FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 29026

FusionGeneSummary for PRUNE2_MYH11

check button Fusion gene summary
Fusion gene informationFusion gene name: PRUNE2_MYH11
Fusion gene ID: 29026
HgeneTgene
Gene symbol

PRUNE2

MYH11

Gene ID

158471

4629

Gene nameprune homolog 2myosin heavy chain 11
SynonymsBMCC1|BNIPXL|C9orf65|KIAA0367AAT4|FAA4|SMHC|SMMHC
Cytomap

9q21.2

16p13.11

Type of geneprotein-codingprotein-coding
Descriptionprotein prune homolog 2BCH motif-containing molecule at the carboxyl terminal region 1BNIP2 motif containing molecule at the carboxyl terminal region 1BNIP2 motif-containing molecule at the C-terminal region 1olfaxintruncated PRUNE2myosin-11myosin heavy chain, smooth muscle isoformmyosin, heavy chain 11, smooth musclemyosin, heavy polypeptide 11, smooth muscle
Modification date2018052320180519
UniProtAcc

Q8WUY3

P35749

Ensembl transtripts involved in fusion geneENST00000466266, ENST00000428286, 
ENST00000376718, ENST00000443509, 
ENST00000223609, ENST00000376713, 
ENST00000396324, ENST00000452625, 
ENST00000576790, ENST00000300036, 
ENST00000573908, 
Fusion gene scores* DoF score6 X 5 X 5=15011 X 15 X 6=990
# samples 721
** MAII scorelog2(7/150*10)=-1.09953567355091
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(21/990*10)=-2.23703919730085
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: PRUNE2 [Title/Abstract] AND MYH11 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDSARCTCGA-3B-A9HR-01APRUNE2chr9

79520844

-MYH11chr16

15797980

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
intron-3CDSENST00000466266ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000466266ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000466266ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000466266ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-5UTRENST00000466266ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5UTR-3CDSENST00000428286ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5UTR-3UTRENST00000428286ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5UTR-3UTRENST00000428286ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5UTR-3UTRENST00000428286ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5UTR-5UTRENST00000428286ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-
In-frameENST00000376718ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376718ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376718ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376718ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-5UTRENST00000376718ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3CDSENST00000443509ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000443509ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000443509ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000443509ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-5UTRENST00000443509ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3CDSENST00000223609ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000223609ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000223609ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-3UTRENST00000223609ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
intron-5UTRENST00000223609ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-
In-frameENST00000376713ENST00000396324PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376713ENST00000452625PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376713ENST00000576790PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-3UTRENST00000376713ENST00000300036PRUNE2chr9

79520844

-MYH11chr16

15797980

-
5CDS-5UTRENST00000376713ENST00000573908PRUNE2chr9

79520844

-MYH11chr16

15797980

-

Top

FusionProtFeatures for PRUNE2_MYH11


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
PRUNE2

Q8WUY3

MYH11

P35749

Muscle contraction.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for PRUNE2_MYH11


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_PRUNE2_ENST00000376718_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_56aa

>In-frame_PRUNE2_ENST00000376713_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_56aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_PRUNE2_ENST00000376718_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_169nt
ATGGAAGAATTTTTGCAACGCGCCAAATCTAAACTGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGT

>In-frame_PRUNE2_ENST00000376713_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_169nt
ATGGAAGAATTTTTGCAACGCGCCAAATCTAAACTGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGT


* Fusion transcript sequences (Full-length transcript).
>In-frame_PRUNE2_ENST00000376718_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_1112nt
GGAGGGAGCAGTCGGTCGCTGCGCCCCGGCGGGCCACTTTCCCGGGACCCCGCTCGTCTTCCTTGGGCCGAGATTTTCCACTGCGCCCCT
CCGAGTACCCGGGTTCCAAACCCCTAGCCACGACATGGAAGAATTTTTGCAACGCGCCAAATCTAAACTGGCGAGGAAACGAGACCTCTT
TCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCA
ATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACC
CAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCC
TCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGT
GGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGAACGCTCCAGCCCAGGACTTCGAGGCTGCAATGAGCTATAA
TTGCATCATTGCACTCCAGCCTGGGCAACAGAGACCCTGTCTCAACCACCACCACCACCACCACCCCTACTACCCCTGTATTCAAGGTAA
AAATTGAAGTTTGTATGATGTAAGAGATGAGAAAAACCCAACAGGAAACACAGACACATCCTCCAGTTCTATCAATGGATTGTGCAGACA
CTGAGTTTTTAGAAAAACATATCCACGGTAACCGGTCCCTGGCAATTCTGTTTACATGAAATGGGGAGAAAGTCACCGAAATGGGTGCCG
CCGGCCCCCACTCCCAATTCATTCCCTAACCTGCAAACCTTTCCAACTTCTCACGTCAGGCCTTTGAGAATTCTTTCCCCCTCTCCTGGT
TTCCACACCTCAGACACGCACAGTTCACCAAGTGCCTTCTGTAGTCACATGAATTGAAAAGGAGACGCTGCTCCCACGGAGGGGAGCAGG

>In-frame_PRUNE2_ENST00000376713_chr9_79520844_-_MYH11_ENST00000396324_chr16_15797980_-_1110nt
AGGGAGCAGTCGGTCGCTGCGCCCCGGCGGGCCACTTTCCCGGGACCCCGCTCGTCTTCCTTGGGCCGAGATTTTCCACTGCGCCCCTCC
GAGTACCCGGGTTCCAAACCCCTAGCCACGACATGGAAGAATTTTTGCAACGCGCCAAATCTAAACTGGCGAGGAAACGAGACCTCTTTC
GTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAAT
GGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCA
ACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTC
ACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGG
TGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGAACGCTCCAGCCCAGGACTTCGAGGCTGCAATGAGCTATAATT
GCATCATTGCACTCCAGCCTGGGCAACAGAGACCCTGTCTCAACCACCACCACCACCACCACCCCTACTACCCCTGTATTCAAGGTAAAA
ATTGAAGTTTGTATGATGTAAGAGATGAGAAAAACCCAACAGGAAACACAGACACATCCTCCAGTTCTATCAATGGATTGTGCAGACACT
GAGTTTTTAGAAAAACATATCCACGGTAACCGGTCCCTGGCAATTCTGTTTACATGAAATGGGGAGAAAGTCACCGAAATGGGTGCCGCC
GGCCCCCACTCCCAATTCATTCCCTAACCTGCAAACCTTTCCAACTTCTCACGTCAGGCCTTTGAGAATTCTTTCCCCCTCTCCTGGTTT
CCACACCTCAGACACGCACAGTTCACCAAGTGCCTTCTGTAGTCACATGAATTGAAAAGGAGACGCTGCTCCCACGGAGGGGAGCAGGAA


Top

FusionGenePPI for PRUNE2_MYH11


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
PRUNE2EWSR1, RCN3, LYN, DYNC1H1, DYNC1I2, DYNC1LI2, EIF2A, EIF3K, RPSA, RPS24, RPS26, RPS5, ZMYM1, FYN, SRC, YES1MYH11SLX1B, GRB2, DAXX, APC, YWHAQ, SP1, FBXO25, MYOC, SHC1, ACTA2, ACTB, DSTN, MYO1E, EIF3A, RPA1, RPA2, RPA3, LGR4, FAM96A, OVCA2, RWDD2B, MYO5A, SFN, C4BPA, CAPZB, FLNA, MYL6, RAD51, SVIL, YWHAE, ARPC5, ACTR3, RALBP1, POC1A, ASTE1, MED4, LRRC59, CGN, INF2, ARPC5L, TBC1D31, UBXN2A, PLBD2, TMEM189, ZNF746, MPP1, GDF9, COQ2, COX15, DLST, DNM1L, PARK7, PDHA1, SOAT1, SOD1, VDAC1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for PRUNE2_MYH11


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for PRUNE2_MYH11


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgenePRUNE2C0023893Liver Cirrhosis, Experimental1CTD_human
TgeneMYH11C0023467Leukemia, Myelocytic, Acute2CTD_human
TgeneMYH11C0023479Acute myelomonocytic leukemia1CTD_human;ORPHANET
TgeneMYH11C1851504Aortic aneurysm, familial thoracic 41CTD_human;UNIPROT