FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 26079

FusionGeneSummary for PAX5_ZNF521

check button Fusion gene summary
Fusion gene informationFusion gene name: PAX5_ZNF521
Fusion gene ID: 26079
HgeneTgene
Gene symbol

PAX5

ZNF521

Gene ID

5079

25925

Gene namepaired box 5zinc finger protein 521
SynonymsALL3|BSAPEHZF|Evi3
Cytomap

9p13.2

18q11.2

Type of geneprotein-codingprotein-coding
Descriptionpaired box protein Pax-5B-cell lineage specific activatorpaired box homeotic gene 5paired domain gene 5transcription factor PAX 5zinc finger protein 521LYST-interacting protein 3early hematopoietic zinc finger protein
Modification date2018052020180519
UniProtAcc

Q02548

Q96K83

Ensembl transtripts involved in fusion geneENST00000358127, ENST00000523241, 
ENST00000520154, ENST00000377852, 
ENST00000377853, ENST00000522003, 
ENST00000520281, ENST00000414447, 
ENST00000523145, ENST00000446742, 
ENST00000377847, 
ENST00000361524, 
ENST00000584787, ENST00000538137, 
ENST00000579111, 
Fusion gene scores* DoF score7 X 8 X 2=1128 X 7 X 7=392
# samples 88
** MAII scorelog2(8/112*10)=-0.485426827170242
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(8/392*10)=-2.29278174922785
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: PAX5 [Title/Abstract] AND ZNF521 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationOncogene involved fusion gene, in-frame and retained their domain.
Tumor suppressor gene involved fusion gene, in-frame but not retained their domain.
Transcription factor involved fusion gene, inframe and retained DNA-binding domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DQ845345PAX5chr9

36923352

-ZNF521chr18

22807664

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000358127ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000358127ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000358127ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000358127ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-3CDSENST00000523241ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000523241ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000523241ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000523241ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-3CDSENST00000520154ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000520154ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000520154ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
intron-5UTRENST00000520154ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000377852ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377852ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377852ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377852ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000377853ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377853ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377853ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377853ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
Frame-shitENST00000522003ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000522003ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000522003ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000522003ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000520281ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000520281ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000520281ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000520281ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000414447ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000414447ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000414447ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000414447ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
Frame-shitENST00000523145ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000523145ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000523145ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000523145ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000446742ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000446742ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000446742ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000446742ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-
In-frameENST00000377847ENST00000361524PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377847ENST00000584787PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377847ENST00000538137PAX5chr9

36923352

-ZNF521chr18

22807664

-
5CDS-5UTRENST00000377847ENST00000579111PAX5chr9

36923352

-ZNF521chr18

22807664

-

Top

FusionProtFeatures for PAX5_ZNF521


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
PAX5

Q02548

ZNF521

Q96K83

Transcription factor that can both act as an activatoror a repressor depending on the context. Involved in BMP signalingand in the regulation of the immature compartment of thehematopoietic system. Associates with SMADs in response to BMP2leading to activate transcription of BMP target genes. Acts as atranscriptional repressor via its interaction with EBF1, atranscription factor involved specification of B-cell lineage;this interaction preventing EBF1 to bind DNA and activate targetgenes. {ECO:0000269|PubMed:14630787}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgenePAX5chr9:36923352chr18:22807664ENST00000358127-71016_142303392DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000377847-7816_142303329DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000377852-7916_142303358DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000377853-7916_142303363DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000414447-6916_142260349DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000446742-6816_142237292DomainPaired
HgenePAX5chr9:36923352chr18:22807664ENST00000520281-6816_142260320DomainPaired
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281020_1042731312Zinc fingerC2H2-type 24
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281065_1083731312Zinc fingerC2H2-type 25%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281138_1161731312Zinc fingerC2H2-type 26
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28118_140731312Zinc fingerC2H2-type 2
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281195_1217731312Zinc fingerC2H2-type 27
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281225_1247731312Zinc fingerC2H2-type 28
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281256_1279731312Zinc fingerC2H2-type 29
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-281286_1309731312Zinc fingerC2H2-type 30
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28146_168731312Zinc fingerC2H2-type 3
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28174_196731312Zinc fingerC2H2-type 4
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28202_224731312Zinc fingerC2H2-type 5
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28246_269731312Zinc fingerC2H2-type 6
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28281_304731312Zinc fingerC2H2-type 7
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28310_332731312Zinc fingerC2H2-type 8
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28405_429731312Zinc fingerC2H2-type 9%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28437_460731312Zinc fingerC2H2-type 10
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28477_500731312Zinc fingerC2H2-type 11
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28513_536731312Zinc fingerC2H2-type 12
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28560_585731312Zinc fingerC2H2-type 13%3B atypical
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28634_656731312Zinc fingerC2H2-type 14
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28664_686731312Zinc fingerC2H2-type 15
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28694_717731312Zinc fingerC2H2-type 16
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28722_745731312Zinc fingerC2H2-type 17
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28752_775731312Zinc fingerC2H2-type 18
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28783_805731312Zinc fingerC2H2-type 19
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28809_832731312Zinc fingerC2H2-type 20
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28886_908731312Zinc fingerC2H2-type 21%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28930_952731312Zinc fingerC2H2-type 22
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-28959_981731312Zinc fingerC2H2-type 23
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281020_1042731312Zinc fingerC2H2-type 24
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281065_1083731312Zinc fingerC2H2-type 25%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281138_1161731312Zinc fingerC2H2-type 26
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28118_140731312Zinc fingerC2H2-type 2
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281195_1217731312Zinc fingerC2H2-type 27
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281225_1247731312Zinc fingerC2H2-type 28
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281256_1279731312Zinc fingerC2H2-type 29
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-281286_1309731312Zinc fingerC2H2-type 30
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28146_168731312Zinc fingerC2H2-type 3
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28174_196731312Zinc fingerC2H2-type 4
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28202_224731312Zinc fingerC2H2-type 5
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28246_269731312Zinc fingerC2H2-type 6
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28281_304731312Zinc fingerC2H2-type 7
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28310_332731312Zinc fingerC2H2-type 8
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28405_429731312Zinc fingerC2H2-type 9%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28437_460731312Zinc fingerC2H2-type 10
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28477_500731312Zinc fingerC2H2-type 11
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28513_536731312Zinc fingerC2H2-type 12
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28560_585731312Zinc fingerC2H2-type 13%3B atypical
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28634_656731312Zinc fingerC2H2-type 14
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28664_686731312Zinc fingerC2H2-type 15
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28694_717731312Zinc fingerC2H2-type 16
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28722_745731312Zinc fingerC2H2-type 17
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28752_775731312Zinc fingerC2H2-type 18
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28783_805731312Zinc fingerC2H2-type 19
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28809_832731312Zinc fingerC2H2-type 20
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28886_908731312Zinc fingerC2H2-type 21%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28930_952731312Zinc fingerC2H2-type 22
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-28959_981731312Zinc fingerC2H2-type 23

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneZNF521chr9:36923352chr18:22807664ENST00000361524-2847_67731312Zinc fingerC2H2-type 1%3B degenerate
TgeneZNF521chr9:36923352chr18:22807664ENST00000538137-2847_67731312Zinc fingerC2H2-type 1%3B degenerate


Top

FusionGeneSequence for PAX5_ZNF521


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_PAX5_ENST00000358127_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5487nt
AAAAAAAAGAAAAAAAAAGGCACAAAAAAGTGGAAACTTTTCCCTGTCCATTCCATCAAGTCCTGAAAAATCAAAATGGATTTAGAGAAA
AATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGACGGCCACTCCCGGAT
GTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTCAGCCATGGTTGTGTC
AGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTCGCCACACCCAAAGTG
GTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCGGCTGCTGGCAGAGCGGGTGTGTGAC
AATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACCCAACCAACCAGTCCCAGCTTCCAGT
CACAGCATAGTGTCCACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCCATCAGCGGCATCCTG
GGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCCGGTGCCGAACGGCCACTCGCTTCCG
GGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCAC
TACTCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGAC
GACATGAAGGCCAATCTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCCATTGTGACAGATGGA
GTGGATGTTGAAGATGATCCGACTTGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGACTTCCCCTAGCCATGGAGAAGGTTGC
GATTTTGGAGAGGAAGAAGGTGGCCCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTTTAGCCGCCTCAGCTACCTAAAGCAC
CATGAGCAGAGTCACAGTGACAAACTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACACAAGCGCAGCCGAGATCGCCACATA
AAACTCCACACCGGGGACAAGAAGTACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGATCACTTGAAGATCCACTTAAAGACT
CACACGTCCAACAAGCCATATAAATGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTTACACGGACACATGCAGGTTCATGAG
AGGAACAAGGACGGCTCTCAGTCCGGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAAGTGCAGTCAGTGTGAGGAAGGCTTT
GACTTCCCGGAAGACCTCCAAAAACACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGACCGAGCGGCCCTCCAGTGTGTCTAC
TGCCACGAGCTCTTCGTAGAGGAGACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGAGAAGAAGAACTCATGCAGCATTTGT
TCTGAGAGTTTCCACACAGTTGAGGAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTCATGCAATCACAGCAACAGCCCTTCC
CTGGTCACGGTGGGCTATACCTCCGTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAGCTCAACCATGGTGGAAGCTGCCCCG
CCAATCCCAAAGAGTCGAGGGAGGAAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTCGAGTAAACAAGCAAAAGTTACCTAC
AGCTGTATTTACTGCAACAAACAATTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAACTATGCACTTAGATAAGCCAGAACAG
GCCCATATTTGTCAGTATTGCTTGGAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAAGCAAGTGCATGAAGCTCAGGACCCA
GGTCTGATTGTTTCTGCCATGCCTGCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAACGACCTCAACACTCTTCAGGAACAC
ATCCGATGTTCTCATGGATTTGCAAACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCATTGCTATATGGGGTTTCTCACTGAC
TCTTCCCTGGAAGAGCATATTAGACAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCCAGTGCTTGGGACTCCCAAAGAACCA
GTAGTAGAAGTCTATTCTTGTTCCTATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACTGAACAAGCATATCAAAGAGAATCAT
AAAAACATTCCCTTGGCCCTGAATTATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCTATCTCCTGTGGCCATAGAGCAGACA
TCTCTTAAGATGATGCAGGCAGTAGGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAATCAATGTGGTGCTAAGTACACATCC
CTAGACAGCTTTCAGACTCACCTAAAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCCTCAGTGCAACAAGGAATTCCCCAAC
CAAGAATCCTTGCTGAAGCATGTTACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGAGAGTTGTGACAAGCAATTCACATCA
GTGGATGACCTTCAGAAACACCTGCTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTGCCAGGAAGTTTTTGACTCAAAAGTC
TCCATTCAGCTCCACTTGGCTGTGAAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTGCAACTGGGACTTCCGCAACGAAACT
GACTTGCAGCTCCATGTGAAACACAACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTTCTGCGGTGAGTCCTTTGGCACCGAG
GTGGAGCTGCAATGCCACATCACCACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGCCTTCCATGCGATCATTTTGTTAGAA
AAACACTTGCGAGAAAAACACTGTGTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGCTTCCGAGCAAGTGCAGAAAGAGGAA
GTGGAGCTGCAGACTTTGCTGACCAACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGAAGACGTTGACACCTCTGAGCCTATG
TACGGCTGCGACATTTGTGGGGCAGCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCGAGACCACAACATCAGACCTGGAGAA
AGTGCCATCGTGAAAAAGAAAGCTGAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCGAACCTTCTTCTCCGAAAATGGCCTC
CGGGAACATATGCAGACCCACCTAGGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCGGTTTCCCTCCCTTTTAACTCTTACT
GAACACAAAGTCACGCATAGTAAGAGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCTCCAGAGTGAAGAGGAGTTTTTAGAG
CATTGCCAAATGCACCCTGACTTGAGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCAGACAGTGACCTCCACCTTGGAACTC
AAAATCCATGGGACGTTCCACATGCAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCGGGGCCAGCACGTCCAAAAACTGTAT
AAGTGCGCATCTTGCCTCAAAGAATTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGGCCTGCCATATGGTCTGTGTGCCGGC
TGCGTGAATCTCAGTAAGAGCGCCAGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGGCTTGGGCCAGAATGAGAATCTGAGT
GCCATTGAGGGGAAAGGCAAGGTGGGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTTTGAGTCTGAAAGTGAACTCCAGAAC
CACATCCAAACCATCCACCGAGAGCTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCAAGTATCACCAATGCCCAGAATCAGT
CCCTCCCAGTCGGATGAGAAGAAGACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGAATGGGATATTCAGGTTCATGTTGCA
AATCACATGATTGATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATA
GAGCACAGCTTCGAAGGGATGGGAGGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCAAGCAAACAAGTTGCAGCAGCATATT
TTCTCTGCCCATGGACAAGAAGACAAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTTCCAAACAGAGCTGCAGAATCATACA
ATGACCCAACACAGCAGTTAGTGCAAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAAAGGGAACATGTTTTACTCTTTGCAC
GAAACTTTCATTGTTAATGTATATTATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATCAAACTGTTGGATGTTCATGTGTTTG
AACTTTTGCGCACCGGATAGACCCCTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATACTAAAATGGTCTTATAAAGACAAGT
GGACTTGGGCCCTATTCAGGCAAGATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGATAAAGTATTTTTAAGGAAGAAAGATT
AAAAACAACTGTTATACATGAGACTATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATTTCTCTTTAGGTATATCAGCGCTTAA
ATCCAAGACTATTTTTTATTGCTGAAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAGAACCCCACAGCTGGATAAGGCCCGT
ATATATATATTTGTAAGCCTTGCAATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATGTAGACTGTCAAAGAATTTTTTTTTC
CCTGGATACATTTGAAGCTTTGAGTGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCTTGAATCAGTTGAACTAACCTGTATG

>In-frame_PAX5_ENST00000377852_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5422nt
AAAAATCAAAATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTT
TGTGAATGGACGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCA
GCTTCGGGTCAGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAA
ACCAAAGGTCGCCACACCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCG
GCTGCTGGCAGAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACC
CAACCAACCAGTCCCAGCTTCCAGTCACAGCATAGTGTCCACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTC
GTCGTACTCCATCAGCGGCATCCTGGGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCC
GGTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCT
GGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCAT
GGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAATCTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCA
GTCCTACCCCATTGTGACAGATGGAGTGGATGTTGAAGATGATCCGACTTGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGAC
TTCCCCTAGCCATGGAGAAGGTTGCGATTTTGGAGAGGAAGAAGGTGGCCCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTT
TAGCCGCCTCAGCTACCTAAAGCACCATGAGCAGAGTCACAGTGACAAACTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACA
CAAGCGCAGCCGAGATCGCCACATAAAACTCCACACCGGGGACAAGAAGTACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGA
TCACTTGAAGATCCACTTAAAGACTCACACGTCCAACAAGCCATATAAATGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTT
ACACGGACACATGCAGGTTCATGAGAGGAACAAGGACGGCTCTCAGTCCGGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAA
GTGCAGTCAGTGTGAGGAAGGCTTTGACTTCCCGGAAGACCTCCAAAAACACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGA
CCGAGCGGCCCTCCAGTGTGTCTACTGCCACGAGCTCTTCGTAGAGGAGACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGA
GAAGAAGAACTCATGCAGCATTTGTTCTGAGAGTTTCCACACAGTTGAGGAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTC
ATGCAATCACAGCAACAGCCCTTCCCTGGTCACGGTGGGCTATACCTCCGTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAG
CTCAACCATGGTGGAAGCTGCCCCGCCAATCCCAAAGAGTCGAGGGAGGAAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTC
GAGTAAACAAGCAAAAGTTACCTACAGCTGTATTTACTGCAACAAACAATTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAAC
TATGCACTTAGATAAGCCAGAACAGGCCCATATTTGTCAGTATTGCTTGGAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAA
GCAAGTGCATGAAGCTCAGGACCCAGGTCTGATTGTTTCTGCCATGCCTGCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAA
CGACCTCAACACTCTTCAGGAACACATCCGATGTTCTCATGGATTTGCAAACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCA
TTGCTATATGGGGTTTCTCACTGACTCTTCCCTGGAAGAGCATATTAGACAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCC
AGTGCTTGGGACTCCCAAAGAACCAGTAGTAGAAGTCTATTCTTGTTCCTATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACT
GAACAAGCATATCAAAGAGAATCATAAAAACATTCCCTTGGCCCTGAATTATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCT
ATCTCCTGTGGCCATAGAGCAGACATCTCTTAAGATGATGCAGGCAGTAGGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAA
TCAATGTGGTGCTAAGTACACATCCCTAGACAGCTTTCAGACTCACCTAAAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCC
TCAGTGCAACAAGGAATTCCCCAACCAAGAATCCTTGCTGAAGCATGTTACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGA
GAGTTGTGACAAGCAATTCACATCAGTGGATGACCTTCAGAAACACCTGCTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTG
CCAGGAAGTTTTTGACTCAAAAGTCTCCATTCAGCTCCACTTGGCTGTGAAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTG
CAACTGGGACTTCCGCAACGAAACTGACTTGCAGCTCCATGTGAAACACAACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTT
CTGCGGTGAGTCCTTTGGCACCGAGGTGGAGCTGCAATGCCACATCACCACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGC
CTTCCATGCGATCATTTTGTTAGAAAAACACTTGCGAGAAAAACACTGTGTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGC
TTCCGAGCAAGTGCAGAAAGAGGAAGTGGAGCTGCAGACTTTGCTGACCAACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGA
AGACGTTGACACCTCTGAGCCTATGTACGGCTGCGACATTTGTGGGGCAGCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCG
AGACCACAACATCAGACCTGGAGAAAGTGCCATCGTGAAAAAGAAAGCTGAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCG
AACCTTCTTCTCCGAAAATGGCCTCCGGGAACATATGCAGACCCACCTAGGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCG
GTTTCCCTCCCTTTTAACTCTTACTGAACACAAAGTCACGCATAGTAAGAGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCT
CCAGAGTGAAGAGGAGTTTTTAGAGCATTGCCAAATGCACCCTGACTTGAGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCA
GACAGTGACCTCCACCTTGGAACTCAAAATCCATGGGACGTTCCACATGCAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCG
GGGCCAGCACGTCCAAAAACTGTATAAGTGCGCATCTTGCCTCAAAGAATTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGG
CCTGCCATATGGTCTGTGTGCCGGCTGCGTGAATCTCAGTAAGAGCGCCAGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGG
CTTGGGCCAGAATGAGAATCTGAGTGCCATTGAGGGGAAAGGCAAGGTGGGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTT
TGAGTCTGAAAGTGAACTCCAGAACCACATCCAAACCATCCACCGAGAGCTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCA
AGTATCACCAATGCCCAGAATCAGTCCCTCCCAGTCGGATGAGAAGAAGACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGA
ATGGGATATTCAGGTTCATGTTGCAAATCACATGATTGATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCC
TGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCGAAGGGATGGGAGGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCA
AGCAAACAAGTTGCAGCAGCATATTTTCTCTGCCCATGGACAAGAAGACAAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTT
CCAAACAGAGCTGCAGAATCATACAATGACCCAACACAGCAGTTAGTGCAAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAA
AGGGAACATGTTTTACTCTTTGCACGAAACTTTCATTGTTAATGTATATTATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATC
AAACTGTTGGATGTTCATGTGTTTGAACTTTTGCGCACCGGATAGACCCCTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATA
CTAAAATGGTCTTATAAAGACAAGTGGACTTGGGCCCTATTCAGGCAAGATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGAT
AAAGTATTTTTAAGGAAGAAAGATTAAAAACAACTGTTATACATGAGACTATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATT
TCTCTTTAGGTATATCAGCGCTTAAATCCAAGACTATTTTTTATTGCTGAAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAG
AACCCCACAGCTGGATAAGGCCCGTATATATATATTTGTAAGCCTTGCAATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATG
TAGACTGTCAAAGAATTTTTTTTTCCCTGGATACATTTGAAGCTTTGAGTGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCT
TGAATCAGTTGAACTAACCTGTATGTTACTGTTATTAATGTTTACTCTGCAGTCTGAACCTGGAGATTACTGGAATTGTTTTCCAAGAGG

>In-frame_PAX5_ENST00000377853_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5422nt
AAAAATCAAAATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTT
TGTGAATGGACGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCA
GCTTCGGGTCAGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAA
ACCAAAGGTCGCCACACCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCG
GCTGCTGGCAGAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACC
CAACCAACCAGTCCCAGCTTCCAGTCACAGCATAGTGTCCACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTC
GTCGTACTCCATCAGCGGCATCCTGGGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCC
GGTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCT
GGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCAT
GGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAATCTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCA
GTCCTACCCCATTGTGACAGATGGAGTGGATGTTGAAGATGATCCGACTTGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGAC
TTCCCCTAGCCATGGAGAAGGTTGCGATTTTGGAGAGGAAGAAGGTGGCCCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTT
TAGCCGCCTCAGCTACCTAAAGCACCATGAGCAGAGTCACAGTGACAAACTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACA
CAAGCGCAGCCGAGATCGCCACATAAAACTCCACACCGGGGACAAGAAGTACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGA
TCACTTGAAGATCCACTTAAAGACTCACACGTCCAACAAGCCATATAAATGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTT
ACACGGACACATGCAGGTTCATGAGAGGAACAAGGACGGCTCTCAGTCCGGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAA
GTGCAGTCAGTGTGAGGAAGGCTTTGACTTCCCGGAAGACCTCCAAAAACACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGA
CCGAGCGGCCCTCCAGTGTGTCTACTGCCACGAGCTCTTCGTAGAGGAGACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGA
GAAGAAGAACTCATGCAGCATTTGTTCTGAGAGTTTCCACACAGTTGAGGAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTC
ATGCAATCACAGCAACAGCCCTTCCCTGGTCACGGTGGGCTATACCTCCGTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAG
CTCAACCATGGTGGAAGCTGCCCCGCCAATCCCAAAGAGTCGAGGGAGGAAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTC
GAGTAAACAAGCAAAAGTTACCTACAGCTGTATTTACTGCAACAAACAATTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAAC
TATGCACTTAGATAAGCCAGAACAGGCCCATATTTGTCAGTATTGCTTGGAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAA
GCAAGTGCATGAAGCTCAGGACCCAGGTCTGATTGTTTCTGCCATGCCTGCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAA
CGACCTCAACACTCTTCAGGAACACATCCGATGTTCTCATGGATTTGCAAACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCA
TTGCTATATGGGGTTTCTCACTGACTCTTCCCTGGAAGAGCATATTAGACAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCC
AGTGCTTGGGACTCCCAAAGAACCAGTAGTAGAAGTCTATTCTTGTTCCTATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACT
GAACAAGCATATCAAAGAGAATCATAAAAACATTCCCTTGGCCCTGAATTATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCT
ATCTCCTGTGGCCATAGAGCAGACATCTCTTAAGATGATGCAGGCAGTAGGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAA
TCAATGTGGTGCTAAGTACACATCCCTAGACAGCTTTCAGACTCACCTAAAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCC
TCAGTGCAACAAGGAATTCCCCAACCAAGAATCCTTGCTGAAGCATGTTACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGA
GAGTTGTGACAAGCAATTCACATCAGTGGATGACCTTCAGAAACACCTGCTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTG
CCAGGAAGTTTTTGACTCAAAAGTCTCCATTCAGCTCCACTTGGCTGTGAAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTG
CAACTGGGACTTCCGCAACGAAACTGACTTGCAGCTCCATGTGAAACACAACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTT
CTGCGGTGAGTCCTTTGGCACCGAGGTGGAGCTGCAATGCCACATCACCACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGC
CTTCCATGCGATCATTTTGTTAGAAAAACACTTGCGAGAAAAACACTGTGTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGC
TTCCGAGCAAGTGCAGAAAGAGGAAGTGGAGCTGCAGACTTTGCTGACCAACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGA
AGACGTTGACACCTCTGAGCCTATGTACGGCTGCGACATTTGTGGGGCAGCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCG
AGACCACAACATCAGACCTGGAGAAAGTGCCATCGTGAAAAAGAAAGCTGAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCG
AACCTTCTTCTCCGAAAATGGCCTCCGGGAACATATGCAGACCCACCTAGGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCG
GTTTCCCTCCCTTTTAACTCTTACTGAACACAAAGTCACGCATAGTAAGAGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCT
CCAGAGTGAAGAGGAGTTTTTAGAGCATTGCCAAATGCACCCTGACTTGAGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCA
GACAGTGACCTCCACCTTGGAACTCAAAATCCATGGGACGTTCCACATGCAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCG
GGGCCAGCACGTCCAAAAACTGTATAAGTGCGCATCTTGCCTCAAAGAATTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGG
CCTGCCATATGGTCTGTGTGCCGGCTGCGTGAATCTCAGTAAGAGCGCCAGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGG
CTTGGGCCAGAATGAGAATCTGAGTGCCATTGAGGGGAAAGGCAAGGTGGGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTT
TGAGTCTGAAAGTGAACTCCAGAACCACATCCAAACCATCCACCGAGAGCTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCA
AGTATCACCAATGCCCAGAATCAGTCCCTCCCAGTCGGATGAGAAGAAGACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGA
ATGGGATATTCAGGTTCATGTTGCAAATCACATGATTGATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCC
TGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCGAAGGGATGGGAGGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCA
AGCAAACAAGTTGCAGCAGCATATTTTCTCTGCCCATGGACAAGAAGACAAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTT
CCAAACAGAGCTGCAGAATCATACAATGACCCAACACAGCAGTTAGTGCAAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAA
AGGGAACATGTTTTACTCTTTGCACGAAACTTTCATTGTTAATGTATATTATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATC
AAACTGTTGGATGTTCATGTGTTTGAACTTTTGCGCACCGGATAGACCCCTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATA
CTAAAATGGTCTTATAAAGACAAGTGGACTTGGGCCCTATTCAGGCAAGATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGAT
AAAGTATTTTTAAGGAAGAAAGATTAAAAACAACTGTTATACATGAGACTATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATT
TCTCTTTAGGTATATCAGCGCTTAAATCCAAGACTATTTTTTATTGCTGAAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAG
AACCCCACAGCTGGATAAGGCCCGTATATATATATTTGTAAGCCTTGCAATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATG
TAGACTGTCAAAGAATTTTTTTTTCCCTGGATACATTTGAAGCTTTGAGTGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCT
TGAATCAGTTGAACTAACCTGTATGTTACTGTTATTAATGTTTACTCTGCAGTCTGAACCTGGAGATTACTGGAATTGTTTTCCAAGAGG

>In-frame_PAX5_ENST00000520281_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5283nt
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGA
CGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTC
AGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTC
GCCACACCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCGGCTGCTGGCA
GAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACCCAACCAACCA
GTCCCAGCTTCCAGTCACAGCATAGGTATTCAGGAGTCTCCGGTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAG
ATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACA
GAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAATCTGGCCAGC
CCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCCATTGTGACAGATGGAGTGGATGTTGAAGATGATCCGACT
TGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGACTTCCCCTAGCCATGGAGAAGGTTGCGATTTTGGAGAGGAAGAAGGTGGC
CCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTTTAGCCGCCTCAGCTACCTAAAGCACCATGAGCAGAGTCACAGTGACAAA
CTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACACAAGCGCAGCCGAGATCGCCACATAAAACTCCACACCGGGGACAAGAAG
TACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGATCACTTGAAGATCCACTTAAAGACTCACACGTCCAACAAGCCATATAAA
TGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTTACACGGACACATGCAGGTTCATGAGAGGAACAAGGACGGCTCTCAGTCC
GGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAAGTGCAGTCAGTGTGAGGAAGGCTTTGACTTCCCGGAAGACCTCCAAAAA
CACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGACCGAGCGGCCCTCCAGTGTGTCTACTGCCACGAGCTCTTCGTAGAGGAG
ACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGAGAAGAAGAACTCATGCAGCATTTGTTCTGAGAGTTTCCACACAGTTGAG
GAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTCATGCAATCACAGCAACAGCCCTTCCCTGGTCACGGTGGGCTATACCTCC
GTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAGCTCAACCATGGTGGAAGCTGCCCCGCCAATCCCAAAGAGTCGAGGGAGG
AAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTCGAGTAAACAAGCAAAAGTTACCTACAGCTGTATTTACTGCAACAAACAA
TTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAACTATGCACTTAGATAAGCCAGAACAGGCCCATATTTGTCAGTATTGCTTG
GAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAAGCAAGTGCATGAAGCTCAGGACCCAGGTCTGATTGTTTCTGCCATGCCT
GCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAACGACCTCAACACTCTTCAGGAACACATCCGATGTTCTCATGGATTTGCA
AACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCATTGCTATATGGGGTTTCTCACTGACTCTTCCCTGGAAGAGCATATTAGA
CAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCCAGTGCTTGGGACTCCCAAAGAACCAGTAGTAGAAGTCTATTCTTGTTCC
TATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACTGAACAAGCATATCAAAGAGAATCATAAAAACATTCCCTTGGCCCTGAAT
TATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCTATCTCCTGTGGCCATAGAGCAGACATCTCTTAAGATGATGCAGGCAGTA
GGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAATCAATGTGGTGCTAAGTACACATCCCTAGACAGCTTTCAGACTCACCTA
AAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCCTCAGTGCAACAAGGAATTCCCCAACCAAGAATCCTTGCTGAAGCATGTT
ACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGAGAGTTGTGACAAGCAATTCACATCAGTGGATGACCTTCAGAAACACCTG
CTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTGCCAGGAAGTTTTTGACTCAAAAGTCTCCATTCAGCTCCACTTGGCTGTG
AAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTGCAACTGGGACTTCCGCAACGAAACTGACTTGCAGCTCCATGTGAAACAC
AACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTTCTGCGGTGAGTCCTTTGGCACCGAGGTGGAGCTGCAATGCCACATCACC
ACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGCCTTCCATGCGATCATTTTGTTAGAAAAACACTTGCGAGAAAAACACTGT
GTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGCTTCCGAGCAAGTGCAGAAAGAGGAAGTGGAGCTGCAGACTTTGCTGACC
AACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGAAGACGTTGACACCTCTGAGCCTATGTACGGCTGCGACATTTGTGGGGCA
GCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCGAGACCACAACATCAGACCTGGAGAAAGTGCCATCGTGAAAAAGAAAGCT
GAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCGAACCTTCTTCTCCGAAAATGGCCTCCGGGAACATATGCAGACCCACCTA
GGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCGGTTTCCCTCCCTTTTAACTCTTACTGAACACAAAGTCACGCATAGTAAG
AGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCTCCAGAGTGAAGAGGAGTTTTTAGAGCATTGCCAAATGCACCCTGACTTG
AGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCAGACAGTGACCTCCACCTTGGAACTCAAAATCCATGGGACGTTCCACATG
CAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCGGGGCCAGCACGTCCAAAAACTGTATAAGTGCGCATCTTGCCTCAAAGAA
TTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGGCCTGCCATATGGTCTGTGTGCCGGCTGCGTGAATCTCAGTAAGAGCGCC
AGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGGCTTGGGCCAGAATGAGAATCTGAGTGCCATTGAGGGGAAAGGCAAGGTG
GGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTTTGAGTCTGAAAGTGAACTCCAGAACCACATCCAAACCATCCACCGAGAG
CTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCAAGTATCACCAATGCCCAGAATCAGTCCCTCCCAGTCGGATGAGAAGAAG
ACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGAATGGGATATTCAGGTTCATGTTGCAAATCACATGATTGATGAAGGACTG
AACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCGAAGGGATGGGA
GGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCAAGCAAACAAGTTGCAGCAGCATATTTTCTCTGCCCATGGACAAGAAGAC
AAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTTCCAAACAGAGCTGCAGAATCATACAATGACCCAACACAGCAGTTAGTGC
AAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAAAGGGAACATGTTTTACTCTTTGCACGAAACTTTCATTGTTAATGTATAT
TATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATCAAACTGTTGGATGTTCATGTGTTTGAACTTTTGCGCACCGGATAGACCC
CTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATACTAAAATGGTCTTATAAAGACAAGTGGACTTGGGCCCTATTCAGGCAAG
ATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGATAAAGTATTTTTAAGGAAGAAAGATTAAAAACAACTGTTATACATGAGAC
TATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATTTCTCTTTAGGTATATCAGCGCTTAAATCCAAGACTATTTTTTATTGCTG
AAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAGAACCCCACAGCTGGATAAGGCCCGTATATATATATTTGTAAGCCTTGCA
ATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATGTAGACTGTCAAAGAATTTTTTTTTCCCTGGATACATTTGAAGCTTTGAG
TGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCTTGAATCAGTTGAACTAACCTGTATGTTACTGTTATTAATGTTTACTCTG

>In-frame_PAX5_ENST00000414447_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5283nt
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGA
CGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTC
AGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTC
GCCACACCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCGGCTGCTGGCA
GAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACCCAACCAACCA
GTCCCAGCTTCCAGTCACAGCATAGGTATTCAGGAGTCTCCGGTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAG
ATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACA
GAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAATCTGGCCAGC
CCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCCATTGTGACAGATGGAGTGGATGTTGAAGATGATCCGACT
TGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGACTTCCCCTAGCCATGGAGAAGGTTGCGATTTTGGAGAGGAAGAAGGTGGC
CCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTTTAGCCGCCTCAGCTACCTAAAGCACCATGAGCAGAGTCACAGTGACAAA
CTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACACAAGCGCAGCCGAGATCGCCACATAAAACTCCACACCGGGGACAAGAAG
TACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGATCACTTGAAGATCCACTTAAAGACTCACACGTCCAACAAGCCATATAAA
TGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTTACACGGACACATGCAGGTTCATGAGAGGAACAAGGACGGCTCTCAGTCC
GGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAAGTGCAGTCAGTGTGAGGAAGGCTTTGACTTCCCGGAAGACCTCCAAAAA
CACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGACCGAGCGGCCCTCCAGTGTGTCTACTGCCACGAGCTCTTCGTAGAGGAG
ACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGAGAAGAAGAACTCATGCAGCATTTGTTCTGAGAGTTTCCACACAGTTGAG
GAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTCATGCAATCACAGCAACAGCCCTTCCCTGGTCACGGTGGGCTATACCTCC
GTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAGCTCAACCATGGTGGAAGCTGCCCCGCCAATCCCAAAGAGTCGAGGGAGG
AAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTCGAGTAAACAAGCAAAAGTTACCTACAGCTGTATTTACTGCAACAAACAA
TTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAACTATGCACTTAGATAAGCCAGAACAGGCCCATATTTGTCAGTATTGCTTG
GAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAAGCAAGTGCATGAAGCTCAGGACCCAGGTCTGATTGTTTCTGCCATGCCT
GCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAACGACCTCAACACTCTTCAGGAACACATCCGATGTTCTCATGGATTTGCA
AACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCATTGCTATATGGGGTTTCTCACTGACTCTTCCCTGGAAGAGCATATTAGA
CAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCCAGTGCTTGGGACTCCCAAAGAACCAGTAGTAGAAGTCTATTCTTGTTCC
TATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACTGAACAAGCATATCAAAGAGAATCATAAAAACATTCCCTTGGCCCTGAAT
TATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCTATCTCCTGTGGCCATAGAGCAGACATCTCTTAAGATGATGCAGGCAGTA
GGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAATCAATGTGGTGCTAAGTACACATCCCTAGACAGCTTTCAGACTCACCTA
AAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCCTCAGTGCAACAAGGAATTCCCCAACCAAGAATCCTTGCTGAAGCATGTT
ACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGAGAGTTGTGACAAGCAATTCACATCAGTGGATGACCTTCAGAAACACCTG
CTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTGCCAGGAAGTTTTTGACTCAAAAGTCTCCATTCAGCTCCACTTGGCTGTG
AAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTGCAACTGGGACTTCCGCAACGAAACTGACTTGCAGCTCCATGTGAAACAC
AACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTTCTGCGGTGAGTCCTTTGGCACCGAGGTGGAGCTGCAATGCCACATCACC
ACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGCCTTCCATGCGATCATTTTGTTAGAAAAACACTTGCGAGAAAAACACTGT
GTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGCTTCCGAGCAAGTGCAGAAAGAGGAAGTGGAGCTGCAGACTTTGCTGACC
AACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGAAGACGTTGACACCTCTGAGCCTATGTACGGCTGCGACATTTGTGGGGCA
GCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCGAGACCACAACATCAGACCTGGAGAAAGTGCCATCGTGAAAAAGAAAGCT
GAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCGAACCTTCTTCTCCGAAAATGGCCTCCGGGAACATATGCAGACCCACCTA
GGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCGGTTTCCCTCCCTTTTAACTCTTACTGAACACAAAGTCACGCATAGTAAG
AGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCTCCAGAGTGAAGAGGAGTTTTTAGAGCATTGCCAAATGCACCCTGACTTG
AGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCAGACAGTGACCTCCACCTTGGAACTCAAAATCCATGGGACGTTCCACATG
CAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCGGGGCCAGCACGTCCAAAAACTGTATAAGTGCGCATCTTGCCTCAAAGAA
TTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGGCCTGCCATATGGTCTGTGTGCCGGCTGCGTGAATCTCAGTAAGAGCGCC
AGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGGCTTGGGCCAGAATGAGAATCTGAGTGCCATTGAGGGGAAAGGCAAGGTG
GGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTTTGAGTCTGAAAGTGAACTCCAGAACCACATCCAAACCATCCACCGAGAG
CTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCAAGTATCACCAATGCCCAGAATCAGTCCCTCCCAGTCGGATGAGAAGAAG
ACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGAATGGGATATTCAGGTTCATGTTGCAAATCACATGATTGATGAAGGACTG
AACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCGAAGGGATGGGA
GGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCAAGCAAACAAGTTGCAGCAGCATATTTTCTCTGCCCATGGACAAGAAGAC
AAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTTCCAAACAGAGCTGCAGAATCATACAATGACCCAACACAGCAGTTAGTGC
AAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAAAGGGAACATGTTTTACTCTTTGCACGAAACTTTCATTGTTAATGTATAT
TATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATCAAACTGTTGGATGTTCATGTGTTTGAACTTTTGCGCACCGGATAGACCC
CTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATACTAAAATGGTCTTATAAAGACAAGTGGACTTGGGCCCTATTCAGGCAAG
ATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGATAAAGTATTTTTAAGGAAGAAAGATTAAAAACAACTGTTATACATGAGAC
TATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATTTCTCTTTAGGTATATCAGCGCTTAAATCCAAGACTATTTTTTATTGCTG
AAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAGAACCCCACAGCTGGATAAGGCCCGTATATATATATTTGTAAGCCTTGCA
ATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATGTAGACTGTCAAAGAATTTTTTTTTCCCTGGATACATTTGAAGCTTTGAG
TGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCTTGAATCAGTTGAACTAACCTGTATGTTACTGTTATTAATGTTTACTCTG

>In-frame_PAX5_ENST00000446742_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5214nt
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGA
CGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTC
AGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGATCATCCGGACAAAAGTACAGCAGCCACCCAACCAACCAGTCCCAGCTTCCAGTCAC
AGCATAGTGTCCACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCCATCAGCGGCATCCTGGGC
ATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCCGGTGCCGAACGGCCACTCGCTTCCGGGC
AGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCACTAC
TCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGACGAC
ATGAAGGCCAATCTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCCATTGTGACAGATGGAGTG
GATGTTGAAGATGATCCGACTTGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGACTTCCCCTAGCCATGGAGAAGGTTGCGAT
TTTGGAGAGGAAGAAGGTGGCCCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTTTAGCCGCCTCAGCTACCTAAAGCACCAT
GAGCAGAGTCACAGTGACAAACTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACACAAGCGCAGCCGAGATCGCCACATAAAA
CTCCACACCGGGGACAAGAAGTACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGATCACTTGAAGATCCACTTAAAGACTCAC
ACGTCCAACAAGCCATATAAATGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTTACACGGACACATGCAGGTTCATGAGAGG
AACAAGGACGGCTCTCAGTCCGGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAAGTGCAGTCAGTGTGAGGAAGGCTTTGAC
TTCCCGGAAGACCTCCAAAAACACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGACCGAGCGGCCCTCCAGTGTGTCTACTGC
CACGAGCTCTTCGTAGAGGAGACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGAGAAGAAGAACTCATGCAGCATTTGTTCT
GAGAGTTTCCACACAGTTGAGGAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTCATGCAATCACAGCAACAGCCCTTCCCTG
GTCACGGTGGGCTATACCTCCGTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAGCTCAACCATGGTGGAAGCTGCCCCGCCA
ATCCCAAAGAGTCGAGGGAGGAAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTCGAGTAAACAAGCAAAAGTTACCTACAGC
TGTATTTACTGCAACAAACAATTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAACTATGCACTTAGATAAGCCAGAACAGGCC
CATATTTGTCAGTATTGCTTGGAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAAGCAAGTGCATGAAGCTCAGGACCCAGGT
CTGATTGTTTCTGCCATGCCTGCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAACGACCTCAACACTCTTCAGGAACACATC
CGATGTTCTCATGGATTTGCAAACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCATTGCTATATGGGGTTTCTCACTGACTCT
TCCCTGGAAGAGCATATTAGACAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCCAGTGCTTGGGACTCCCAAAGAACCAGTA
GTAGAAGTCTATTCTTGTTCCTATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACTGAACAAGCATATCAAAGAGAATCATAAA
AACATTCCCTTGGCCCTGAATTATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCTATCTCCTGTGGCCATAGAGCAGACATCT
CTTAAGATGATGCAGGCAGTAGGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAATCAATGTGGTGCTAAGTACACATCCCTA
GACAGCTTTCAGACTCACCTAAAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCCTCAGTGCAACAAGGAATTCCCCAACCAA
GAATCCTTGCTGAAGCATGTTACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGAGAGTTGTGACAAGCAATTCACATCAGTG
GATGACCTTCAGAAACACCTGCTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTGCCAGGAAGTTTTTGACTCAAAAGTCTCC
ATTCAGCTCCACTTGGCTGTGAAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTGCAACTGGGACTTCCGCAACGAAACTGAC
TTGCAGCTCCATGTGAAACACAACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTTCTGCGGTGAGTCCTTTGGCACCGAGGTG
GAGCTGCAATGCCACATCACCACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGCCTTCCATGCGATCATTTTGTTAGAAAAA
CACTTGCGAGAAAAACACTGTGTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGCTTCCGAGCAAGTGCAGAAAGAGGAAGTG
GAGCTGCAGACTTTGCTGACCAACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGAAGACGTTGACACCTCTGAGCCTATGTAC
GGCTGCGACATTTGTGGGGCAGCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCGAGACCACAACATCAGACCTGGAGAAAGT
GCCATCGTGAAAAAGAAAGCTGAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCGAACCTTCTTCTCCGAAAATGGCCTCCGG
GAACATATGCAGACCCACCTAGGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCGGTTTCCCTCCCTTTTAACTCTTACTGAA
CACAAAGTCACGCATAGTAAGAGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCTCCAGAGTGAAGAGGAGTTTTTAGAGCAT
TGCCAAATGCACCCTGACTTGAGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCAGACAGTGACCTCCACCTTGGAACTCAAA
ATCCATGGGACGTTCCACATGCAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCGGGGCCAGCACGTCCAAAAACTGTATAAG
TGCGCATCTTGCCTCAAAGAATTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGGCCTGCCATATGGTCTGTGTGCCGGCTGC
GTGAATCTCAGTAAGAGCGCCAGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGGCTTGGGCCAGAATGAGAATCTGAGTGCC
ATTGAGGGGAAAGGCAAGGTGGGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTTTGAGTCTGAAAGTGAACTCCAGAACCAC
ATCCAAACCATCCACCGAGAGCTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCAAGTATCACCAATGCCCAGAATCAGTCCC
TCCCAGTCGGATGAGAAGAAGACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGAATGGGATATTCAGGTTCATGTTGCAAAT
CACATGATTGATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAG
CACAGCTTCGAAGGGATGGGAGGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCAAGCAAACAAGTTGCAGCAGCATATTTTC
TCTGCCCATGGACAAGAAGACAAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTTCCAAACAGAGCTGCAGAATCATACAATG
ACCCAACACAGCAGTTAGTGCAAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAAAGGGAACATGTTTTACTCTTTGCACGAA
ACTTTCATTGTTAATGTATATTATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATCAAACTGTTGGATGTTCATGTGTTTGAAC
TTTTGCGCACCGGATAGACCCCTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATACTAAAATGGTCTTATAAAGACAAGTGGA
CTTGGGCCCTATTCAGGCAAGATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGATAAAGTATTTTTAAGGAAGAAAGATTAAA
AACAACTGTTATACATGAGACTATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATTTCTCTTTAGGTATATCAGCGCTTAAATC
CAAGACTATTTTTTATTGCTGAAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAGAACCCCACAGCTGGATAAGGCCCGTATA
TATATATTTGTAAGCCTTGCAATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATGTAGACTGTCAAAGAATTTTTTTTTCCCT
GGATACATTTGAAGCTTTGAGTGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCTTGAATCAGTTGAACTAACCTGTATGTTA

>In-frame_PAX5_ENST00000377847_chr9_36923352_-_ZNF521_ENST00000361524_chr18_22807664_-_5412nt
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTGGGGGGGTTTTTGTGAATGGA
CGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTC
AGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTC
GCCACACCCAAAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCGGCTGCTGGCA
GAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGGACAAAAGTACAGCAGCCACCCAACCAACCA
GTCCCAGCTTCCAGTCACAGCATAGTGTCCACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCC
ATCAGCGGCATCCTGGGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCCGGTGCCGAAC
GGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTG
TTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTG
GCTGGTGGGCTGGACGACATGAAGGCCAATCTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCC
ATTGTGACAGATGGAGTGGATGTTGAAGATGATCCGACTTGCTCTTGGCCAGCTTCCTCACCTTCTAGCAAGGATCAGACTTCCCCTAGC
CATGGAGAAGGTTGCGATTTTGGAGAGGAAGAAGGTGGCCCTGGGCTTCCATACCCGTGTCAATTCTGTGACAAGTCGTTTAGCCGCCTC
AGCTACCTAAAGCACCATGAGCAGAGTCACAGTGACAAACTGCCTTTCAAATGCACCTACTGCAGTAGGCTGTTCAAACACAAGCGCAGC
CGAGATCGCCACATAAAACTCCACACCGGGGACAAGAAGTACCACTGCAGTGAATGTGATGCTGCGTTTTCCAGAAGTGATCACTTGAAG
ATCCACTTAAAGACTCACACGTCCAACAAGCCATATAAATGTGCCATTTGTCGCCGTGGGTTTCTGTCCTCTAGTTCCTTACACGGACAC
ATGCAGGTTCATGAGAGGAACAAGGACGGCTCTCAGTCCGGTTCCAGGATGGAGGACTGGAAGATGAAGGACACTCAGAAGTGCAGTCAG
TGTGAGGAAGGCTTTGACTTCCCGGAAGACCTCCAAAAACACATTGCAGAGTGCCACCCCGAATGCTCCCCAAATGAGGACCGAGCGGCC
CTCCAGTGTGTCTACTGCCACGAGCTCTTCGTAGAGGAGACCTCCCTCATGAACCACATGGAGCAGGTGCATAGCGGGGAGAAGAAGAAC
TCATGCAGCATTTGTTCTGAGAGTTTCCACACAGTTGAGGAACTGTACAGCCACATGGACAGTCACCAGCAACCGGAGTCATGCAATCAC
AGCAACAGCCCTTCCCTGGTCACGGTGGGCTATACCTCCGTGTCCAGTACGACTCCAGATTCCAACCTCTCAGTGGACAGCTCAACCATG
GTGGAAGCTGCCCCGCCAATCCCAAAGAGTCGAGGGAGGAAGAGGGCCGCTCAACAAACCCCTGACATGACTGGTCCCTCGAGTAAACAA
GCAAAAGTTACCTACAGCTGTATTTACTGCAACAAACAATTATTTTCAAGTCTTGCAGTTCTGCAGATTCACCTGAAAACTATGCACTTA
GATAAGCCAGAACAGGCCCATATTTGTCAGTATTGCTTGGAGGTCCTGCCCTCACTCTATAACCTAAATGAACATCTTAAGCAAGTGCAT
GAAGCTCAGGACCCAGGTCTGATTGTTTCTGCCATGCCTGCCATTGTCTACCAGTGTAACTTCTGTTCCGAAGTTGTCAACGACCTCAAC
ACTCTTCAGGAACACATCCGATGTTCTCATGGATTTGCAAACCCTGCAGCTAAAGATAGTAATGCATTCTTTTGTCCCCATTGCTATATG
GGGTTTCTCACTGACTCTTCCCTGGAAGAGCATATTAGACAGGTTCATTGTGACCTCAGTGGCTCCCGATTTGGGTCTCCAGTGCTTGGG
ACTCCCAAAGAACCAGTAGTAGAAGTCTATTCTTGTTCCTATTGTACAAATTCGCCAATATTCAACAGCGTTCTTAAACTGAACAAGCAT
ATCAAAGAGAATCATAAAAACATTCCCTTGGCCCTGAATTATATCCACAATGGGAAGAAATCCAGGGCCTTAAGCCCCCTATCTCCTGTG
GCCATAGAGCAGACATCTCTTAAGATGATGCAGGCAGTAGGAGGTGCACCTGCACGTCCCACTGGAGAATATATCTGTAATCAATGTGGT
GCTAAGTACACATCCCTAGACAGCTTTCAGACTCACCTAAAAACTCATCTCGACACTGTGCTTCCAAAATTGACCTGTCCTCAGTGCAAC
AAGGAATTCCCCAACCAAGAATCCTTGCTGAAGCATGTTACCATTCACTTTATGATCACTTCAACGTATTACATCTGTGAGAGTTGTGAC
AAGCAATTCACATCAGTGGATGACCTTCAGAAACACCTGCTGGACATGCACACCTTTGTCTTCTTTCGCTGCACCCTCTGCCAGGAAGTT
TTTGACTCAAAAGTCTCCATTCAGCTCCACTTGGCTGTGAAGCACAGTAACGAAAAGAAAGTCTATAGGTGCACATCTTGCAACTGGGAC
TTCCGCAACGAAACTGACTTGCAGCTCCATGTGAAACACAACCACCTGGAAAACCAAGGGAAAGTGCATAAGTGCATTTTCTGCGGTGAG
TCCTTTGGCACCGAGGTGGAGCTGCAATGCCACATCACCACTCACAGTAAGAAGTACAACTGCAAGTTCTGTAGCAAAGCCTTCCATGCG
ATCATTTTGTTAGAAAAACACTTGCGAGAAAAACACTGTGTATTCGAAACCAAGACACCCAACTGTGGAACAAATGGAGCTTCCGAGCAA
GTGCAGAAAGAGGAAGTGGAGCTGCAGACTTTGCTGACCAACAGCCAGGAGTCCCACAACAGTCACGATGGGAGCGAAGAAGACGTTGAC
ACCTCTGAGCCTATGTACGGCTGCGACATTTGTGGGGCAGCCTACACTATGGAAACTTTGCTGCAGAATCACCAGCTCCGAGACCACAAC
ATCAGACCTGGAGAAAGTGCCATCGTGAAAAAGAAAGCTGAGCTCATTAAAGGGAATTACAAGTGCAACGTGTGCTCTCGAACCTTCTTC
TCCGAAAATGGCCTCCGGGAACATATGCAGACCCACCTAGGCCCTGTCAAACACTACATGTGCCCTATTTGCGGAGAGCGGTTTCCCTCC
CTTTTAACTCTTACTGAACACAAAGTCACGCATAGTAAGAGTCTTGATACTGGAAACTGCCGGATTTGCAAGATGCCTCTCCAGAGTGAA
GAGGAGTTTTTAGAGCATTGCCAAATGCACCCTGACTTGAGGAATTCCCTGACAGGCTTTCGCTGCGTGGTGTGCATGCAGACAGTGACC
TCCACCTTGGAACTCAAAATCCATGGGACGTTCCACATGCAAAAGACAGGGAATGGGTCTGCAGTTCAGACCACAGGGCGGGGCCAGCAC
GTCCAAAAACTGTATAAGTGCGCATCTTGCCTCAAAGAATTCCGTTCCAAGCAAGATCTGGTGAAACTTGATATCAATGGCCTGCCATAT
GGTCTGTGTGCCGGCTGCGTGAATCTCAGTAAGAGCGCCAGCCCAGGCATTAACGTCCCTCCCGGCACGAATAGACCAGGCTTGGGCCAG
AATGAGAATCTGAGTGCCATTGAGGGGAAAGGCAAGGTGGGGGGACTGAAGACACGCTGCTCTAGCTGCAACGTTAAGTTTGAGTCTGAA
AGTGAACTCCAGAACCACATCCAAACCATCCACCGAGAGCTCGTGCCAGACAGCAACAGCACACAGTTGAAAACGCCCCAAGTATCACCA
ATGCCCAGAATCAGTCCCTCCCAGTCGGATGAGAAGAAGACCTATCAATGCATCAAGTGTCAGATGGTTTTCTACAATGAATGGGATATT
CAGGTTCATGTTGCAAATCACATGATTGATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTC
CAGTGCCACCTGATAGAGCACAGCTTCGAAGGGATGGGAGGCACCTTCAAGTGTCCAGTCTGCTTTACAGTATTTGTTCAAGCAAACAAG
TTGCAGCAGCATATTTTCTCTGCCCATGGACAAGAAGACAAGATCTATGACTGTACACAATGTCCACAGAAGTTTTTCTTCCAAACAGAG
CTGCAGAATCATACAATGACCCAACACAGCAGTTAGTGCAAGTACAGTCTCTCAAGGAGAATTGATTTTGTGGCACAAAAAGGGAACATG
TTTTACTCTTTGCACGAAACTTTCATTGTTAATGTATATTATTCAGAAACATTGTATTGTACCATAAAACTTGTATTATCAAACTGTTGG
ATGTTCATGTGTTTGAACTTTTGCGCACCGGATAGACCCCTTGTATATAAAGTGTTGCACATGTATTATGTCGTCTGATACTAAAATGGT
CTTATAAAGACAAGTGGACTTGGGCCCTATTCAGGCAAGATTAAAAAAAAAAAAAGACTATGACCAAAATGGCTTAAGATAAAGTATTTT
TAAGGAAGAAAGATTAAAAACAACTGTTATACATGAGACTATGGTTGGACTTCCTTTTCTTTACACTTAAGCCTAGAATTTCTCTTTAGG
TATATCAGCGCTTAAATCCAAGACTATTTTTTATTGCTGAAGATTCTTGCAAACCATGAAGAGATGTTCTCACAGAACAGAACCCCACAG
CTGGATAAGGCCCGTATATATATATTTGTAAGCCTTGCAATGTGACAGGTAGCATCACTATATATGCAATAGTTGTTATGTAGACTGTCA
AAGAATTTTTTTTTCCCTGGATACATTTGAAGCTTTGAGTGTTCAAGGTTTTCCTTAATGATTTCACGCAGCCAAATTCTTGAATCAGTT
GAACTAACCTGTATGTTACTGTTATTAATGTTTACTCTGCAGTCTGAACCTGGAGATTACTGGAATTGTTTTCCAAGAGGAAATAAATTC


Top

FusionGenePPI for PAX5_ZNF521


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
PAX5TLE4, DAXX, RUNX1, MYB, ID3, EP300, TBP, RB1, MAPK1ZNF521LYST, ELAVL1, SMAD1, SMAD4, HDAC1, MTA1, ZNF219, RBBP7, MBD3L1, BRAP


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for PAX5_ZNF521


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for PAX5_ZNF521


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgenePAX5C1961102Precursor Cell Lymphoblastic Leukemia Lymphoma2CTD_human;UNIPROT
HgenePAX5C0023485Precursor B-Cell Lymphoblastic Leukemia-Lymphoma1CTD_human