FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 24995

FusionGeneSummary for NTM_CARD18

check button Fusion gene summary
Fusion gene informationFusion gene name: NTM_CARD18
Fusion gene ID: 24995
HgeneTgene
Gene symbol

NTM

CARD18

Gene ID

50863

59082

Gene nameneurotrimincaspase recruitment domain family member 18
SynonymsCEPU-1|HNT|IGLON2|NTRIICEBERG|UNQ5804|pseudo-ICE
Cytomap

11q25

11q22.3

Type of geneprotein-codingprotein-coding
DescriptionneurotriminIgLON family member 2caspase recruitment domain-containing protein 18ICEBERG caspase-1 inhibitorcaspase-1 inhibitor Iceberg
Modification date2018052220180522
UniProtAcc

Q9P121

P57730

Ensembl transtripts involved in fusion geneENST00000374791, ENST00000539799, 
ENST00000427481, ENST00000374786, 
ENST00000425719, ENST00000374784, 
ENST00000474900, 
ENST00000530950, 
ENST00000526823, ENST00000532895, 
Fusion gene scores* DoF score5 X 4 X 4=802 X 1 X 1=2
# samples 52
** MAII scorelog2(5/80*10)=-0.678071905112638
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(2/2*10)=3.32192809488736
Context

PubMed: NTM [Title/Abstract] AND CARD18 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneCARD18

GO:0032091

negative regulation of protein binding

11536016

TgeneCARD18

GO:0050713

negative regulation of interleukin-1 beta secretion

11536016|11821383

TgeneCARD18

GO:0097340

inhibition of cysteine-type endopeptidase activity

11821383


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVPRADTCGA-EJ-7781-01ANTMchr11

131240783

+CARD18chr11

105009805

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000374791ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
5CDS-5UTRENST00000374791ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
5CDS-5UTRENST00000374791ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
In-frameENST00000539799ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
5CDS-5UTRENST00000539799ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
5CDS-5UTRENST00000539799ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
intron-3CDSENST00000427481ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000427481ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000427481ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
intron-3CDSENST00000374786ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000374786ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000374786ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
intron-3CDSENST00000425719ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000425719ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000425719ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
intron-3CDSENST00000374784ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000374784ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000374784ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-
intron-3CDSENST00000474900ENST00000530950NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000474900ENST00000526823NTMchr11

131240783

+CARD18chr11

105009805

-
intron-5UTRENST00000474900ENST00000532895NTMchr11

131240783

+CARD18chr11

105009805

-

Top

FusionProtFeatures for NTM_CARD18


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
NTM

Q9P121

CARD18

P57730

Neural cell adhesion molecule. Inhibits generation of IL-1-beta by interacting withcaspase-1 and preventing its association with RIP2. Down-regulatesthe release of IL1B. {ECO:0000269|PubMed:11051551}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneCARD18chr11:131240783chr11:105009805ENST00000530950-031_902214DomainCARD

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNTMchr11:131240783chr11:105009805ENST00000374784+16136_218-5317DomainNote=Ig-like C2-type 2
HgeneNTMchr11:131240783chr11:105009805ENST00000374784+16222_309-5317DomainNote=Ig-like C2-type 3
HgeneNTMchr11:131240783chr11:105009805ENST00000374784+1639_126-5317DomainNote=Ig-like C2-type 1
HgeneNTMchr11:131240783chr11:105009805ENST00000374786+17136_218-160345DomainNote=Ig-like C2-type 2
HgeneNTMchr11:131240783chr11:105009805ENST00000374786+17222_309-160345DomainNote=Ig-like C2-type 3
HgeneNTMchr11:131240783chr11:105009805ENST00000374786+1739_126-160345DomainNote=Ig-like C2-type 1
HgeneNTMchr11:131240783chr11:105009805ENST00000374791+18136_21827345DomainNote=Ig-like C2-type 2
HgeneNTMchr11:131240783chr11:105009805ENST00000374791+18222_30927345DomainNote=Ig-like C2-type 3
HgeneNTMchr11:131240783chr11:105009805ENST00000374791+1839_12627345DomainNote=Ig-like C2-type 1
HgeneNTMchr11:131240783chr11:105009805ENST00000425719+18136_218-7356DomainNote=Ig-like C2-type 2
HgeneNTMchr11:131240783chr11:105009805ENST00000425719+18222_309-7356DomainNote=Ig-like C2-type 3
HgeneNTMchr11:131240783chr11:105009805ENST00000425719+1839_126-7356DomainNote=Ig-like C2-type 1


Top

FusionGeneSequence for NTM_CARD18


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_NTM_ENST00000374791_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_27aa

>In-frame_NTM_ENST00000539799_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_27aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_NTM_ENST00000374791_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_82nt

>In-frame_NTM_ENST00000539799_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_82nt


* Fusion transcript sequences (Full-length transcript).
>In-frame_NTM_ENST00000374791_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_1056nt
AGAGTGTGTGTGCGTGTGTGTGTGTGTGTGTGCCCGCGCGCGTGTGTTGTAGCTCTGTCAATCCTTGGATTAGAACCAATGATTGCAGCT
TGTAGGAGGGCTGTCCAGGGCCAGATTGTACAATGTGTCTCAGTGCCAGAGTATGAGTGGAGATAATTACGGAGAAGTCATACTCTCTCA
CACCCTCGGCTTTCTTGTTGTGTCCTTCAGCAAAACAGTGGATTTAAATCTCCTTGCACAAGCTTGAGAGCAACACAATCTATCAGGAAA
GAAAGAAAGAAAAAAACCGAACCTGACAAAAAAGAAGAAAAAGAAGAAGAAAAAAAATCATGAAAACCATCCAGCCAAAAATGCACAATT
CTATCTCTTGGGCAATCTTCACGGGGCTGGCTGCTCTGTGTCTCTTCCAAGACCAACTCTTGCGTAAAAAGAGAAGAATTTTTATCCATT
CAGTGGGTGCAGGCACAATAAATGCCTTGCTGGATTGCCTATTAGAGGATGAAGTTATTAGCCAGGAAGACATGAACAAAGTGAGAGATG
AAAATGACACTGTCATGGATAAGGCTCGAGTCTTGATTGACCTTGTTACTGGAAAAGGACCCAAGTCTTGCTGCAAATTTATCAAGCATC
TCTGTGAAGAAGACCCTCAACTTGCCTCAAAGATGGGTTTGCACTAAGAGAGAAGATGGAACTCTGGAGCACTTCAGAGACTTCCCAGAG
CTTCTTCCAAGGGAGAAGATATTCTCGTGAAAGAAAAAAACAAAACAAAACAACAGTGCTTTTTTCAAACCTGATTAATTTCATCAATTT
CCAATAAATCTTTCATTCTCTCATATTACTTTCTTCTTATTCTTTCTCTCCTCATACCAACAGAGGATAATTCATCAATAATAATGAAGG
TCATGATGATTGTAATGTAATTAAGAAAGTCCCTCCCTTTCCCTTCCTTTCTGTTTAGTTCCTTTGCAATCCTGTAGAGACATGTACAGC

>In-frame_NTM_ENST00000539799_chr11_131240783_+_CARD18_ENST00000530950_chr11_105009805_-_727nt
ATGAAAACCATCCAGCCAAAAATGCACAATTCTATCTCTTGGGCAATCTTCACGGGGCTGGCTGCTCTGTGTCTCTTCCAAGACCAACTC
TTGCGTAAAAAGAGAAGAATTTTTATCCATTCAGTGGGTGCAGGCACAATAAATGCCTTGCTGGATTGCCTATTAGAGGATGAAGTTATT
AGCCAGGAAGACATGAACAAAGTGAGAGATGAAAATGACACTGTCATGGATAAGGCTCGAGTCTTGATTGACCTTGTTACTGGAAAAGGA
CCCAAGTCTTGCTGCAAATTTATCAAGCATCTCTGTGAAGAAGACCCTCAACTTGCCTCAAAGATGGGTTTGCACTAAGAGAGAAGATGG
AACTCTGGAGCACTTCAGAGACTTCCCAGAGCTTCTTCCAAGGGAGAAGATATTCTCGTGAAAGAAAAAAACAAAACAAAACAACAGTGC
TTTTTTCAAACCTGATTAATTTCATCAATTTCCAATAAATCTTTCATTCTCTCATATTACTTTCTTCTTATTCTTTCTCTCCTCATACCA
ACAGAGGATAATTCATCAATAATAATGAAGGTCATGATGATTGTAATGTAATTAAGAAAGTCCCTCCCTTTCCCTTCCTTTCTGTTTAGT
TCCTTTGCAATCCTGTAGAGACATGTACAGCTTACTTTGGTGCTTTTAGCACTGAGAGTCTGCTGTGATGGGAATAAAATGAAGTCCCAG


Top

FusionGenePPI for NTM_CARD18


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
NTMAPP, LSAMP, NEGR1, NTM, CCKBR, KRTAP5-9, KRTAP3-2, C19orf47, HAX1, NUFIP1, DGUOK, OPCML, CALR, PDIA5, FBXO2CARD18


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for NTM_CARD18


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for NTM_CARD18


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneNTMC0041696Unipolar Depression1PSYGENET
HgeneNTMC1269683Major Depressive Disorder1PSYGENET
TgeneCARD18C0007131Non-Small Cell Lung Carcinoma1CTD_human
TgeneCARD18C0007137Squamous cell carcinoma1CTD_human