604RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000381584RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000558098RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000545619RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3CDSENST00000464074ENST00000535374RSU1chr10

16824033

-ZMYND11chr10

294276

+
intron-3UTRENST00000464074ENST00000473115RSU1chr10

16824033

-ZMYND11chr10

294276

+

Top

FusionProtFeatures for RSU1_ZMYND11


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
RSU1

Q15404

ZMYND11

Q15326

Potentially plays a role in the Ras signal transductionpathway. Capable of suppressing v-Ras transformation in vitro.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for RSU1_ZMYND11


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381602_chr10_294276_+_160aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397962_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000309776_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000509513_chr10_294276_+_160aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397959_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381591_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000403354_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381607_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000402736_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000602682_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381604_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381584_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000558098_chr10_294276_+_160aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000545619_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000535374_chr10_294276_+_194aa
RTRA_NRSSKF_PGNTHDASAHRKSLRVNSDKEVKCLFTKNAASEHPDHKRRRVSEHVP_QIHQDLQ_LQRPDEVGPQAGDRACCPRSSG
EAAF_NGRRKETSCK_SCSQHAG_DGQKM_ASKGKV_GRICRRNQEAGNTAQATDFSDQEEAVVLQL_GGGHVPLLLEHILLLHQVPAGA


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381602_chr10_294276_+_481nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397962_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000309776_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000509513_chr10_294276_+_481nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397959_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381591_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000403354_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381607_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000402736_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000602682_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381604_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381584_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000558098_chr10_294276_+_481nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000545619_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000535374_chr10_294276_+_583nt
AGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCGTGTCAACTCA
GACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCATGTGCCATGA
CAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAGAAGCTCTGGA
GAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACAGAAAATGTAA
GCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTCAGACCAAGAA
GAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCCAGCAGGAGCA


* Fusion transcript sequences (Full-length transcript).
>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381602_chr10_294276_+_821nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGGTAAATACCAGTCTTTTTTAGACCCTTATTTCTGAAAATGTACCACAGGTATGATGCCCGTTAATTCAGA
AGGTAGCTGTGGCACATGCAGAAGATGTTTCTGAAATAAGATCAAATGTGAAATGGTCAGCTTTAGTTTTAAAAATTTTATTAAAAGTCC

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397962_chr10_294276_+_2929nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT
GTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTATCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTT
CCCTTCCCTTCCCACATATCATCTCACTGCCTATTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTA
AGTTTCACAGAAGCCGTTATGTTTGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGT
TAATTTTCTTGTATTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGA
TCGATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATCTCACAAT
TTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGTTAGAGAATAATTTGTAC
ATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAGGAGAAAAGCCTTTTAAAAAGTATTCTC
CAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAAATATCATCCATCTAATCTTGATGCTGTTGCAGATGGT
GGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACAATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCT
AAATTATGCAGTAACTTGGCATCATCGTTCCCTCCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGT
CAGAACCGAGAACACTTAACCTTCTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATAT
TTTTGGTGTAAAATCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTG
TTGACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTGGCCTGGT
TTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATAAAGCTATATCGAGGTGT
TGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTCTGGCATTTTGTAAGCTGCTCTGACTAG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000309776_chr10_294276_+_2929nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT
GTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTATCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTT
CCCTTCCCTTCCCACATATCATCTCACTGCCTATTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTA
AGTTTCACAGAAGCCGTTATGTTTGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGT
TAATTTTCTTGTATTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGA
TCGATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATCTCACAAT
TTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGTTAGAGAATAATTTGTAC
ATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAGGAGAAAAGCCTTTTAAAAAGTATTCTC
CAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAAATATCATCCATCTAATCTTGATGCTGTTGCAGATGGT
GGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACAATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCT
AAATTATGCAGTAACTTGGCATCATCGTTCCCTCCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGT
CAGAACCGAGAACACTTAACCTTCTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATAT
TTTTGGTGTAAAATCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTG
TTGACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTGGCCTGGT
TTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATAAAGCTATATCGAGGTGT
TGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTCTGGCATTTTGTAAGCTGCTCTGACTAG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000509513_chr10_294276_+_823nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGGTAAATACCAGTCTTTTTTAGACCCTTATTTCTGAAAATGTACCACAGGTATGATGCCCGTTAATTCAGA
AGGTAGCTGTGGCACATGCAGAAGATGTTTCTGAAATAAGATCAAATGTGAAATGGTCAGCTTTAGTTTTAAAAATTTTATTAAAAGTCC

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000397959_chr10_294276_+_883nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381591_chr10_294276_+_2940nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT
GTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTATCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTT
CCCTTCCCTTCCCACATATCATCTCACTGCCTATTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTA
AGTTTCACAGAAGCCGTTATGTTTGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGT
TAATTTTCTTGTATTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGA
TCGATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATCTCACAAT
TTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGTTAGAGAATAATTTGTAC
ATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAGGAGAAAAGCCTTTTAAAAAGTATTCTC
CAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAAATATCATCCATCTAATCTTGATGCTGTTGCAGATGGT
GGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACAATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCT
AAATTATGCAGTAACTTGGCATCATCGTTCCCTCCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGT
CAGAACCGAGAACACTTAACCTTCTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATAT
TTTTGGTGTAAAATCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTG
TTGACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTGGCCTGGT
TTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATAAAGCTATATCGAGGTGT
TGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTCTGGCATTTTGTAAGCTGCTCTGACTAG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000403354_chr10_294276_+_773nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381607_chr10_294276_+_2929nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT
GTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTATCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTT
CCCTTCCCTTCCCACATATCATCTCACTGCCTATTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTA
AGTTTCACAGAAGCCGTTATGTTTGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGT
TAATTTTCTTGTATTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGA
TCGATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATCTCACAAT
TTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGTTAGAGAATAATTTGTAC
ATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAGGAGAAAAGCCTTTTAAAAAGTATTCTC
CAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAAATATCATCCATCTAATCTTGATGCTGTTGCAGATGGT
GGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACAATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCT
AAATTATGCAGTAACTTGGCATCATCGTTCCCTCCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGT
CAGAACCGAGAACACTTAACCTTCTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATAT
TTTTGGTGTAAAATCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTG
TTGACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTGGCCTGGT
TTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATAAAGCTATATCGAGGTGT
TGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTCTGGCATTTTGTAAGCTGCTCTGACTAG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000402736_chr10_294276_+_2937nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT
GTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTATCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTT
CCCTTCCCTTCCCACATATCATCTCACTGCCTATTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTA
AGTTTCACAGAAGCCGTTATGTTTGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGT
TAATTTTCTTGTATTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGA
TCGATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATCTCACAAT
TTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGTTAGAGAATAATTTGTAC
ATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAGGAGAAAAGCCTTTTAAAAAGTATTCTC
CAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAAATATCATCCATCTAATCTTGATGCTGTTGCAGATGGT
GGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACAATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCT
AAATTATGCAGTAACTTGGCATCATCGTTCCCTCCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGT
CAGAACCGAGAACACTTAACCTTCTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATAT
TTTTGGTGTAAAATCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTG
TTGACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTGGCCTGGT
TTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATAAAGCTATATCGAGGTGT
TGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTCTGGCATTTTGTAAGCTGCTCTGACTAG

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000602682_chr10_294276_+_883nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381604_chr10_294276_+_1532nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000381584_chr10_294276_+_1559nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT
TTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTTTAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGA
AGAAATTTTGCACAGTAGTTTAAATCTTTTGTTAATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTT
TAAATAAATTTTAATTGAGAATTTGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAG
ATCTTTAAAAAACAGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAA
TAAAACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCATTATCTG
TTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTTTTTCTTAAATATTTCCC
AATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATCTTGTAGTTTAAAATTGCAGGGAACTGG
GGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAAGTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTT

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000558098_chr10_294276_+_823nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGGTAAATACCAGTCTTTTTTAGACCCTTATTTCTGAAAATGTACCACAGGTATGATGCCCGTTAATTCAGA
AGGTAGCTGTGGCACATGCAGAAGATGTTTCTGAAATAAGATCAAATGTGAAATGGTCAGCTTTAGTTTTAAAAATTTTATTAAAAGTCC

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000545619_chr10_294276_+_773nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC

>In-frame_RSU1_ENST00000602389_chr10_16824033_-_ZMYND11_ENST00000535374_chr10_294276_+_875nt
GCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTC
TGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAA
CAAGCTAACAAGAACCAGAGCCTGAAACAGAAGCAGTAAGTTCTAGCCAGGAAATACCCACGATGCCTCAGCCCATCGAAAAAGTCTCCG
TGTCAACTCAGACAAAGAAGTTAAGTGCCTCTTCACCAAGAATGCTGCATCGGAGCACCCAGACCACAAACGACGGCGTGTGTCAGAGCA
TGTGCCATGACAAATACACCAAGATCTTCAATGACTTCAAAGACCGGATGAAGTCGGACCACAAGCGGGAGACAGAGCGTGTTGTCCGAG
AAGCTCTGGAGAAGCTGCGTTCTGAAATGGAAGAAGAAAAGAGACAAGCTGTAAATAAAGCTGTAGCCAACATGCAGGGTGAGATGGACA
GAAAATGTAAGCAAGTAAAGGAAAAGTGTAAGGAAGAATTTGTAGAAGAAATCAAGAAGCTGGCAACACAGCACAAGCAACTGATTTCTC
AGACCAAGAAGAAGCAGTGGTGCTACAACTGTGAGGAGGAGGCCATGTACCACTGCTGCTGGAACACATCCTACTGCTCCATCAAGTGCC
AGCAGGAGCACTGGCACGCGGAGCACAAGCGCACCTGCCGCCGGAAAAGATGAAGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCT


Top

FusionGenePPI for RSU1_ZMYND11


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
RSU1ACP6, ILK, HGS, GSK3B, ELAVL1, LRRK1, APP, VCP, FN1, LRCH3, FAM114A1, PARVA, PPAT, SEC24D, SUGT1, LIMS1, PARVB, PARVG, CBS, HNRNPA3, NDUFA8, NTMT1, PFKP, DAZAP1, DHX15, FLNB, HADH, USP3, TIAL1, TKTZMYND11C11orf30, ETS2, ZHX1, NCOR1, BMPR1A, TAB1, MYB, SMARCA2, HDAC1, EZH2, EZH1, E2F6, TP53, EP400, PDLIM7, TRAF6, HOXD4, ELAVL1, LTBR, ZMYND11, PIAS1, UBE2I, TRAF1, TRAF2, TRAF3, TRAF5, SMAD2, TRADD, SMAD3, SRPK1, MAGEC2, H3F3A, HIST3H3, PRPF8, SRRM2, SNRNP200, SRRM1, PNN, SRSF4, SRSF1, PABPC1, EFTUD2, SAP18, PPIG, MAGOHB, SRSF10, RNU4-1, RNU5A-1, RNU6-1, CDK2, GBA, RPL10


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for RSU1_ZMYND11


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for RSU1_ZMYND11


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneRSU1C0029456Osteoporosis1CTD_human
HgeneRSU1C0263454Chloracne1CTD_human
TgeneZMYND11C0004352Autistic Disorder1CTD_human