FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 31290

FusionGeneSummary for RIT1_NNMT

check button Fusion gene summary
Fusion gene informationFusion gene name: RIT1_NNMT
Fusion gene ID: 31290
HgeneTgene
Gene symbol

RIT1

NNMT

Gene ID

64919

4837

Gene nameB cell CLL/lymphoma 11Bnicotinamide N-methyltransferase
SynonymsATL1|ATL1-alpha|ATL1-beta|ATL1-delta|ATL1-gamma|CTIP-2|CTIP2|IMD49|RIT1|ZNF856B|hRIT1-alpha-
Cytomap

14q32.2

11q23.2

Type of geneprotein-codingprotein-coding
DescriptionB-cell lymphoma/leukemia 11BB-cell CLL/lymphoma 11B (zinc finger protein)B-cell CLL/lymphoma 11B/T-cell receptor delta constant region fusion proteinB-cell lymphoma/leukaemia 11BBCL-11BBCL11B/TRDC fusionCOUP-TF-interacting protein 2hRit1radiation-nicotinamide N-methyltransferase
Modification date2018052320180523
UniProtAcc

Q92963

P40261

Ensembl transtripts involved in fusion geneENST00000368323, ENST00000539040, 
ENST00000368322, 
ENST00000535401, 
ENST00000535185, ENST00000299964, 
ENST00000541754, ENST00000542647, 
ENST00000545255, 
Fusion gene scores* DoF score4 X 3 X 4=484 X 4 X 3=48
# samples 44
** MAII scorelog2(4/48*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(4/48*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: RIT1 [Title/Abstract] AND NNMT [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDSARCTCGA-HB-A5W3-01ARIT1chr1

155874102

-NNMTchr11

114182767

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000368323ENST00000535401RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000368323ENST00000535185RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000368323ENST00000299964RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368323ENST00000541754RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368323ENST00000542647RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368323ENST00000545255RIT1chr1

155874102

-NNMTchr11

114182767

+
In-frameENST00000539040ENST00000535401RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000539040ENST00000535185RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000539040ENST00000299964RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000539040ENST00000541754RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000539040ENST00000542647RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000539040ENST00000545255RIT1chr1

155874102

-NNMTchr11

114182767

+
Frame-shitENST00000368322ENST00000535401RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000368322ENST00000535185RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-intronENST00000368322ENST00000299964RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368322ENST00000541754RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368322ENST00000542647RIT1chr1

155874102

-NNMTchr11

114182767

+
5CDS-5UTRENST00000368322ENST00000545255RIT1chr1

155874102

-NNMTchr11

114182767

+

Top

FusionProtFeatures for RIT1_NNMT


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
RIT1

Q92963

NNMT

P40261

Plays a crucial role in coupling NGF stimulation to theactivation of both EPHB2 and MAPK14 signaling pathways and in NGF-dependent neuronal differentiation. Involved in ELK1transactivation through the Ras-MAPK signaling cascade thatmediates a wide variety of cellular functions, including cellproliferation, survival, and differentiation.{ECO:0000269|PubMed:15632082, ECO:0000269|PubMed:23791108}. Catalyzes the N-methylation of nicotinamide and otherpyridines to form pyridinium ions. This activity is important forbiotransformation of many drugs and xenobiotic compounds.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for RIT1_NNMT


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_RIT1_ENST00000539040_chr1_155874102_-_NNMT_ENST00000535401_chr11_114182767_+_144aa
SQGSREGGEVETGGQAGAEV_CDSEPATGGRPLTPG_LRAQHTVSGCRLPRPPHLLQGAQEPRQPTEARGLPGDHGCAQEQLLHDW_AEV


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_RIT1_ENST00000539040_chr1_155874102_-_NNMT_ENST00000535401_chr11_114182767_+_433nt
AGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGACAGGCGGTCAAGCAGGTGCTGAAGTGTGATGTGACTCAGAGCCAGCCACTGGGGGC
CGTCCCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTGCCCAGACCTCCCCACCTACTGCAGGGCGCTCAG
GAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTCCTGGTGATCATGGATGCGCTCAAGAGCAGCTACTACATGATTGGTGAGCAGAAGTT
CTCCAGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTACACAATCGAATGGTTTGAGGTGATCTCGCAAAG


* Fusion transcript sequences (Full-length transcript).
>In-frame_RIT1_ENST00000539040_chr1_155874102_-_NNMT_ENST00000535401_chr11_114182767_+_1724nt
GACTCGGGCGCCGGTGGCGCCATCTTACTCGGTTGCGGGAGGGGTCACAGGTCAGTGCCGGAGCCTCCGCGAGTGAAGGAAGACGAAGTG
CGTGACCCGACCGGCTGTGGTGTTCCAGTCCCCACTGACCAGTAGGAGCAGCAGGGCGTCGGCTTGTGAGCCATGACCATGCAGTTCATC
AGCCACCGATTCCCAGAAGATCATGATCCCACCATTGAAGATGCTTATAAGATCAGGATCCGTATTGATGATGAGCCTGCCAATCTGGAC
ATTTTGGATACAGCTGGACAGGCAGAGTTTACAGCCATGCGGGACCAGTATATGAGGGCAGGAGAAGGGTTTATCATCTGTTACTCTATC
ACGGATCGTCGAAGTTTCCATGAAGTTCGTGAGTTTAAACAGCTTATTTATCGAGTCCGACGTACTGACGATACACCTGTGGTTCTTGTG
GGAAACAAGTCAGACCTCAAACAGCTAAGACAGAGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGACAGGCGGTCAAGCAGGTGCTGAA
GTGTGATGTGACTCAGAGCCAGCCACTGGGGGCCGTCCCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTG
CCCAGACCTCCCCACCTACTGCAGGGCGCTCAGGAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTCCTGGTGATCATGGATGCGCTCAA
GAGCAGCTACTACATGATTGGTGAGCAGAAGTTCTCCAGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTA
CACAATCGAATGGTTTGAGGTGATCTCGCAAAGTTATTCTTCCACCATGGCCAACAACGAAGGACTTTTCTCCCTGGTGGCGAGGAAGCT
GAGCAGACCCCTGTGATGCCTGTGACCTCAATTAAAGCAATTCCTTTGACCTGTCCAGTTGACTTTAGTCCTTGTTTCTAACTGCCAAGT
CATGTGCTGAGTAGAGGCTCAGTGGTTGGGGCCCAATGGTTCATCTAGGACGGGACTAGAGAGGTCAGTCTACAAGCAATCCATTGACCA
CTTACTTGGTGCTGCACACAAATGTTGGTGCTATGGGACCCAAAGATGAGCAATTAGTATTCCAGTCTTCATTGCCTGTGCTTACAAAAG
AAGACCTCACTTCCCTAAACATCTAGTTATGGCGGCTCAAGCCCGTACCTGCCTACAGAGAAGTGTCTGCAGTTACTCACTATTAGTTTC
CTAAGGGGGCACTGCTGGCTCCTTCTCTCCCAGGAATGGGCTTCTCCTATTCTTTAACTCTTGCCTTCTCCCTGGAGAGGCTACCAAACC
CTGGCCTCTGCCGCTGTTCAGGCTGCCATGTGGGTATAGCTGTTTGCTAGACTCCACTCTGGCCTCAGGGGCCAGAGAACAGCTGTCCAG
CATTTCTGTTCATCCCAGCAATCCAAAAAAAAATTTTTTTAAGCTACAAAGATCACTCCATTTTCAAATTCAGACTCTGCCACTTATTAG
CTGTTTCTCATTAGGCAAGTTATATAACCTTGCAGTGCCTCACTTTCCTCATCTATAAAATGAGATTAAAATAGTCTTTTTATTAAGAGA
ATTAAAGTGAATTGTGGCCAGGCACTGTGGCTCATGCCTGTAATCCCAGCGCTTTGGGAGGCTGAGGCAGACAGATTGCTTGAGCTCAGA


Top

FusionGenePPI for RIT1_NNMT


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
RIT1RALGDS, PTN, LRIF1, MLLT4, RLF, VHL, NF2, KLHL12, ASB4, SRPK2, LZTR1, CAMKV, RIT2, MAD2L1BPNNMTAPP, ATF6, BMF, GLOD4, ADK, CRYZ, CDC73


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for RIT1_NNMT


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
TgeneNNMTP40261DB00627NiacinNicotinamide N-methyltransferasesmall moleculeapproved|investigational|nutraceutical

Top

RelatedDiseases for RIT1_NNMT


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneRIT1C3809233NOONAN SYNDROME 82UNIPROT
HgeneRIT1C0023893Liver Cirrhosis, Experimental1CTD_human
TgeneNNMTC0036341Schizophrenia2PSYGENET
TgeneNNMTC0005586Bipolar Disorder1PSYGENET