FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 28577

FusionGeneSummary for PRAME_HDLBP

check button Fusion gene summary
Fusion gene informationFusion gene name: PRAME_HDLBP
Fusion gene ID: 28577
HgeneTgene
Gene symbol

PRAME

HDLBP

Gene ID

23532

3069

Gene namepreferentially expressed antigen in melanomahigh density lipoprotein binding protein
SynonymsCT130|MAPE|OIP-4|OIP4HBP|PRO2900|VGL
Cytomap

22q11.22

2q37.3

Type of geneprotein-codingprotein-coding
Descriptionmelanoma antigen preferentially expressed in tumorsOpa-interacting protein OIP4cancer/testis antigen 130opa-interacting protein 4preferentially expressed antigen of melanomavigilinHDL-binding protein
Modification date2018051920180522
UniProtAcc

P78395

Q00341

Ensembl transtripts involved in fusion geneENST00000398743, ENST00000398741, 
ENST00000543184, ENST00000405655, 
ENST00000539862, ENST00000402697, 
ENST00000424204, ENST00000485532, 
ENST00000406503, 
ENST00000391976, 
ENST00000310931, ENST00000391975, 
ENST00000427183, ENST00000476807, 
Fusion gene scores* DoF score2 X 2 X 1=415 X 14 X 6=1260
# samples 216
** MAII scorelog2(2/4*10)=2.32192809488736log2(16/1260*10)=-2.97727992349992
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: PRAME [Title/Abstract] AND HDLBP [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgenePRAME

GO:0008284

positive regulation of cell proliferation

16179254

HgenePRAME

GO:0043066

negative regulation of apoptotic process

16179254

HgenePRAME

GO:0045596

negative regulation of cell differentiation

16179254

HgenePRAME

GO:0045892

negative regulation of transcription, DNA-templated

16179254

HgenePRAME

GO:0048387

negative regulation of retinoic acid receptor signaling pathway

16179254


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVSKCMTCGA-EB-A3Y6-01APRAMEchr22

22890128

-HDLBPchr2

242202277

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000398743ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000398743ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000398743ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000398743ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
5CDS-intronENST00000398743ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
In-frameENST00000398741ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
In-frameENST00000398741ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
In-frameENST00000398741ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
In-frameENST00000398741ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
5CDS-intronENST00000398741ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000543184ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000543184ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000543184ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000543184ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
5CDS-intronENST00000543184ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000405655ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000405655ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000405655ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000405655ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
5CDS-intronENST00000405655ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000539862ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000539862ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000539862ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
Frame-shitENST00000539862ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
5CDS-intronENST00000539862ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000402697ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000402697ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000402697ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000402697ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-intronENST00000402697ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000424204ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000424204ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000424204ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000424204ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-intronENST00000424204ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000485532ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000485532ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000485532ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000485532ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-intronENST00000485532ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000406503ENST00000391976PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000406503ENST00000310931PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000406503ENST00000391975PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-3CDSENST00000406503ENST00000427183PRAMEchr22

22890128

-HDLBPchr2

242202277

-
intron-intronENST00000406503ENST00000476807PRAMEchr22

22890128

-HDLBPchr2

242202277

-

Top

FusionProtFeatures for PRAME_HDLBP


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
PRAME

P78395

HDLBP

Q00341

Functions as a transcriptional repressor, inhibiting thesignaling of retinoic acid through the retinoic acid receptorsRARA, RARB and RARG. Prevents retinoic acid-induced cellproliferation arrest, differentiation and apoptosis.{ECO:0000269|PubMed:16179254}. Appears to play a role in cell sterol metabolism. It mayfunction to protect cells from over-accumulation of cholesterol.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for PRAME_HDLBP


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391976_chr2_242202277_-_0aa

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000310931_chr2_242202277_-_0aa

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391975_chr2_242202277_-_0aa

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000427183_chr2_242202277_-_0aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391976_chr2_242202277_-_0nt

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000310931_chr2_242202277_-_0nt

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391975_chr2_242202277_-_0nt

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000427183_chr2_242202277_-_0nt


* Fusion transcript sequences (Full-length transcript).
>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391976_chr2_242202277_-_5801nt
AATGTAGGGAAAGCAGGGCGGAGTCCTCTGCAGGCTCGGGGGAGGGGAGGGGCGTGAATGCGTGGATTTCTGTGGAGAGTGGAAACACGG
GGAGTCGAGGGGAGCATGCGCGGGCCTCAGAAAGTTTTGGGAAACCGACTCCTGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAACTTC
GCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGATTATTACTCTCAGACGTGCGTGGCAACAAGTGACTGAGACCTAGAAATCCAAG
CGTTGGAGGTCCTGAGGCCAGCCTAAGTCGCTTCAAAATGGAACGAAGGCGTTTGTGGGGTTCCATTCAGAGCCGATACATCAGCATGAG
TGTGTGGACAAGCCCACGGAGACTTGTGGAGCTGGCAGGGCAGAGCCTGCTGAAGGATGAGGCCCTGGCCATTGCCGCCCTGGAGTTGCT
GCCCAGGGAGCTCTTCCCGCCACTCTTCATGGCAGCCTTTGACGGGAGACACAGCCAGACCCTGAAGGCAATGGTGCAGGCCTGGCCCTT
CACCTGCCTCCCTCTGGGAGTGCTGATGAAGGGACAACATCTTCACCTGGAGACCTTCAAAGCTGTGCTTGATGGACTTGATGTGCTCCT
TGCCCAGGAGGTTCGCCCCAGGAGGTGGAAACTTCAAGTGCTGGATTTACGGAAGAACTCTCATCAGGACTTCTGGACTGTATGGTCTGG
AAACAGGGCCAGTCTGTACTCATTTCCAGAGCCAGAAGCAGCTCAGCCCATGACAAAGAAGCGAAAAGTAGATGGTTTGAGCACAGAGGC
AGAGCAGCCCTTCATTCCAGTAGAGGTGCTCGTAGACCTGTTCCTCAAGGAAGGTGCCTGTGATGAATTGTTCTCCTACCTCATTGAGAA
AGTGAAGCGAAAGAAAAATGTACTACGCCTGTGCTGTAAGAAGCTGAAGATTTTTGCAATGCCCATGCAGGATATCAAGATGATCCTGAA
AATGGTGCAGCTGGACTCTATTGAAGATTTGGAAGTGACTTGTACCTGGAAGCTACCCACCTTGGCGAAATTTTCTCCTTACCTGGGCCA
GATGATTAATCTGCGTAGACTCCTCCTCTCCCACATCCATGCATCTTCCTACATTTCCCCGGAGAAGGAAGAGCAGTATATCGCCCAGTT
CACCTCTCAGTTCCTCAGTCTGCAGTGCCTGCAGGCTCTCTATGTGGACTCTTTATTTTTCCTTAGAGGCCGCCTGGATCAGTTGCTCAG
GCACGTGATGAACCCCTTGGAAACCCTCTCAATAACTAACTGCCGGCTTTCGGAAGGGGATGTGATGCATCTGTCCCAGAGTCCCAGCGT
CAGTCAGCTAAGTGTCCTGAGTCTAAGTGGGGTCATGCTGACCGATGTAAGTCCCGAGCCCCTCCAAGCTCTGCTGGAGAGAGCCTCTGC
CACCCTCCAGGACCTGGTCTTTGATGAGTGTGGGATCACGGATGATCAGCTCCTTGCCCTCCTGCCTTCCCTGAGCCACTGCTCCCAGCT
TACAACCTTAAGCTTCTACGGGAATTCCATCTCCATATCTGCCTTGCAGAGTCTCCTGCAGCACCTCATCGGGCTGAGCAATCTGACCCA
CGTGCTGTATCCTGTCCCCCTGGAGAGTTATGAGGACATCCATGGTACCCTCCACCTGGAGAGGCTTGCCTATCTGCATGCCAGGCTCAG
GGAGTTGCTGTGTGAGTTGGGGCGGCCCAGCATGGTCTGGCTTAGTGCCAACCCCTGTCCTCACTGTGGGGACAGAACCTTCTATGACCC
GGAGCCCATCCTGTGCCCCTGTTTCATGCCTAACTAGCTGGGTGCACATATCAAATGCTTCATTCTGCATACTTGGACACTAAAGCCAGG
ATGTGCATGCATCTTGAAGCAACAAAGCAGCCACAGTTTCAGACAAATGTTCAGTGTGAGTGAGGAAAACATGTTCAGTGAGGAAAAAAC
ATTCAGACAAATGTTCAGTGAGGAAAAAAAGGGGAAGTTGGGGATAGGCAGATGTTGACTTGAGGAGTTAATGTGATCTTTGGGGAGATA
CATCTTATAGAGTTAGAAATAGAATCTGAATTTCTAAAGGGAGATTCTGGCTTGGGAAGTACATGTAGGAGTTAATCCCTGTGTAGACTG
TTGTAAAGAAACTGTTGAAAATAAAGAGAAGCAATGTGAAGCGTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAG
TTTGGAGAAGGTGAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCTTTGGCCAAAGACCAAGGC
CTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAAGCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAGGCCTCAGCAACT
GTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGAGAGAAACTGCAAGACTTGGAGCTAAAAACTGCAACCAAAATC
CAGATCCCACGCCCAGATGACCCCAGCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCATGAAGTCTTACTC
ATCTCTGCCGAGCAGGACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGGCCGTATAATAGACTG
GTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCCCCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAG
GAACAGTTGGCTCAGGCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAGAAAAAGAAGACTACAACCATTGCAGTGGAAGTGAAGAAA
TCCCAACACAAGTATGTCATTGGGCCCAAGGGCAATTCATTGCAGGAGATCCTTGAGAGAACTGGAGTTTCCGTTGAGATCCCACCCTCA
GACAGCATCTCTGAGACTGTAATACTTCGAGGCGAACCTGAAAAGTTAGGTCAGGCGTTGACTGAAGTCTATGCCAAGGCCAATAGCTTC
ACCGTCTCCTCTGTCGCCGCCCCTTCCTGGCTTCACCGTTTCATCATTGGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATG
CCAAAGGTTCACATCGAGTTCACAGAGGGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGATGTCAATGTGGCCCAGGAACAGATA
GAAGGCATGGTCAAAGATTTGATTAACCGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATTGGGAAGAGC
GGTGCCAACATAAACAGAATCAAAGACCAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGAGCAATTTGATCCGCATCGAG
GGGGACCCACAGGGCGTGCAGCAGGCCAAGCGAGAGCTGCTGGAGCTTGCATCTCGCATGGAAAATGAGCGTACCAAGGATCTAATCATT
GAGCAAAGATTTCATCGCACAATCATTGGGCAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAGGTCATCATTAACTTT
CCAGACCCAGCACAAAAAAGTGACATTGTCCAGCTCAGAGGACCTAAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTG
GCAGATCTGGTGGAAAATAGCTATTCAATTTCTGTTCCGATCTTCAAACAGTTTCACAAGAATATCATTGGGAAAGGAGGCGCAAACATT
AAAAAGATTCGTGAAGAAAGCAACACCAAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACCATTATCATCACAGGCAAGCGAGCC
AACTGCGAAGCTGCCCGGAGCAGGATTCTGTCTATTCAGAAAGACCTGGCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTG
CACAACTCCCTCATTGGCACCAAGGGCCGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTTCCCGTGGAAGGT
TCAGGAAGCGACACCGTTGTTATCAGGGGCCCTTCCTCGGATGTGGAGAAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAGCAA
ACCAAGAGTTTCACTGTTGACATCCGCGCCAAGCCAGAATACCACAAATTCCTCATCGGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGC
GACAGCACTGGAGCACGTGTCATCTTCCCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGGAGGACGCCGTCCGA
GAGGCACAGAAGGAGCTGGAGGCCTTGATCCAAAACCTGGATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCAC
TTCGTCATCCGCAGAGGCCAGGTCTTGCGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTCCCACGCTCTGGCACACAGAGC
GACAAAGTCACCCTCAAGGGCGCCAAGGACTGTGTGGAGGCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTGGAAGCTCAGGTG
ACATTAGAATGTGCTATACCCCAGAAATTCCATCGATCTGTCATGGGCCCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGT
GTTCAAATTAAATTCCCAGACAGAGAGGAGAACGCAGTTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGG
AGAGAGGCTAAAGATTGTGACCCCGGCTCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGAAAGAAAAGTGTGAGGCTGCCAAG
GAAGCTCTGGAGGCATTGGTTCCTGTCACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATTGGGCAGAAAGGAAGTGGG
ATCCGCAAGATGATGGATGAGTTTGAGGTGAACATACATGTCCCGGCACCTGAGCTGCAGTCTGACATCATCGCCATCACGGGCCTCGCT
GCAAATTTGGACCGGGCCAAGGCTGGACTGCTGGAGCGTGTGAAGGAGCTACAGGCCGAGCAGGAGGACCGGGCTTTAAGGAGTTTTAAG
CTGAGTGTCACTGTAGACCCCAAATACCATCCCAAGATTATCGGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTG
AACATCCAGTTTCCTGATAAGGACGATGGGAACCAGCCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGG
GATGCTATACTGAGAATTGTGGGTGAACTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCACCGCGTTCACGCCCGCATCATTGGT
GCCCGCGGCAAAGCCATTCGCAAAATCATGGACGAATTCAAGGTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTC
ACTGTGACGGGGCTCCCAGAGAATGTGGAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATACCTAGCTGACGTGGTGGACAGT
GAGGCGCTGCAGGTATACATGAAACCCCCAGCACACGAAGAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACC
GCCAGCAGCAGTGAGAAGACAGAGATTACTGCAGTTTATGTGACAAGCAGCCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCA

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000310931_chr2_242202277_-_5801nt
AATGTAGGGAAAGCAGGGCGGAGTCCTCTGCAGGCTCGGGGGAGGGGAGGGGCGTGAATGCGTGGATTTCTGTGGAGAGTGGAAACACGG
GGAGTCGAGGGGAGCATGCGCGGGCCTCAGAAAGTTTTGGGAAACCGACTCCTGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAACTTC
GCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGATTATTACTCTCAGACGTGCGTGGCAACAAGTGACTGAGACCTAGAAATCCAAG
CGTTGGAGGTCCTGAGGCCAGCCTAAGTCGCTTCAAAATGGAACGAAGGCGTTTGTGGGGTTCCATTCAGAGCCGATACATCAGCATGAG
TGTGTGGACAAGCCCACGGAGACTTGTGGAGCTGGCAGGGCAGAGCCTGCTGAAGGATGAGGCCCTGGCCATTGCCGCCCTGGAGTTGCT
GCCCAGGGAGCTCTTCCCGCCACTCTTCATGGCAGCCTTTGACGGGAGACACAGCCAGACCCTGAAGGCAATGGTGCAGGCCTGGCCCTT
CACCTGCCTCCCTCTGGGAGTGCTGATGAAGGGACAACATCTTCACCTGGAGACCTTCAAAGCTGTGCTTGATGGACTTGATGTGCTCCT
TGCCCAGGAGGTTCGCCCCAGGAGGTGGAAACTTCAAGTGCTGGATTTACGGAAGAACTCTCATCAGGACTTCTGGACTGTATGGTCTGG
AAACAGGGCCAGTCTGTACTCATTTCCAGAGCCAGAAGCAGCTCAGCCCATGACAAAGAAGCGAAAAGTAGATGGTTTGAGCACAGAGGC
AGAGCAGCCCTTCATTCCAGTAGAGGTGCTCGTAGACCTGTTCCTCAAGGAAGGTGCCTGTGATGAATTGTTCTCCTACCTCATTGAGAA
AGTGAAGCGAAAGAAAAATGTACTACGCCTGTGCTGTAAGAAGCTGAAGATTTTTGCAATGCCCATGCAGGATATCAAGATGATCCTGAA
AATGGTGCAGCTGGACTCTATTGAAGATTTGGAAGTGACTTGTACCTGGAAGCTACCCACCTTGGCGAAATTTTCTCCTTACCTGGGCCA
GATGATTAATCTGCGTAGACTCCTCCTCTCCCACATCCATGCATCTTCCTACATTTCCCCGGAGAAGGAAGAGCAGTATATCGCCCAGTT
CACCTCTCAGTTCCTCAGTCTGCAGTGCCTGCAGGCTCTCTATGTGGACTCTTTATTTTTCCTTAGAGGCCGCCTGGATCAGTTGCTCAG
GCACGTGATGAACCCCTTGGAAACCCTCTCAATAACTAACTGCCGGCTTTCGGAAGGGGATGTGATGCATCTGTCCCAGAGTCCCAGCGT
CAGTCAGCTAAGTGTCCTGAGTCTAAGTGGGGTCATGCTGACCGATGTAAGTCCCGAGCCCCTCCAAGCTCTGCTGGAGAGAGCCTCTGC
CACCCTCCAGGACCTGGTCTTTGATGAGTGTGGGATCACGGATGATCAGCTCCTTGCCCTCCTGCCTTCCCTGAGCCACTGCTCCCAGCT
TACAACCTTAAGCTTCTACGGGAATTCCATCTCCATATCTGCCTTGCAGAGTCTCCTGCAGCACCTCATCGGGCTGAGCAATCTGACCCA
CGTGCTGTATCCTGTCCCCCTGGAGAGTTATGAGGACATCCATGGTACCCTCCACCTGGAGAGGCTTGCCTATCTGCATGCCAGGCTCAG
GGAGTTGCTGTGTGAGTTGGGGCGGCCCAGCATGGTCTGGCTTAGTGCCAACCCCTGTCCTCACTGTGGGGACAGAACCTTCTATGACCC
GGAGCCCATCCTGTGCCCCTGTTTCATGCCTAACTAGCTGGGTGCACATATCAAATGCTTCATTCTGCATACTTGGACACTAAAGCCAGG
ATGTGCATGCATCTTGAAGCAACAAAGCAGCCACAGTTTCAGACAAATGTTCAGTGTGAGTGAGGAAAACATGTTCAGTGAGGAAAAAAC
ATTCAGACAAATGTTCAGTGAGGAAAAAAAGGGGAAGTTGGGGATAGGCAGATGTTGACTTGAGGAGTTAATGTGATCTTTGGGGAGATA
CATCTTATAGAGTTAGAAATAGAATCTGAATTTCTAAAGGGAGATTCTGGCTTGGGAAGTACATGTAGGAGTTAATCCCTGTGTAGACTG
TTGTAAAGAAACTGTTGAAAATAAAGAGAAGCAATGTGAAGCGTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAG
TTTGGAGAAGGTGAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCTTTGGCCAAAGACCAAGGC
CTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAAGCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAGGCCTCAGCAACT
GTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGAGAGAAACTGCAAGACTTGGAGCTAAAAACTGCAACCAAAATC
CAGATCCCACGCCCAGATGACCCCAGCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCATGAAGTCTTACTC
ATCTCTGCCGAGCAGGACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGGCCGTATAATAGACTG
GTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCCCCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAG
GAACAGTTGGCTCAGGCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAGAAAAAGAAGACTACAACCATTGCAGTGGAAGTGAAGAAA
TCCCAACACAAGTATGTCATTGGGCCCAAGGGCAATTCATTGCAGGAGATCCTTGAGAGAACTGGAGTTTCCGTTGAGATCCCACCCTCA
GACAGCATCTCTGAGACTGTAATACTTCGAGGCGAACCTGAAAAGTTAGGTCAGGCGTTGACTGAAGTCTATGCCAAGGCCAATAGCTTC
ACCGTCTCCTCTGTCGCCGCCCCTTCCTGGCTTCACCGTTTCATCATTGGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATG
CCAAAGGTTCACATCGAGTTCACAGAGGGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGATGTCAATGTGGCCCAGGAACAGATA
GAAGGCATGGTCAAAGATTTGATTAACCGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATTGGGAAGAGC
GGTGCCAACATAAACAGAATCAAAGACCAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGAGCAATTTGATCCGCATCGAG
GGGGACCCACAGGGCGTGCAGCAGGCCAAGCGAGAGCTGCTGGAGCTTGCATCTCGCATGGAAAATGAGCGTACCAAGGATCTAATCATT
GAGCAAAGATTTCATCGCACAATCATTGGGCAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAGGTCATCATTAACTTT
CCAGACCCAGCACAAAAAAGTGACATTGTCCAGCTCAGAGGACCTAAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTG
GCAGATCTGGTGGAAAATAGCTATTCAATTTCTGTTCCGATCTTCAAACAGTTTCACAAGAATATCATTGGGAAAGGAGGCGCAAACATT
AAAAAGATTCGTGAAGAAAGCAACACCAAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACCATTATCATCACAGGCAAGCGAGCC
AACTGCGAAGCTGCCCGGAGCAGGATTCTGTCTATTCAGAAAGACCTGGCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTG
CACAACTCCCTCATTGGCACCAAGGGCCGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTTCCCGTGGAAGGT
TCAGGAAGCGACACCGTTGTTATCAGGGGCCCTTCCTCGGATGTGGAGAAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAGCAA
ACCAAGAGTTTCACTGTTGACATCCGCGCCAAGCCAGAATACCACAAATTCCTCATCGGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGC
GACAGCACTGGAGCACGTGTCATCTTCCCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGGAGGACGCCGTCCGA
GAGGCACAGAAGGAGCTGGAGGCCTTGATCCAAAACCTGGATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCAC
TTCGTCATCCGCAGAGGCCAGGTCTTGCGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTCCCACGCTCTGGCACACAGAGC
GACAAAGTCACCCTCAAGGGCGCCAAGGACTGTGTGGAGGCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTGGAAGCTCAGGTG
ACATTAGAATGTGCTATACCCCAGAAATTCCATCGATCTGTCATGGGCCCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGT
GTTCAAATTAAATTCCCAGACAGAGAGGAGAACGCAGTTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGG
AGAGAGGCTAAAGATTGTGACCCCGGCTCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGAAAGAAAAGTGTGAGGCTGCCAAG
GAAGCTCTGGAGGCATTGGTTCCTGTCACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATTGGGCAGAAAGGAAGTGGG
ATCCGCAAGATGATGGATGAGTTTGAGGTGAACATACATGTCCCGGCACCTGAGCTGCAGTCTGACATCATCGCCATCACGGGCCTCGCT
GCAAATTTGGACCGGGCCAAGGCTGGACTGCTGGAGCGTGTGAAGGAGCTACAGGCCGAGCAGGAGGACCGGGCTTTAAGGAGTTTTAAG
CTGAGTGTCACTGTAGACCCCAAATACCATCCCAAGATTATCGGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTG
AACATCCAGTTTCCTGATAAGGACGATGGGAACCAGCCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGG
GATGCTATACTGAGAATTGTGGGTGAACTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCACCGCGTTCACGCCCGCATCATTGGT
GCCCGCGGCAAAGCCATTCGCAAAATCATGGACGAATTCAAGGTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTC
ACTGTGACGGGGCTCCCAGAGAATGTGGAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATACCTAGCTGACGTGGTGGACAGT
GAGGCGCTGCAGGTATACATGAAACCCCCAGCACACGAAGAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACC
GCCAGCAGCAGTGAGAAGACAGAGATTACTGCAGTTTATGTGACAAGCAGCCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCA

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000391975_chr2_242202277_-_5801nt
AATGTAGGGAAAGCAGGGCGGAGTCCTCTGCAGGCTCGGGGGAGGGGAGGGGCGTGAATGCGTGGATTTCTGTGGAGAGTGGAAACACGG
GGAGTCGAGGGGAGCATGCGCGGGCCTCAGAAAGTTTTGGGAAACCGACTCCTGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAACTTC
GCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGATTATTACTCTCAGACGTGCGTGGCAACAAGTGACTGAGACCTAGAAATCCAAG
CGTTGGAGGTCCTGAGGCCAGCCTAAGTCGCTTCAAAATGGAACGAAGGCGTTTGTGGGGTTCCATTCAGAGCCGATACATCAGCATGAG
TGTGTGGACAAGCCCACGGAGACTTGTGGAGCTGGCAGGGCAGAGCCTGCTGAAGGATGAGGCCCTGGCCATTGCCGCCCTGGAGTTGCT
GCCCAGGGAGCTCTTCCCGCCACTCTTCATGGCAGCCTTTGACGGGAGACACAGCCAGACCCTGAAGGCAATGGTGCAGGCCTGGCCCTT
CACCTGCCTCCCTCTGGGAGTGCTGATGAAGGGACAACATCTTCACCTGGAGACCTTCAAAGCTGTGCTTGATGGACTTGATGTGCTCCT
TGCCCAGGAGGTTCGCCCCAGGAGGTGGAAACTTCAAGTGCTGGATTTACGGAAGAACTCTCATCAGGACTTCTGGACTGTATGGTCTGG
AAACAGGGCCAGTCTGTACTCATTTCCAGAGCCAGAAGCAGCTCAGCCCATGACAAAGAAGCGAAAAGTAGATGGTTTGAGCACAGAGGC
AGAGCAGCCCTTCATTCCAGTAGAGGTGCTCGTAGACCTGTTCCTCAAGGAAGGTGCCTGTGATGAATTGTTCTCCTACCTCATTGAGAA
AGTGAAGCGAAAGAAAAATGTACTACGCCTGTGCTGTAAGAAGCTGAAGATTTTTGCAATGCCCATGCAGGATATCAAGATGATCCTGAA
AATGGTGCAGCTGGACTCTATTGAAGATTTGGAAGTGACTTGTACCTGGAAGCTACCCACCTTGGCGAAATTTTCTCCTTACCTGGGCCA
GATGATTAATCTGCGTAGACTCCTCCTCTCCCACATCCATGCATCTTCCTACATTTCCCCGGAGAAGGAAGAGCAGTATATCGCCCAGTT
CACCTCTCAGTTCCTCAGTCTGCAGTGCCTGCAGGCTCTCTATGTGGACTCTTTATTTTTCCTTAGAGGCCGCCTGGATCAGTTGCTCAG
GCACGTGATGAACCCCTTGGAAACCCTCTCAATAACTAACTGCCGGCTTTCGGAAGGGGATGTGATGCATCTGTCCCAGAGTCCCAGCGT
CAGTCAGCTAAGTGTCCTGAGTCTAAGTGGGGTCATGCTGACCGATGTAAGTCCCGAGCCCCTCCAAGCTCTGCTGGAGAGAGCCTCTGC
CACCCTCCAGGACCTGGTCTTTGATGAGTGTGGGATCACGGATGATCAGCTCCTTGCCCTCCTGCCTTCCCTGAGCCACTGCTCCCAGCT
TACAACCTTAAGCTTCTACGGGAATTCCATCTCCATATCTGCCTTGCAGAGTCTCCTGCAGCACCTCATCGGGCTGAGCAATCTGACCCA
CGTGCTGTATCCTGTCCCCCTGGAGAGTTATGAGGACATCCATGGTACCCTCCACCTGGAGAGGCTTGCCTATCTGCATGCCAGGCTCAG
GGAGTTGCTGTGTGAGTTGGGGCGGCCCAGCATGGTCTGGCTTAGTGCCAACCCCTGTCCTCACTGTGGGGACAGAACCTTCTATGACCC
GGAGCCCATCCTGTGCCCCTGTTTCATGCCTAACTAGCTGGGTGCACATATCAAATGCTTCATTCTGCATACTTGGACACTAAAGCCAGG
ATGTGCATGCATCTTGAAGCAACAAAGCAGCCACAGTTTCAGACAAATGTTCAGTGTGAGTGAGGAAAACATGTTCAGTGAGGAAAAAAC
ATTCAGACAAATGTTCAGTGAGGAAAAAAAGGGGAAGTTGGGGATAGGCAGATGTTGACTTGAGGAGTTAATGTGATCTTTGGGGAGATA
CATCTTATAGAGTTAGAAATAGAATCTGAATTTCTAAAGGGAGATTCTGGCTTGGGAAGTACATGTAGGAGTTAATCCCTGTGTAGACTG
TTGTAAAGAAACTGTTGAAAATAAAGAGAAGCAATGTGAAGCGTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAG
TTTGGAGAAGGTGAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCTTTGGCCAAAGACCAAGGC
CTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAAGCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAGGCCTCAGCAACT
GTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGAGAGAAACTGCAAGACTTGGAGCTAAAAACTGCAACCAAAATC
CAGATCCCACGCCCAGATGACCCCAGCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCATGAAGTCTTACTC
ATCTCTGCCGAGCAGGACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGGCCGTATAATAGACTG
GTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCCCCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAG
GAACAGTTGGCTCAGGCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAGAAAAAGAAGACTACAACCATTGCAGTGGAAGTGAAGAAA
TCCCAACACAAGTATGTCATTGGGCCCAAGGGCAATTCATTGCAGGAGATCCTTGAGAGAACTGGAGTTTCCGTTGAGATCCCACCCTCA
GACAGCATCTCTGAGACTGTAATACTTCGAGGCGAACCTGAAAAGTTAGGTCAGGCGTTGACTGAAGTCTATGCCAAGGCCAATAGCTTC
ACCGTCTCCTCTGTCGCCGCCCCTTCCTGGCTTCACCGTTTCATCATTGGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATG
CCAAAGGTTCACATCGAGTTCACAGAGGGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGATGTCAATGTGGCCCAGGAACAGATA
GAAGGCATGGTCAAAGATTTGATTAACCGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATTGGGAAGAGC
GGTGCCAACATAAACAGAATCAAAGACCAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGAGCAATTTGATCCGCATCGAG
GGGGACCCACAGGGCGTGCAGCAGGCCAAGCGAGAGCTGCTGGAGCTTGCATCTCGCATGGAAAATGAGCGTACCAAGGATCTAATCATT
GAGCAAAGATTTCATCGCACAATCATTGGGCAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAGGTCATCATTAACTTT
CCAGACCCAGCACAAAAAAGTGACATTGTCCAGCTCAGAGGACCTAAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTG
GCAGATCTGGTGGAAAATAGCTATTCAATTTCTGTTCCGATCTTCAAACAGTTTCACAAGAATATCATTGGGAAAGGAGGCGCAAACATT
AAAAAGATTCGTGAAGAAAGCAACACCAAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACCATTATCATCACAGGCAAGCGAGCC
AACTGCGAAGCTGCCCGGAGCAGGATTCTGTCTATTCAGAAAGACCTGGCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTG
CACAACTCCCTCATTGGCACCAAGGGCCGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTTCCCGTGGAAGGT
TCAGGAAGCGACACCGTTGTTATCAGGGGCCCTTCCTCGGATGTGGAGAAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAGCAA
ACCAAGAGTTTCACTGTTGACATCCGCGCCAAGCCAGAATACCACAAATTCCTCATCGGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGC
GACAGCACTGGAGCACGTGTCATCTTCCCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGGAGGACGCCGTCCGA
GAGGCACAGAAGGAGCTGGAGGCCTTGATCCAAAACCTGGATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCAC
TTCGTCATCCGCAGAGGCCAGGTCTTGCGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTCCCACGCTCTGGCACACAGAGC
GACAAAGTCACCCTCAAGGGCGCCAAGGACTGTGTGGAGGCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTGGAAGCTCAGGTG
ACATTAGAATGTGCTATACCCCAGAAATTCCATCGATCTGTCATGGGCCCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGT
GTTCAAATTAAATTCCCAGACAGAGAGGAGAACGCAGTTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGG
AGAGAGGCTAAAGATTGTGACCCCGGCTCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGAAAGAAAAGTGTGAGGCTGCCAAG
GAAGCTCTGGAGGCATTGGTTCCTGTCACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATTGGGCAGAAAGGAAGTGGG
ATCCGCAAGATGATGGATGAGTTTGAGGTGAACATACATGTCCCGGCACCTGAGCTGCAGTCTGACATCATCGCCATCACGGGCCTCGCT
GCAAATTTGGACCGGGCCAAGGCTGGACTGCTGGAGCGTGTGAAGGAGCTACAGGCCGAGCAGGAGGACCGGGCTTTAAGGAGTTTTAAG
CTGAGTGTCACTGTAGACCCCAAATACCATCCCAAGATTATCGGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTG
AACATCCAGTTTCCTGATAAGGACGATGGGAACCAGCCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGG
GATGCTATACTGAGAATTGTGGGTGAACTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCACCGCGTTCACGCCCGCATCATTGGT
GCCCGCGGCAAAGCCATTCGCAAAATCATGGACGAATTCAAGGTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTC
ACTGTGACGGGGCTCCCAGAGAATGTGGAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATACCTAGCTGACGTGGTGGACAGT
GAGGCGCTGCAGGTATACATGAAACCCCCAGCACACGAAGAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACC
GCCAGCAGCAGTGAGAAGACAGAGATTACTGCAGTTTATGTGACAAGCAGCCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCA

>In-frame_PRAME_ENST00000398741_chr22_22890128_-_HDLBP_ENST00000427183_chr2_242202277_-_5594nt
AATGTAGGGAAAGCAGGGCGGAGTCCTCTGCAGGCTCGGGGGAGGGGAGGGGCGTGAATGCGTGGATTTCTGTGGAGAGTGGAAACACGG
GGAGTCGAGGGGAGCATGCGCGGGCCTCAGAAAGTTTTGGGAAACCGACTCCTGGGAGCAGGGAGGAACGCGCGCTCCAGAGACAACTTC
GCGGTGTGGTGAACTCTCTGAGGAAAAACCATTTTGATTATTACTCTCAGACGTGCGTGGCAACAAGTGACTGAGACCTAGAAATCCAAG
CGTTGGAGGTCCTGAGGCCAGCCTAAGTCGCTTCAAAATGGAACGAAGGCGTTTGTGGGGTTCCATTCAGAGCCGATACATCAGCATGAG
TGTGTGGACAAGCCCACGGAGACTTGTGGAGCTGGCAGGGCAGAGCCTGCTGAAGGATGAGGCCCTGGCCATTGCCGCCCTGGAGTTGCT
GCCCAGGGAGCTCTTCCCGCCACTCTTCATGGCAGCCTTTGACGGGAGACACAGCCAGACCCTGAAGGCAATGGTGCAGGCCTGGCCCTT
CACCTGCCTCCCTCTGGGAGTGCTGATGAAGGGACAACATCTTCACCTGGAGACCTTCAAAGCTGTGCTTGATGGACTTGATGTGCTCCT
TGCCCAGGAGGTTCGCCCCAGGAGGTGGAAACTTCAAGTGCTGGATTTACGGAAGAACTCTCATCAGGACTTCTGGACTGTATGGTCTGG
AAACAGGGCCAGTCTGTACTCATTTCCAGAGCCAGAAGCAGCTCAGCCCATGACAAAGAAGCGAAAAGTAGATGGTTTGAGCACAGAGGC
AGAGCAGCCCTTCATTCCAGTAGAGGTGCTCGTAGACCTGTTCCTCAAGGAAGGTGCCTGTGATGAATTGTTCTCCTACCTCATTGAGAA
AGTGAAGCGAAAGAAAAATGTACTACGCCTGTGCTGTAAGAAGCTGAAGATTTTTGCAATGCCCATGCAGGATATCAAGATGATCCTGAA
AATGGTGCAGCTGGACTCTATTGAAGATTTGGAAGTGACTTGTACCTGGAAGCTACCCACCTTGGCGAAATTTTCTCCTTACCTGGGCCA
GATGATTAATCTGCGTAGACTCCTCCTCTCCCACATCCATGCATCTTCCTACATTTCCCCGGAGAAGGAAGAGCAGTATATCGCCCAGTT
CACCTCTCAGTTCCTCAGTCTGCAGTGCCTGCAGGCTCTCTATGTGGACTCTTTATTTTTCCTTAGAGGCCGCCTGGATCAGTTGCTCAG
GCACGTGATGAACCCCTTGGAAACCCTCTCAATAACTAACTGCCGGCTTTCGGAAGGGGATGTGATGCATCTGTCCCAGAGTCCCAGCGT
CAGTCAGCTAAGTGTCCTGAGTCTAAGTGGGGTCATGCTGACCGATGTAAGTCCCGAGCCCCTCCAAGCTCTGCTGGAGAGAGCCTCTGC
CACCCTCCAGGACCTGGTCTTTGATGAGTGTGGGATCACGGATGATCAGCTCCTTGCCCTCCTGCCTTCCCTGAGCCACTGCTCCCAGCT
TACAACCTTAAGCTTCTACGGGAATTCCATCTCCATATCTGCCTTGCAGAGTCTCCTGCAGCACCTCATCGGGCTGAGCAATCTGACCCA
CGTGCTGTATCCTGTCCCCCTGGAGAGTTATGAGGACATCCATGGTACCCTCCACCTGGAGAGGCTTGCCTATCTGCATGCCAGGCTCAG
GGAGTTGCTGTGTGAGTTGGGGCGGCCCAGCATGGTCTGGCTTAGTGCCAACCCCTGTCCTCACTGTGGGGACAGAACCTTCTATGACCC
GGAGCCCATCCTGTGCCCCTGTTTCATGCCTAACTAGCTGGGTGCACATATCAAATGCTTCATTCTGCATACTTGGACACTAAAGCCAGG
ATGTGCATGCATCTTGAAGCAACAAAGCAGCCACAGTTTCAGACAAATGTTCAGTGTGAGTGAGGAAAACATGTTCAGTGAGGAAAAAAC
ATTCAGACAAATGTTCAGTGAGGAAAAAAAGGGGAAGTTGGGGATAGGCAGATGTTGACTTGAGGAGTTAATGTGATCTTTGGGGAGATA
CATCTTATAGAGTTAGAAATAGAATCTGAATTTCTAAAGGGAGATTCTGGCTTGGGAAGTACATGTAGGAGTTAATCCCTGTGTAGACTG
TTGTAAAGAAACTGTTGAAAATAAAGAGAAGCAATGTGAAGCGTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAG
TTTGGAGAAGGTGAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCTTTGGCCAAAGACCAAGGC
CTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAAGCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAGGCCTCAGCAACT
GTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGAGAGAAACTGCAAGACTTGGAGCTAAAAACTGCAACCAAAATC
CAGATCCCACGCCCAGATGACCCCAGCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCATGAAGTCTTACTC
ATCTCTGCCGAGCAGGACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGGCCGTATAATAGACTG
GTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCCCCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAG
GAACAGTTGGCTCAGGCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAGGCCAATAGCTTCACCGTCTCCTCTGTCGCCGCCCCTTCC
TGGCTTCACCGTTTCATCATTGGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATGCCAAAGGTTCACATCGAGTTCACAGAG
GGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGATGTCAATGTGGCCCAGGAACAGATAGAAGGCATGGTCAAAGATTTGATTAAC
CGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATTGGGAAGAGCGGTGCCAACATAAACAGAATCAAAGAC
CAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGAGCAATTTGATCCGCATCGAGGGGGACCCACAGGGCGTGCAGCAGGCC
AAGCGAGAGCTGCTGGAGCTTGCATCTCGCATGGAAAATGAGCGTACCAAGGATCTAATCATTGAGCAAAGATTTCATCGCACAATCATT
GGGCAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAGGTCATCATTAACTTTCCAGACCCAGCACAAAAAAGTGACATT
GTCCAGCTCAGAGGACCTAAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTGGCAGATCTGGTGGAAAATAGCTATTCA
ATTTCTGTTCCGATCTTCAAACAGTTTCACAAGAATATCATTGGGAAAGGAGGCGCAAACATTAAAAAGATTCGTGAAGAAAGCAACACC
AAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACCATTATCATCACAGGCAAGCGAGCCAACTGCGAAGCTGCCCGGAGCAGGATT
CTGTCTATTCAGAAAGACCTGGCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTGCACAACTCCCTCATTGGCACCAAGGGC
CGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTTCCCGTGGAAGGTTCAGGAAGCGACACCGTTGTTATCAGG
GGCCCTTCCTCGGATGTGGAGAAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAGCAAACCAAGAGTTTCACTGTTGACATCCGC
GCCAAGCCAGAATACCACAAATTCCTCATCGGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGCGACAGCACTGGAGCACGTGTCATCTTC
CCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGGAGGACGCCGTCCGAGAGGCACAGAAGGAGCTGGAGGCCTTG
ATCCAAAACCTGGATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCACTTCGTCATCCGCAGAGGCCAGGTCTTG
CGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTCCCACGCTCTGGCACACAGAGCGACAAAGTCACCCTCAAGGGCGCCAAG
GACTGTGTGGAGGCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTGGAAGCTCAGGTGACATTAGAATGTGCTATACCCCAGAAA
TTCCATCGATCTGTCATGGGCCCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGTGTTCAAATTAAATTCCCAGACAGAGAG
GAGAACGCAGTTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGGAGAGAGGCTAAAGATTGTGACCCCGGC
TCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGAAAGAAAAGTGTGAGGCTGCCAAGGAAGCTCTGGAGGCATTGGTTCCTGTC
ACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATTGGGCAGAAAGGAAGTGGGATCCGCAAGATGATGGATGAGTTTGAG
GTGAACATACATGTCCCGGCACCTGAGCTGCAGTCTGACATCATCGCCATCACGGGCCTCGCTGCAAATTTGGACCGGGCCAAGGCTGGA
CTGCTGGAGCGTGTGAAGGAGCTACAGGCCGAGCAGGAGGACCGGGCTTTAAGGAGTTTTAAGCTGAGTGTCACTGTAGACCCCAAATAC
CATCCCAAGATTATCGGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTGAACATCCAGTTTCCTGATAAGGACGAT
GGGAACCAGCCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGGGATGCTATACTGAGAATTGTGGGTGAA
CTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCACCGCGTTCACGCCCGCATCATTGGTGCCCGCGGCAAAGCCATTCGCAAAATC
ATGGACGAATTCAAGGTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTCACTGTGACGGGGCTCCCAGAGAATGTG
GAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATACCTAGCTGACGTGGTGGACAGTGAGGCGCTGCAGGTATACATGAAACCC
CCAGCACACGAAGAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACCGCCAGCAGCAGTGAGAAGACAGAGATT
ACTGCAGTTTATGTGACAAGCAGCCAATCGGGAGGCTGCTTTTCCGGCAGTTTTGTGAAACCAGGCCTGGGCTGGAGTGTTACATTCAGT


Top

FusionGenePPI for PRAME_HDLBP


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
PRAMESTK19, CUL2, TCEB1, TCEB2, RBX1, KDM1A, BAG2, HNRNPC, UBL4A, SNRPB, RPL10, HNRNPH1, RFC4, RPL22, PSMC4, HNRNPM, HNRNPF, RPS13, PRAME, LAGE3, OSGEP, TP53RK, TPRKB, RARA, HIST2H2BE, HIST4H4, HIST2H2AC, HIST3H3, FBXL12, XRN2, ZNF408, MOV10, UBC, MLST8, QTRT1, PARK2, ZNF562, IFT81, COPS2, NOL11, AZIN2, EEF1D, SIRT6, PDDC1, NPY2R, FSCN3, FOXD4, DAAM2, CCDC28BHDLBPAKTIP, MAGEA6, XPOT, XRCC5, PRKDC, ADAR, DHX9, SOS1, SUV39H1, CBX5, ARRB1, SIRT7, CDK2, COPS5, PSMD12, VPS35, S100A11, VPS29, UPF1, VPS26A, VPS36, UBA6, VPS25, TTC4, TYRO3, UBE2A, PLAUR, TOPBP1, TTK, ATP6V1B2, S100A10, ZW10, UBE4B, ZNF598, VCP, CSNK2A1, SMAD4, FAM46A, DYNLL1, EIF2A, FAU, KCMF1, IKBKG, WWOX, LGR4, OBSL1, CCDC8, ESR1, SERPINB5, BPGM, TMEM171, PTCRA, ZCCHC7, SERPINB3, ACTL6A, CYP1A1, HSPB1, CLUH, DDX43, GLMN, SMS, SAC3D1, NTRK1, SCARNA22, ERBB2, KIF11, MLH1, YBX1, SNW1, CDC5L, CDH1, STYX, WDR59, SERPINB2, CCDC102B, GTF2E2, HDHD2, SNRNP27, FGB, HSPA8, IL20RA, USP47, SYNCRIP, DLD, PDHA1, SDHA


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for PRAME_HDLBP


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for PRAME_HDLBP


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgenePRAMEC0007131Non-Small Cell Lung Carcinoma1CTD_human
HgenePRAMEC0007134Renal Cell Carcinoma1CTD_human
HgenePRAMEC0018671Head and Neck Neoplasms1CTD_human
HgenePRAMEC0023418leukemia1CTD_human
HgenePRAMEC0023473Myeloid Leukemia, Chronic1CTD_human
HgenePRAMEC0025149Medulloblastoma1CTD_human
HgenePRAMEC0025202melanoma1CTD_human
HgenePRAMEC0026764Multiple Myeloma1CTD_human
HgenePRAMEC1261473Sarcoma1CTD_human
TgeneHDLBPC0004352Autistic Disorder1CTD_human
TgeneHDLBPC2931817Chromosome 2q37 deletion syndrome1CTD_human