FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 1856

FusionGeneSummary for ANKRD42_PICALM

check button Fusion gene summary
Fusion gene informationFusion gene name: ANKRD42_PICALM
Fusion gene ID: 1856
HgeneTgene
Gene symbol

ANKRD42

PICALM

Gene ID

338699

8301

Gene nameankyrin repeat domain 42phosphatidylinositol binding clathrin assembly protein
SynonymsPPP1R79|SARPCALM|CLTH|LAP
Cytomap

11q14.1

11q14.2

Type of geneprotein-codingprotein-coding
Descriptionankyrin repeat domain-containing protein 42protein phosphatase 1, regulatory subunit 79several ankyrin repeat proteinphosphatidylinositol-binding clathrin assembly proteinclathrin assembly lymphoid myeloid leukemia protein
Modification date2018051920180523
UniProtAcc

Q8N9B4

Q13492

Ensembl transtripts involved in fusion geneENST00000528190, ENST00000393389, 
ENST00000528722, ENST00000260047, 
ENST00000526731, ENST00000531895, 
ENST00000393392, ENST00000533342, 
ENST00000532317, ENST00000526033, 
ENST00000393346, ENST00000528398, 
ENST00000356360, ENST00000528411, 
Fusion gene scores* DoF score2 X 2 X 2=87 X 12 X 4=336
# samples 214
** MAII scorelog2(2/8*10)=1.32192809488736log2(14/336*10)=-1.26303440583379
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: ANKRD42 [Title/Abstract] AND PICALM [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgenePICALM

GO:0006898

receptor-mediated endocytosis

10436022

TgenePICALM

GO:0032880

regulation of protein localization

10436022

TgenePICALM

GO:0045893

positive regulation of transcription, DNA-templated

11425879

TgenePICALM

GO:0048261

negative regulation of receptor-mediated endocytosis

10436022


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDHNSCTCGA-CV-7422-01AANKRD42chr11

82909684

+PICALMchr11

85670103

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
intron-3CDSENST00000528190ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000528190ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000528190ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000528190ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000528190ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-intronENST00000528190ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000393389ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000393389ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000393389ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000393389ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000393389ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5CDS-intronENST00000393389ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-3CDSENST00000528722ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-3CDSENST00000528722ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-3CDSENST00000528722ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-3CDSENST00000528722ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-3CDSENST00000528722ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5UTR-intronENST00000528722ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000260047ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000260047ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000260047ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000260047ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000260047ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5CDS-intronENST00000260047ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000526731ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000526731ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000526731ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000526731ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000526731ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5CDS-intronENST00000526731ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000531895ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000531895ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000531895ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000531895ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000531895ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5CDS-intronENST00000531895ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000393392ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000393392ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000393392ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000393392ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-3CDSENST00000393392ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
intron-intronENST00000393392ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000533342ENST00000532317ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000533342ENST00000526033ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000533342ENST00000393346ANKRD42chr11

82909684

+PICALMchr11

85670103

-
Frame-shitENST00000533342ENST00000528398ANKRD42chr11

82909684

+PICALMchr11

85670103

-
In-frameENST00000533342ENST00000356360ANKRD42chr11

82909684

+PICALMchr11

85670103

-
5CDS-intronENST00000533342ENST00000528411ANKRD42chr11

82909684

+PICALMchr11

85670103

-

Top

FusionProtFeatures for ANKRD42_PICALM


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
ANKRD42

Q8N9B4

PICALM

Q13492

Assembly protein recruiting clathrin and adapter proteincomplex 2 (AP2) to cell membranes at sites of coated-pit formationand clathrin-vesicle assembly. May be required to determine theamount of membrane to be recycled, possibly by regulating the sizeof the clathrin cage. Involved in AP2-dependent clathrin-mediatedendocytosis at the neuromuscular junction.{ECO:0000269|PubMed:10436022}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for ANKRD42_PICALM


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_79aa

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_79aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_237nt
ATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATA
CATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAG


* Fusion transcript sequences (Full-length transcript).
>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_2531nt
GCCTCTCCAGCCAAGTGGCTGGAGTCGGGAGGCTGGAAAGAGACTCCGAGAAAGTACCAGCGGAAGGCGGCCGCCGCTACGGCGATTCGC
AGGGAGTAGCAGACGAAGACGGTGGCCGCCGCACTAGCCACCACGTGTGGAGGATAAACGGTCTACACGGCCATTCCGGCGCCGAGTCTA
GGGAAAGAGTTAGCGACGACGGGGAAAGAAAATGTGAAGAGAGCGACCGCCGCTCCAGGGTCGCTGCAGGAAGCCTAAGTGCAGACGCCG
GCTTCTCCCGCAGTGACTTGAGAAGGGTCAGTGAAAACCTCGGCCACTGCCGCAGCGTCTCTAGGGAGAGAGTTAGGGGAGATAGTGGCC
ACAGTCACAGCTGCTCTTGGGAGAGAGTTAGGGGAGACAGCACCTTCTGCAGCAGCGACGTGAATTTTAGTGAAGTTGGAGGCCACCAAA
CTACCGACTCCAGGGGAACAGCCAGAGAAGACCGAGGCCTCCGCCTCAGTGGTCCTTGGGAGGGAGTCAGTGACATTCGGGACCCGCGAA
CTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTCAGTGGCTCCTGGGAGGGAGGGAGTGTCGAAGGCGGCCACAGCG
TTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCCAGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACC
GCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGCTGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTC
CTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGGGTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACT
CAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCT
GTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAG
CCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAAC
TTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTTACTTCCAGCAAAATCCAAACTGCTGTCTCTTA
AATCTCTTAAACTCTCTTCTTCCATTAGAATGCTACAAGTAACTCAGTGAAGGCCCATGAAGGAAATTGGGACTAGTTTATAGGAGAACG
TATCAATACAGTTTATAAAGCCAAGAATTGCTATGATTTAAGACTAAGATCTGTCTTTTTGGTGACTAACCCTTCAATTCTTTCAACTCC
TGTTAATACCCATAATCAGTAACCTATCAAGAAAAGCCCTTATTTGGAAAGTGTGAAATTTGTATTTGGAAAAGCTGCCTGGAGAGAAGA
ACTGTGTCCTTTACTGTATTTCAACAGGACTCTTTTGGGGGATCAAAATTAAAATTCCTAATTATGCATTATCTTTCTTTTCTCCAGTCC
TCACAAATACAGAAACAATAACTGAAATTAACTTTTCTTTTTTTAAAAAAAATTATATTCAGTTTGCAGTAGACATTCCTTAAGTATTTG
TATTTATTTATGATTATCAATTTTACATAACATTAATATTGTATCAGACCTCCTTATGAAAATGAGTATGGATGTGCACAGTATGTTTGA
TTTTTATCCACAAGAATGAATCTGATTCAGAATGCTTTTCTCAGCTGACATACAGAGCACTAAATATTTTAAGGCAAGTCCATAGGTCTG
AATCTCTTAAGAATTCTCGGCCTCTGTGGGATTTAGGGAAGCATTATAAATGCATTAATCCTTATAGTCAATTCTGTGCCTAGGATTTTG
CCAGGGAACAGTTCACTGACTAGGAAAAGCACTACATTTTAAATTCAGCATTAGTGCATTGGGAAGGATCTTTACTGCTTTGTGCTTGGC
ATGTCATTATTTTCCATTTGACATTAGGGCCTTTCCAAAATGAATGTGAGGAATTGCTTTCACTTCAAGACTTTCCTTCTTTTCACTAAA
ACTCTAGAAGGTGTTACAAGGGGGAGGGAAGGGGGGCAAAGTCCTTGAACATTTTCTTTGGCTCGTGCCATGTTATGATCATATACCTTT
TAAATAAGGGGAAATAGTATCTTTAAAGTTAATGTCTAGCCAAGAGTTTAGTAAACGAAGAATTAAACTGCACTGTTGATCGGTGCTTTG
TGTAAATACATCTTTAACATTTGGGTGGAGAGGGGCCTTAAGAAGGACAGTTCATTGTAGGAAAGCAATTCTGTACATGAGTTTAAGCAT
TCTTGTTGCATTGTCTCTGCAGATTCTATTTTTGTTTACAATATTAAAATGTATGTTAGCAAAATGGGTGGATTTTCAAATAAAATGCAG

>In-frame_ANKRD42_ENST00000393389_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_1228nt
GCCTCTCCAGCCAAGTGGCTGGAGTCGGGAGGCTGGAAAGAGACTCCGAGAAAGTACCAGCGGAAGGCGGCCGCCGCTACGGCGATTCGC
AGGGAGTAGCAGACGAAGACGGTGGCCGCCGCACTAGCCACCACGTGTGGAGGATAAACGGTCTACACGGCCATTCCGGCGCCGAGTCTA
GGGAAAGAGTTAGCGACGACGGGGAAAGAAAATGTGAAGAGAGCGACCGCCGCTCCAGGGTCGCTGCAGGAAGCCTAAGTGCAGACGCCG
GCTTCTCCCGCAGTGACTTGAGAAGGGTCAGTGAAAACCTCGGCCACTGCCGCAGCGTCTCTAGGGAGAGAGTTAGGGGAGATAGTGGCC
ACAGTCACAGCTGCTCTTGGGAGAGAGTTAGGGGAGACAGCACCTTCTGCAGCAGCGACGTGAATTTTAGTGAAGTTGGAGGCCACCAAA
CTACCGACTCCAGGGGAACAGCCAGAGAAGACCGAGGCCTCCGCCTCAGTGGTCCTTGGGAGGGAGTCAGTGACATTCGGGACCCGCGAA
CTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTCAGTGGCTCCTGGGAGGGAGGGAGTGTCGAAGGCGGCCACAGCG
TTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCCAGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACC
GCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGCTGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTC
CTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGGGTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACT
CAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCT
GTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAG
CCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAAC

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_2394nt
TGGAGGATAAACGGTCTACACGGCCATTCCGGCGCCGAGTCTAGGGAAAGAGTTAGCGACGACGGGGAAAGAAAATGTGAAGAGAGCGAC
CGCCGCTCCAGGGTCGCTGCAGGAAGCCTAAGTGCAGACGCCGGCTTCTCCCGCAGTGACTTGAGAAGGGTCAGTGAAAACCTCGGCCAC
TGCCGCAGCGTCTCTAGGGAGAGAGTTAGGGGAGATAGTGGCCACAGTCACAGCTGCTCTTGGGAGAGAGTTAGGGGAGACAGCACCTTC
TGCAGCAGCGACGTGAATTTTAGTGAAGTTGGAGGCCACCAAACTACCGACTCCAGGGGAACAGCCAGAGAAGACCGAGGCCTCCGCCTC
AGTGGTCCTTGGGAGGGAGTCAGTGACATTCGGGACCCGCGAACTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTC
AGTGGCTCCTGGGAGGGAGGGAGTGTCGAAGGCGGCCACAGCGTTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCC
AGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGC
TGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGG
GTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCC
AATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGA
GCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACAT
TGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCA
GCAAAATCCTTACTTCCAGCAAAATCCAAACTGCTGTCTCTTAAATCTCTTAAACTCTCTTCTTCCATTAGAATGCTACAAGTAACTCAG
TGAAGGCCCATGAAGGAAATTGGGACTAGTTTATAGGAGAACGTATCAATACAGTTTATAAAGCCAAGAATTGCTATGATTTAAGACTAA
GATCTGTCTTTTTGGTGACTAACCCTTCAATTCTTTCAACTCCTGTTAATACCCATAATCAGTAACCTATCAAGAAAAGCCCTTATTTGG
AAAGTGTGAAATTTGTATTTGGAAAAGCTGCCTGGAGAGAAGAACTGTGTCCTTTACTGTATTTCAACAGGACTCTTTTGGGGGATCAAA
ATTAAAATTCCTAATTATGCATTATCTTTCTTTTCTCCAGTCCTCACAAATACAGAAACAATAACTGAAATTAACTTTTCTTTTTTTAAA
AAAAATTATATTCAGTTTGCAGTAGACATTCCTTAAGTATTTGTATTTATTTATGATTATCAATTTTACATAACATTAATATTGTATCAG
ACCTCCTTATGAAAATGAGTATGGATGTGCACAGTATGTTTGATTTTTATCCACAAGAATGAATCTGATTCAGAATGCTTTTCTCAGCTG
ACATACAGAGCACTAAATATTTTAAGGCAAGTCCATAGGTCTGAATCTCTTAAGAATTCTCGGCCTCTGTGGGATTTAGGGAAGCATTAT
AAATGCATTAATCCTTATAGTCAATTCTGTGCCTAGGATTTTGCCAGGGAACAGTTCACTGACTAGGAAAAGCACTACATTTTAAATTCA
GCATTAGTGCATTGGGAAGGATCTTTACTGCTTTGTGCTTGGCATGTCATTATTTTCCATTTGACATTAGGGCCTTTCCAAAATGAATGT
GAGGAATTGCTTTCACTTCAAGACTTTCCTTCTTTTCACTAAAACTCTAGAAGGTGTTACAAGGGGGAGGGAAGGGGGGCAAAGTCCTTG
AACATTTTCTTTGGCTCGTGCCATGTTATGATCATATACCTTTTAAATAAGGGGAAATAGTATCTTTAAAGTTAATGTCTAGCCAAGAGT
TTAGTAAACGAAGAATTAAACTGCACTGTTGATCGGTGCTTTGTGTAAATACATCTTTAACATTTGGGTGGAGAGGGGCCTTAAGAAGGA
CAGTTCATTGTAGGAAAGCAATTCTGTACATGAGTTTAAGCATTCTTGTTGCATTGTCTCTGCAGATTCTATTTTTGTTTACAATATTAA

>In-frame_ANKRD42_ENST00000260047_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_1091nt
TGGAGGATAAACGGTCTACACGGCCATTCCGGCGCCGAGTCTAGGGAAAGAGTTAGCGACGACGGGGAAAGAAAATGTGAAGAGAGCGAC
CGCCGCTCCAGGGTCGCTGCAGGAAGCCTAAGTGCAGACGCCGGCTTCTCCCGCAGTGACTTGAGAAGGGTCAGTGAAAACCTCGGCCAC
TGCCGCAGCGTCTCTAGGGAGAGAGTTAGGGGAGATAGTGGCCACAGTCACAGCTGCTCTTGGGAGAGAGTTAGGGGAGACAGCACCTTC
TGCAGCAGCGACGTGAATTTTAGTGAAGTTGGAGGCCACCAAACTACCGACTCCAGGGGAACAGCCAGAGAAGACCGAGGCCTCCGCCTC
AGTGGTCCTTGGGAGGGAGTCAGTGACATTCGGGACCCGCGAACTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTC
AGTGGCTCCTGGGAGGGAGGGAGTGTCGAAGGCGGCCACAGCGTTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCC
AGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGC
TGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGG
GTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCC
AATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGA
GCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACAT
TGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCA

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_2021nt
AGGGAGTCAGTGACATTCGGGACCCGCGAACTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTCAGTGGCTCCTGGG
AGGGAGGGAGTGTCGAAGGCGGCCACAGCGTTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCCAGCGACTCCTCTG
GTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGCTGCAGCTTCTGGG
AGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGGGTGAGAGCAAGTG
AAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCT
CCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAA
AGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATT
CTGGAAGTTTGGAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTTAC
TTCCAGCAAAATCCAAACTGCTGTCTCTTAAATCTCTTAAACTCTCTTCTTCCATTAGAATGCTACAAGTAACTCAGTGAAGGCCCATGA
AGGAAATTGGGACTAGTTTATAGGAGAACGTATCAATACAGTTTATAAAGCCAAGAATTGCTATGATTTAAGACTAAGATCTGTCTTTTT
GGTGACTAACCCTTCAATTCTTTCAACTCCTGTTAATACCCATAATCAGTAACCTATCAAGAAAAGCCCTTATTTGGAAAGTGTGAAATT
TGTATTTGGAAAAGCTGCCTGGAGAGAAGAACTGTGTCCTTTACTGTATTTCAACAGGACTCTTTTGGGGGATCAAAATTAAAATTCCTA
ATTATGCATTATCTTTCTTTTCTCCAGTCCTCACAAATACAGAAACAATAACTGAAATTAACTTTTCTTTTTTTAAAAAAAATTATATTC
AGTTTGCAGTAGACATTCCTTAAGTATTTGTATTTATTTATGATTATCAATTTTACATAACATTAATATTGTATCAGACCTCCTTATGAA
AATGAGTATGGATGTGCACAGTATGTTTGATTTTTATCCACAAGAATGAATCTGATTCAGAATGCTTTTCTCAGCTGACATACAGAGCAC
TAAATATTTTAAGGCAAGTCCATAGGTCTGAATCTCTTAAGAATTCTCGGCCTCTGTGGGATTTAGGGAAGCATTATAAATGCATTAATC
CTTATAGTCAATTCTGTGCCTAGGATTTTGCCAGGGAACAGTTCACTGACTAGGAAAAGCACTACATTTTAAATTCAGCATTAGTGCATT
GGGAAGGATCTTTACTGCTTTGTGCTTGGCATGTCATTATTTTCCATTTGACATTAGGGCCTTTCCAAAATGAATGTGAGGAATTGCTTT
CACTTCAAGACTTTCCTTCTTTTCACTAAAACTCTAGAAGGTGTTACAAGGGGGAGGGAAGGGGGGCAAAGTCCTTGAACATTTTCTTTG
GCTCGTGCCATGTTATGATCATATACCTTTTAAATAAGGGGAAATAGTATCTTTAAAGTTAATGTCTAGCCAAGAGTTTAGTAAACGAAG
AATTAAACTGCACTGTTGATCGGTGCTTTGTGTAAATACATCTTTAACATTTGGGTGGAGAGGGGCCTTAAGAAGGACAGTTCATTGTAG
GAAAGCAATTCTGTACATGAGTTTAAGCATTCTTGTTGCATTGTCTCTGCAGATTCTATTTTTGTTTACAATATTAAAATGTATGTTAGC

>In-frame_ANKRD42_ENST00000526731_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_718nt
AGGGAGTCAGTGACATTCGGGACCCGCGAACTAGTGACTTCGGGGATAGAGTCAGTGACGATCGCAGTCGCCGCTTCAGTGGCTCCTGGG
AGGGAGGGAGTGTCGAAGGCGGCCACAGCGTTGGTAGTTCTTGGGAGGAAGTAAGTGGAGACCGCGGCTACGCAGCCAGCGACTCCTCTG
GTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGTGAAGACGAAGGTTTCCGCTGCAGCTTCTGGG
AGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGCCGCTGCAGTGGCTCGTGGGTGAGAGCAAGTG
AAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCT
CCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAA
AGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATT

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_1872nt
GACCGCGGCTACGCAGCCAGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGT
GAAGACGAAGGTTTCCGCTGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGC
CGCTGCAGTGGCTCGTGGGTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGC
GCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGC
ATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCAT
AAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAA
AAGACAAGTGCTCAAGCAGCAAAATCCTTACTTCCAGCAAAATCCAAACTGCTGTCTCTTAAATCTCTTAAACTCTCTTCTTCCATTAGA
ATGCTACAAGTAACTCAGTGAAGGCCCATGAAGGAAATTGGGACTAGTTTATAGGAGAACGTATCAATACAGTTTATAAAGCCAAGAATT
GCTATGATTTAAGACTAAGATCTGTCTTTTTGGTGACTAACCCTTCAATTCTTTCAACTCCTGTTAATACCCATAATCAGTAACCTATCA
AGAAAAGCCCTTATTTGGAAAGTGTGAAATTTGTATTTGGAAAAGCTGCCTGGAGAGAAGAACTGTGTCCTTTACTGTATTTCAACAGGA
CTCTTTTGGGGGATCAAAATTAAAATTCCTAATTATGCATTATCTTTCTTTTCTCCAGTCCTCACAAATACAGAAACAATAACTGAAATT
AACTTTTCTTTTTTTAAAAAAAATTATATTCAGTTTGCAGTAGACATTCCTTAAGTATTTGTATTTATTTATGATTATCAATTTTACATA
ACATTAATATTGTATCAGACCTCCTTATGAAAATGAGTATGGATGTGCACAGTATGTTTGATTTTTATCCACAAGAATGAATCTGATTCA
GAATGCTTTTCTCAGCTGACATACAGAGCACTAAATATTTTAAGGCAAGTCCATAGGTCTGAATCTCTTAAGAATTCTCGGCCTCTGTGG
GATTTAGGGAAGCATTATAAATGCATTAATCCTTATAGTCAATTCTGTGCCTAGGATTTTGCCAGGGAACAGTTCACTGACTAGGAAAAG
CACTACATTTTAAATTCAGCATTAGTGCATTGGGAAGGATCTTTACTGCTTTGTGCTTGGCATGTCATTATTTTCCATTTGACATTAGGG
CCTTTCCAAAATGAATGTGAGGAATTGCTTTCACTTCAAGACTTTCCTTCTTTTCACTAAAACTCTAGAAGGTGTTACAAGGGGGAGGGA
AGGGGGGCAAAGTCCTTGAACATTTTCTTTGGCTCGTGCCATGTTATGATCATATACCTTTTAAATAAGGGGAAATAGTATCTTTAAAGT
TAATGTCTAGCCAAGAGTTTAGTAAACGAAGAATTAAACTGCACTGTTGATCGGTGCTTTGTGTAAATACATCTTTAACATTTGGGTGGA
GAGGGGCCTTAAGAAGGACAGTTCATTGTAGGAAAGCAATTCTGTACATGAGTTTAAGCATTCTTGTTGCATTGTCTCTGCAGATTCTAT

>In-frame_ANKRD42_ENST00000531895_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_569nt
GACCGCGGCTACGCAGCCAGCGACTCCTCTGGTGTGAGCGGCAGTGAAGACGCCAGCTACCGCTTCAGTGGCTTTTGGGAGAGAGAAAGT
GAAGACGAAGGTTTCCGCTGCAGCTTCTGGGAGAGAGCAAGAGAGGACCTTGGGCCCCGTCCTAGTGACGACGGAGAAGAGGGCCGCTGC
CGCTGCAGTGGCTCGTGGGTGAGAGCAAGTGAAGACCGCCGCAGCATCAGGGGCCTGGACTCAACTCCTCCCCAGAGTCGGAGGTGTTGC
GCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCAGGAAGAAGGTGCATTTTGGCAGC
ATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCATTAATGAACTTGATGTTCTCCAT
AAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAA

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000532317_chr11_85670103_-_1625nt
CTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCA
GGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCA
TTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATG
GAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTTACTTCCAGCAAAATCCAAACTGCTGTCTCTTAAATCTC
TTAAACTCTCTTCTTCCATTAGAATGCTACAAGTAACTCAGTGAAGGCCCATGAAGGAAATTGGGACTAGTTTATAGGAGAACGTATCAA
TACAGTTTATAAAGCCAAGAATTGCTATGATTTAAGACTAAGATCTGTCTTTTTGGTGACTAACCCTTCAATTCTTTCAACTCCTGTTAA
TACCCATAATCAGTAACCTATCAAGAAAAGCCCTTATTTGGAAAGTGTGAAATTTGTATTTGGAAAAGCTGCCTGGAGAGAAGAACTGTG
TCCTTTACTGTATTTCAACAGGACTCTTTTGGGGGATCAAAATTAAAATTCCTAATTATGCATTATCTTTCTTTTCTCCAGTCCTCACAA
ATACAGAAACAATAACTGAAATTAACTTTTCTTTTTTTAAAAAAAATTATATTCAGTTTGCAGTAGACATTCCTTAAGTATTTGTATTTA
TTTATGATTATCAATTTTACATAACATTAATATTGTATCAGACCTCCTTATGAAAATGAGTATGGATGTGCACAGTATGTTTGATTTTTA
TCCACAAGAATGAATCTGATTCAGAATGCTTTTCTCAGCTGACATACAGAGCACTAAATATTTTAAGGCAAGTCCATAGGTCTGAATCTC
TTAAGAATTCTCGGCCTCTGTGGGATTTAGGGAAGCATTATAAATGCATTAATCCTTATAGTCAATTCTGTGCCTAGGATTTTGCCAGGG
AACAGTTCACTGACTAGGAAAAGCACTACATTTTAAATTCAGCATTAGTGCATTGGGAAGGATCTTTACTGCTTTGTGCTTGGCATGTCA
TTATTTTCCATTTGACATTAGGGCCTTTCCAAAATGAATGTGAGGAATTGCTTTCACTTCAAGACTTTCCTTCTTTTCACTAAAACTCTA
GAAGGTGTTACAAGGGGGAGGGAAGGGGGGCAAAGTCCTTGAACATTTTCTTTGGCTCGTGCCATGTTATGATCATATACCTTTTAAATA
AGGGGAAATAGTATCTTTAAAGTTAATGTCTAGCCAAGAGTTTAGTAAACGAAGAATTAAACTGCACTGTTGATCGGTGCTTTGTGTAAA
TACATCTTTAACATTTGGGTGGAGAGGGGCCTTAAGAAGGACAGTTCATTGTAGGAAAGCAATTCTGTACATGAGTTTAAGCATTCTTGT
TGCATTGTCTCTGCAGATTCTATTTTTGTTTACAATATTAAAATGTATGTTAGCAAAATGGGTGGATTTTCAAATAAAATGCAGCTTCCA

>In-frame_ANKRD42_ENST00000533342_chr11_82909684_+_PICALM_ENST00000356360_chr11_85670103_-_322nt
CTCCCCAGAGTCGGAGGTGTTGCGCCATGCCCGGGGTGGCCAATTCAGGCCCCTCCACTTCCTCTAGGGAGACTGCAAACCCCTGTTCCA
GGAAGAAGGTGCATTTTGGCAGCATACATGATGCAGTACGAGCTGGAGATGTAAAGCAGCTTTCAGAAATAGTGGTACGTGGAGCCAGCA
TTAATGAACTTGATGTTCTCCATAAGTTTACCCCTTTACATTGGGCAGCACATTCTGGAAGTTTGGAGATACAGTTTATGTAACTTGATG


Top

FusionGenePPI for ANKRD42_PICALM


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
ANKRD42PPP1CCPICALMPLCG1, CLTC, ITSN1, AP2A1, HIP1R, LAMTOR3, EEF1A1, SEC24D, DNM2, EGFR, FLOT1, SEC24C, ATP6V1E1, ILF3, HNRNPDL, SH3GLB2, ABCC2, ATP6V1F, CD55, SIRT1, FN1, VCAM1, ITGA4, PELI2, KLHL20, SLC25A41, ITLN1, ATF6B, SLC25A32, SOX2, FAM64A, CYP1A1, HNRNPA1, UNK, NTRK1, C14orf166, CARS, CPPED1, HNRNPD, ILVBL, ITGB1, LPP, PAPOLA, DDX1, EWSR1, FERMT2, FUS, ILK, NPLOC4, PFKM, PTPRF, VCL, PXN, STXBP1, TRIM25, UNC13D, XPO1, AP2B1, AP2M1, CLTA, CLTB, DAB2, EPS15, GAK, MYO6, PIK3C2A, SEC13, CLTCL1, CAPZA2, DBN1, MYH9, LIMA1, GTSE1, ANLN, MYO19, MYO18A, CLINT1, SEC16A, TNRC6A, BMP2K, MICAL3, DENND1A, WNK1, PRRC2B, STON2, FCHO2, MCM2, SNW1, CDC5L, SMURF1, CDH1, STAMBPL1, RALBP1, SNRNP27, DLST


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for ANKRD42_PICALM


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for ANKRD42_PICALM


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgenePICALMC0002395Alzheimer's Disease2CTD_human