FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 28332

FusionGeneSummary for PPP1R13L_MBOAT7

check button Fusion gene summary
Fusion gene informationFusion gene name: PPP1R13L_MBOAT7
Fusion gene ID: 28332
HgeneTgene
Gene symbol

PPP1R13L

MBOAT7

Gene ID

10848

79143

Gene nameprotein phosphatase 1 regulatory subunit 13 likemembrane bound O-acyltransferase domain containing 7
SynonymsIASPP|NKIP1|RAI|RAI4BB1|LENG4|LPIAT|LPLAT|LRC4|MBOA7|MRT57|OACT7|hMBOA-7
Cytomap

19q13.32

19q13.42

Type of geneprotein-codingprotein-coding
DescriptionrelA-associated inhibitorNFkB interacting protein 1PPP1R13B-like proteininhibitor of ASPP proteininhibitor of apoptosis stimulating protein of p53protein iASPPprotein phosphatase 1, regulatory (inhibitor) subunit 13 likeretinoic acid induced 4lysophospholipid acyltransferase 71-acylglycerophosphatidylinositol O-acyltransferaseLPLAT 7bladder and breast carcinoma-overexpressed gene 1 proteinh-mboa-7leukocyte receptor cluster (LRC) member 4lyso-PI acyltransferaselysophosphatidylinositol ac
Modification date2018052220180519
UniProtAcc

Q8WUF5

Q96N66

Ensembl transtripts involved in fusion geneENST00000360957, ENST00000418234, 
ENST00000431666, ENST00000338624, 
ENST00000245615, ENST00000391754, 
ENST00000474910, 
Fusion gene scores* DoF score4 X 4 X 4=645 X 5 X 3=75
# samples 46
** MAII scorelog2(4/64*10)=-0.678071905112638
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(6/75*10)=-0.321928094887362
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: PPP1R13L [Title/Abstract] AND MBOAT7 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVESCATCGA-L5-A891-01APPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000360957ENST00000431666PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
Frame-shitENST00000360957ENST00000338624PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
In-frameENST00000360957ENST00000245615PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
5CDS-intronENST00000360957ENST00000391754PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
5CDS-intronENST00000360957ENST00000474910PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
Frame-shitENST00000418234ENST00000431666PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
Frame-shitENST00000418234ENST00000338624PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
In-frameENST00000418234ENST00000245615PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
5CDS-intronENST00000418234ENST00000391754PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-
5CDS-intronENST00000418234ENST00000474910PPP1R13Lchr19

45885785

-MBOAT7chr19

54678125

-

Top

FusionProtFeatures for PPP1R13L_MBOAT7


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
PPP1R13L

Q8WUF5

MBOAT7

Q96N66

Regulator that plays a central role in regulation ofapoptosis and transcription via its interaction with NF-kappa-Band p53/TP53 proteins. Blocks transcription of HIV-1 virus byinhibiting the action of both NF-kappa-B and SP1. Also inhibitsp53/TP53 function, possibly by preventing the association betweenp53/TP53 and ASPP1 or ASPP2, and therefore suppressing thesubsequent activation of apoptosis. {ECO:0000269|PubMed:10336463,ECO:0000269|PubMed:12134007, ECO:0000269|PubMed:12524540,ECO:0000269|PubMed:15489900}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for PPP1R13L_MBOAT7


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_PPP1R13L_ENST00000360957_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_129aa
ERLDHAAERLLARPPPGLLPELPDHPAVPGCRGPAGVSPAGAAEPRGPEGLGLGALVPEDARL_LHVHGLRAALLGRHPSVLGLHLLLTP

>In-frame_PPP1R13L_ENST00000418234_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_129aa
ERLDHAAERLLARPPPGLLPELPDHPAVPGCRGPAGVSPAGAAEPRGPEGLGLGALVPEDARL_LHVHGLRAALLGRHPSVLGLHLLLTP


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_PPP1R13L_ENST00000360957_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_388nt
GAGCGCCTGGACCATGCTGCTGAGCGCCTACTGGCACGGCCTCCACCCGGGCTACTACCTGAGCTTCCTGACCATCCCGCTGTGCCTGGC
TGCCGAGGGCCGGCTGGAGTCAGCCCTGCGGGGGCGGCTGAGCCCAGGGGGCCAGAAGGCCTGGGACTGGGTGCACTGGTTCCTGAAGAT
GCGCGCCTATGACTACATGTGCATGGGCTTCGTGCTGCTCTCCTTGGCCGACACCCTTCGGTACTGGGCCTCCATCTACTTCTGTATCCA
CTTCCTGGCCCTGGCAGCCCTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCCCAGCCGGCGGAAGGCAGCATCCCAGCCCACCAGCCT

>In-frame_PPP1R13L_ENST00000418234_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_388nt
GAGCGCCTGGACCATGCTGCTGAGCGCCTACTGGCACGGCCTCCACCCGGGCTACTACCTGAGCTTCCTGACCATCCCGCTGTGCCTGGC
TGCCGAGGGCCGGCTGGAGTCAGCCCTGCGGGGGCGGCTGAGCCCAGGGGGCCAGAAGGCCTGGGACTGGGTGCACTGGTTCCTGAAGAT
GCGCGCCTATGACTACATGTGCATGGGCTTCGTGCTGCTCTCCTTGGCCGACACCCTTCGGTACTGGGCCTCCATCTACTTCTGTATCCA
CTTCCTGGCCCTGGCAGCCCTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCCCAGCCGGCGGAAGGCAGCATCCCAGCCCACCAGCCT


* Fusion transcript sequences (Full-length transcript).
>In-frame_PPP1R13L_ENST00000360957_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_3526nt
GCTGGAGGAAGCCCCCAGGTGCCAGGATCTGCCCGGATCCGCGCCCGCTCCGGCCGGCACCATGGACAGCGAGGCATTCCAGAGCGCGCG
GGACTTTCTGGACATGAACTTCCAGTCGCTGGCCATGAAACACATGGATCTGAAGCAGATGGAGCTGGACACGGCGGCGGCCAAGGTGGA
TGAACTGACCAAGCAGCTGGAGTCGCTGTGGTCAGACTCTCCCGCGCCTCCTGGCCCGCAGGCCGGACCCCCTTCTAGGCCGCCCCGGTA
CAGCTCCAGCTCGATCCCTGAGCCCTTCGGCAGCCGAGGGTCCCCCCGGAAGGCGGCCACCGACGGCGCAGACACCCCGTTCGGACGATC
AGAGAGTGCCCCAACCCTACACCCCTACAGCCCGCTGTCCCCCAAGGGACGGCCGTCGTCGCCGCGCACCCCGCTCTACCTGCAGCCGGA
CGCCTACGGCAGCCTGGACCGCGCGACCTCGCCCCGGCCCCGCGCCTTCGATGGCGCAGGCAGCTCCCTCGGCCGTGCGCCCTCCCCGCG
GCCCGGGCCAGGCCCGCTCCGCCAGCAGGGTCCCCCCACGCCTTTCGACTTCCTGGGCCGCGCAGGCTCCCCCCGCGGCAGCCCCCTGGC
GGAGGGGCCCCAGGCCTTCTTCCCCGAGCGTGGGCCGTCACCGCGCCCCCCTGCCACAGCCTACGACGCGCCAGCGTCCGCCTTCGGGAG
CTCCCTGCTAGGCTCCGGCGGCAGCGCATTCGCCCCGCCTCTGCGCGCGCAAGACGACCTGACGCTGCGCCGGCGGCCTCCGAAAGCCTG
GAACGAGTCTGACCTGGACGTGGCGTACGAGAAGAAGCCTTCGCAGACAGCGAGCTATGAACGCCTGGACGTCTTCGCAAGGCCTGCCTC
GCCGAGCCTGCAGCTGTTGCCTTGGAGGGAGAGCAGCCTGGATGGACTGGGGGGCACCGGCAAGGACAACCTCACTAGCGCCACCCTGCC
GCGCAATTACAAGGTCTCTCCTCTGGCCAGCGACCGGCGTTCAGACGCGGGCAGCTACCGGCGCTCGCTGGGCTCCGCGGGGCCGTCGGG
CACTTTGCCTCGCAGCTGGCAGCCCGTCAGCCGCATCCCCATGCCCCCCTCCAGCCCCCAGCCCCGCGGGGCCCCGCGCCAGCGTCCCAT
CCCCCTCAGCATGATCTTCAAGCTGCAGAACGCCTTCTGGGAGCACGGGGCCAGCCGCGCCATGCTCCCTGGGTCCCCCCTCTTCACCCG
AGCACCCCCGCCTAAGCTGCAGCCCCAACCACAACCACAGCCCCAGCCACAATCACAACCACAGCCCCAGCTGCCCCCACAGCCCCAGAC
CCAACCCCAAACCCCTACCCCAGCCCCCCAGCATCCCCAACAGACATGGCCCCCTGTGAACGAAGGACCCCCCAAACCCCCCACCGAGCT
GGAGCCTGAGCCGGAGATAGAGGGGCTGCTGACACCAGTGCTGGAGGCTGGCGATGTGGATGAAGGCCCTGTAGCAAGGCCTCTCAGCCC
CACGAGGCTGCAGCCAGCACTGCCACCGGAGGCACAGTCGGTGCCCGAGCTGGAGGAGGTGGCACGGGTGTTGGCGGAAATTCCCCGGCC
CCTCAAACGCAGGGGCTCCATGGAGCAGGCCCCTGCTGTGGCCCTGCCCCCTACCCACAAGAAACAGTACCAGCAGATCATCAGCCGCCT
CTTCCATCGTCATGGGGGGCCAGGGCCCGGGGGGCCGGAGCCAGAGCTGTCCCCCATCACTGAGGGATCTGAGGCCAGGGCAGGGCCCCC
TGCTCCTGCCCCACCAGCTCCCATTCCACCCCCGGCCCCGTCCCAGAGCAGCCCACCAGAGCAGCCGCAGAGCATGGAGATGCGCTCTGT
GCTGCGGAAGGCGGGCTCCCCGCGCAAGGCCCGCCGCGCGCGCCTCAACCCTCTGGTGCTCCTCCTGGACGCGGCGCTGACCGGGGAGCT
GGAGGTGGTGCAGCAGGCGGTGAAGGAGATGAACGACCCGAGCCAGCCCAACGAGGAGGGCATCACTGCCTTGCACAACGCCATCTGCGG
CGCCAACTACTCTATCGTGGATTTCCTCATCACCGCGGGTGCCAATGTCAACTCCCCCGACAGCCACGGCTGGACACCCTTGCACTGCGC
GGCGTCGTGCAACGACACAGTCATCTGCATGGCGCTGGTGCAGCACGGCGCTGCAATCTTCGCCACCACGCTCAGCGACGGCGCCACCGC
CTTCGAGAAGTGCGACCCTTACCGCGAGGGTTATGCTGACTGCGCCACCTACCTGGCAGACGTCGAGCAGAGTATGGGGCTGATGAACAG
CGGGGCAGTGTACGCTCTCTGGGACTACAGCGCCGAGTTCGGGGACGAGCTGTCCTTCCGCGAGGGCGAGTCGGTCACCGTGCTGCGGAG
GGACGGGCCGGAGGAGACCGACTGGTGGTGGGCCGCGCTGCACGGCCAGGAGGGCTACGTGCCGCGGAACTACTTCGGGGAGCGCCTGGA
CCATGCTGCTGAGCGCCTACTGGCACGGCCTCCACCCGGGCTACTACCTGAGCTTCCTGACCATCCCGCTGTGCCTGGCTGCCGAGGGCC
GGCTGGAGTCAGCCCTGCGGGGGCGGCTGAGCCCAGGGGGCCAGAAGGCCTGGGACTGGGTGCACTGGTTCCTGAAGATGCGCGCCTATG
ACTACATGTGCATGGGCTTCGTGCTGCTCTCCTTGGCCGACACCCTTCGGTACTGGGCCTCCATCTACTTCTGTATCCACTTCCTGGCCC
TGGCAGCCCTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCCCAGCCGGCGGAAGGCAGCATCCCAGCCCACCAGCCTTGCCCCAGAGA
AGCTCCGGGAGGAGTAAGCTGTCACGACGCTCCCTCTGCCAGCTGGTCCCGGGAATTCTGTGAACCAGGCTGCTGTCTCCTCCCCAGAAA
GAGTCCTTACCTTGGAGAGGGTCCTGGAGAGAATTTCCTCTTCCCCAGCTAAATACCCTGCCTGCAACTGAAGCAGACCCGGGGGTGTCC
TCCCTGCCCTCTGCCCAGAGGCCACCTCCACTCCTACAAAATCAAAGTATTGTCCAGACAAGAGTCACTGGCCCCTGCTCCAGCTTCTGG
GTATCCAGAGAGCACTGCACTTCCCCAAAACGGAAGGGGCCCCTGGGCAGTGGGTTTTGGGCAAATTCCCTTTCTTTGCATCCACAATGT
GGGGTCGGAGCTTGGGGGCAGGTCCTGGGAGTGGGAAGCCTCTTCCTTGTGTCTTTCGCTCCACTTTTAGCTCATCGCACCAATATTGCA
GACTTGGAAGGAAGCATAAGCTTCCCATTTCACAAAGGGGAAACTGAGGTGCGGGTGCGCGGGCCTGGGGACGGCCGTCCCATGGCTTCC
ATCTGAGCCACCTCGGGACCCCAGCGCTCCTGGCGCCCTCTTCTCATCGCTTGGCCTATGACAGGTCACCGTGTGTAAATCTTTCCCAAT

>In-frame_PPP1R13L_ENST00000418234_chr19_45885785_-_MBOAT7_ENST00000245615_chr19_54678125_-_3544nt
CTTCCTAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCGCTCCGGCCGGCACCATGGACAGCGA
GGCATTCCAGAGCGCGCGGGACTTTCTGGACATGAACTTCCAGTCGCTGGCCATGAAACACATGGATCTGAAGCAGATGGAGCTGGACAC
GGCGGCGGCCAAGGTGGATGAACTGACCAAGCAGCTGGAGTCGCTGTGGTCAGACTCTCCCGCGCCTCCTGGCCCGCAGGCCGGACCCCC
TTCTAGGCCGCCCCGGTACAGCTCCAGCTCGATCCCTGAGCCCTTCGGCAGCCGAGGGTCCCCCCGGAAGGCGGCCACCGACGGCGCAGA
CACCCCGTTCGGACGATCAGAGAGTGCCCCAACCCTACACCCCTACAGCCCGCTGTCCCCCAAGGGACGGCCGTCGTCGCCGCGCACCCC
GCTCTACCTGCAGCCGGACGCCTACGGCAGCCTGGACCGCGCGACCTCGCCCCGGCCCCGCGCCTTCGATGGCGCAGGCAGCTCCCTCGG
CCGTGCGCCCTCCCCGCGGCCCGGGCCAGGCCCGCTCCGCCAGCAGGGTCCCCCCACGCCTTTCGACTTCCTGGGCCGCGCAGGCTCCCC
CCGCGGCAGCCCCCTGGCGGAGGGGCCCCAGGCCTTCTTCCCCGAGCGTGGGCCGTCACCGCGCCCCCCTGCCACAGCCTACGACGCGCC
AGCGTCCGCCTTCGGGAGCTCCCTGCTAGGCTCCGGCGGCAGCGCATTCGCCCCGCCTCTGCGCGCGCAAGACGACCTGACGCTGCGCCG
GCGGCCTCCGAAAGCCTGGAACGAGTCTGACCTGGACGTGGCGTACGAGAAGAAGCCTTCGCAGACAGCGAGCTATGAACGCCTGGACGT
CTTCGCAAGGCCTGCCTCGCCGAGCCTGCAGCTGTTGCCTTGGAGGGAGAGCAGCCTGGATGGACTGGGGGGCACCGGCAAGGACAACCT
CACTAGCGCCACCCTGCCGCGCAATTACAAGGTCTCTCCTCTGGCCAGCGACCGGCGTTCAGACGCGGGCAGCTACCGGCGCTCGCTGGG
CTCCGCGGGGCCGTCGGGCACTTTGCCTCGCAGCTGGCAGCCCGTCAGCCGCATCCCCATGCCCCCCTCCAGCCCCCAGCCCCGCGGGGC
CCCGCGCCAGCGTCCCATCCCCCTCAGCATGATCTTCAAGCTGCAGAACGCCTTCTGGGAGCACGGGGCCAGCCGCGCCATGCTCCCTGG
GTCCCCCCTCTTCACCCGAGCACCCCCGCCTAAGCTGCAGCCCCAACCACAACCACAGCCCCAGCCACAATCACAACCACAGCCCCAGCT
GCCCCCACAGCCCCAGACCCAACCCCAAACCCCTACCCCAGCCCCCCAGCATCCCCAACAGACATGGCCCCCTGTGAACGAAGGACCCCC
CAAACCCCCCACCGAGCTGGAGCCTGAGCCGGAGATAGAGGGGCTGCTGACACCAGTGCTGGAGGCTGGCGATGTGGATGAAGGCCCTGT
AGCAAGGCCTCTCAGCCCCACGAGGCTGCAGCCAGCACTGCCACCGGAGGCACAGTCGGTGCCCGAGCTGGAGGAGGTGGCACGGGTGTT
GGCGGAAATTCCCCGGCCCCTCAAACGCAGGGGCTCCATGGAGCAGGCCCCTGCTGTGGCCCTGCCCCCTACCCACAAGAAACAGTACCA
GCAGATCATCAGCCGCCTCTTCCATCGTCATGGGGGGCCAGGGCCCGGGGGGCCGGAGCCAGAGCTGTCCCCCATCACTGAGGGATCTGA
GGCCAGGGCAGGGCCCCCTGCTCCTGCCCCACCAGCTCCCATTCCACCCCCGGCCCCGTCCCAGAGCAGCCCACCAGAGCAGCCGCAGAG
CATGGAGATGCGCTCTGTGCTGCGGAAGGCGGGCTCCCCGCGCAAGGCCCGCCGCGCGCGCCTCAACCCTCTGGTGCTCCTCCTGGACGC
GGCGCTGACCGGGGAGCTGGAGGTGGTGCAGCAGGCGGTGAAGGAGATGAACGACCCGAGCCAGCCCAACGAGGAGGGCATCACTGCCTT
GCACAACGCCATCTGCGGCGCCAACTACTCTATCGTGGATTTCCTCATCACCGCGGGTGCCAATGTCAACTCCCCCGACAGCCACGGCTG
GACACCCTTGCACTGCGCGGCGTCGTGCAACGACACAGTCATCTGCATGGCGCTGGTGCAGCACGGCGCTGCAATCTTCGCCACCACGCT
CAGCGACGGCGCCACCGCCTTCGAGAAGTGCGACCCTTACCGCGAGGGTTATGCTGACTGCGCCACCTACCTGGCAGACGTCGAGCAGAG
TATGGGGCTGATGAACAGCGGGGCAGTGTACGCTCTCTGGGACTACAGCGCCGAGTTCGGGGACGAGCTGTCCTTCCGCGAGGGCGAGTC
GGTCACCGTGCTGCGGAGGGACGGGCCGGAGGAGACCGACTGGTGGTGGGCCGCGCTGCACGGCCAGGAGGGCTACGTGCCGCGGAACTA
CTTCGGGGAGCGCCTGGACCATGCTGCTGAGCGCCTACTGGCACGGCCTCCACCCGGGCTACTACCTGAGCTTCCTGACCATCCCGCTGT
GCCTGGCTGCCGAGGGCCGGCTGGAGTCAGCCCTGCGGGGGCGGCTGAGCCCAGGGGGCCAGAAGGCCTGGGACTGGGTGCACTGGTTCC
TGAAGATGCGCGCCTATGACTACATGTGCATGGGCTTCGTGCTGCTCTCCTTGGCCGACACCCTTCGGTACTGGGCCTCCATCTACTTCT
GTATCCACTTCCTGGCCCTGGCAGCCCTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCCCAGCCGGCGGAAGGCAGCATCCCAGCCCA
CCAGCCTTGCCCCAGAGAAGCTCCGGGAGGAGTAAGCTGTCACGACGCTCCCTCTGCCAGCTGGTCCCGGGAATTCTGTGAACCAGGCTG
CTGTCTCCTCCCCAGAAAGAGTCCTTACCTTGGAGAGGGTCCTGGAGAGAATTTCCTCTTCCCCAGCTAAATACCCTGCCTGCAACTGAA
GCAGACCCGGGGGTGTCCTCCCTGCCCTCTGCCCAGAGGCCACCTCCACTCCTACAAAATCAAAGTATTGTCCAGACAAGAGTCACTGGC
CCCTGCTCCAGCTTCTGGGTATCCAGAGAGCACTGCACTTCCCCAAAACGGAAGGGGCCCCTGGGCAGTGGGTTTTGGGCAAATTCCCTT
TCTTTGCATCCACAATGTGGGGTCGGAGCTTGGGGGCAGGTCCTGGGAGTGGGAAGCCTCTTCCTTGTGTCTTTCGCTCCACTTTTAGCT
CATCGCACCAATATTGCAGACTTGGAAGGAAGCATAAGCTTCCCATTTCACAAAGGGGAAACTGAGGTGCGGGTGCGCGGGCCTGGGGAC
GGCCGTCCCATGGCTTCCATCTGAGCCACCTCGGGACCCCAGCGCTCCTGGCGCCCTCTTCTCATCGCTTGGCCTATGACAGGTCACCGT


Top

FusionGenePPI for PPP1R13L_MBOAT7


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
PPP1R13LRELA, TP53, SP1, PPP1CA, AURKB, CEP57, EP300, MAPRE1, WDR83, MAGEA4, PPP1CC, CREBBP, PPP1R3A, SRPK2, XPO1, PPP1CB, SMS, SEC16A, ATP6AP2, CDH1, FAM19A3, PPP1R7, KEAP1, NFE2L2, TRIM25MBOAT7TMEM173, UNC93B1, MAPK6, SPTSSA, TM4SF20, NRG1, PTH1R, PTGFR, GPR52, B3GNT3, POMK, CD200R1, SLC35A5, LPAR1, HTR3C, TCTN2, TCTN3, PKN2, RAB7A, VAPA, GOLT1B, YIPF5, SLC22A9, SLC7A1, UPK1A, CD36, SLC39A12, IPPK, TM2D2, GPR21, SYP, HTR2C, KDELR3, STS, TPRA1, LMBRD1, TMEM184A, CD44, SLC5A8, SLC18A1, GPR37, UBC, STOM, SOAT1, NDUFS1, ACAP2


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for PPP1R13L_MBOAT7


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for PPP1R13L_MBOAT7


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgenePPP1R13LC0023418leukemia1CTD_human
TgeneMBOAT7C0023891Liver Cirrhosis, Alcoholic1CTD_human