FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 17101

FusionGeneSummary for IFT20_GLS

check button Fusion gene summary
Fusion gene informationFusion gene name: IFT20_GLS
Fusion gene ID: 17101
HgeneTgene
Gene symbol

IFT20

GLS

Gene ID

90410

27165

Gene nameintraflagellar transport 20glutaminase 2
Synonyms-GA|GLS|LGA|hLGA
Cytomap

17q11.2

12q13.3

Type of geneprotein-codingprotein-coding
Descriptionintraflagellar transport protein 20 homologintraflagellar transport 20 homologintraflagellar transport protein IFT20glutaminase liver isoform, mitochondrialL-glutamine amidohydrolasebreast cell glutaminaseglutaminase 2 (liver, mitochondrial)glutaminase Iphosphate-activated glutaminasephosphate-dependent glutaminase
Modification date2018052320180523
UniProtAcc

Q8IY31

O94925

Ensembl transtripts involved in fusion geneENST00000579419, ENST00000357896, 
ENST00000395418, ENST00000585089, 
ENST00000585313, ENST00000578122, 
ENST00000578985, 
ENST00000320717, 
ENST00000338435, ENST00000409626, 
ENST00000409428, ENST00000409215, 
ENST00000471443, 
Fusion gene scores* DoF score3 X 3 X 3=278 X 7 X 3=168
# samples 38
** MAII scorelog2(3/27*10)=0.15200309344505
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
log2(8/168*10)=-1.0703893278914
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: IFT20 [Title/Abstract] AND GLS [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DC316034IFT20chr17

26658882

-GLSchr2

191827556

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000579419ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000579419ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000579419ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000579419ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000579419ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000579419ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
Frame-shitENST00000357896ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000357896ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000357896ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000357896ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000357896ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000357896ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
Frame-shitENST00000395418ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000395418ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000395418ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000395418ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000395418ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000395418ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
In-frameENST00000585089ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585089ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585089ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585089ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585089ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585089ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
Frame-shitENST00000585313ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585313ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585313ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585313ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585313ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000585313ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
In-frameENST00000578122ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578122ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578122ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578122ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578122ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578122ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+
In-frameENST00000578985ENST00000320717IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578985ENST00000338435IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578985ENST00000409626IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578985ENST00000409428IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578985ENST00000409215IFT20chr17

26658882

-GLSchr2

191827556

+
5CDS-intronENST00000578985ENST00000471443IFT20chr17

26658882

-GLSchr2

191827556

+

Top

FusionProtFeatures for IFT20_GLS


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
IFT20

Q8IY31

GLS

O94925

Part of intraflagellar transport (IFT) particlesinvolved in ciliary process assembly. May play a role in thetrafficking of ciliary membrane proteins from the Golgi complex tothe cilium. Also involved in autophagy since it is required fortrafficking of ATG16L and the expansion of the autophagiccompartment. {ECO:0000269|PubMed:16775004}. Catalyzes the first reaction in the primary pathway forthe renal catabolism of glutamine. Plays a role in maintainingacid-base homeostasis. Regulates the levels of theneurotransmitter glutamate in the brain. Isoform 2 lacks catalyticactivity.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for IFT20_GLS


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_IFT20_ENST00000585089_chr17_26658882_-_GLS_ENST00000320717_chr2_191827556_+_3199nt
GTGGCAGCGGCCGTGGCAGGCTGGCTGGGTACCGGCTGTCGCTGACCCAGGAGAAGCTGCCTGTCTACATCAGCCTGGGCTGCAGCGCGC
TGCCGCCGCGGGGCCGGCAGCTGAACTATGTGCTCTTCAGGGCGGGCACCGTGTTGCATTCATCTTTGTACCCCCAGCATCTAGCAGTGT
TGGCATGTAGTAGGCACTCAAGAAATGTGTGTTGAATGAACGATGCCTGTGACAAGCAAGCGGACTTTATTCTTTCCTGACCCTTGCTCC
TATGACACACCTCCTCCTGACTGCCACTGTCACTCCTTCAGAGCAGAACTCCTCTAGGGAACCTGGATGGGAAACAGCCATGGCCAAGGA
CATCCTGGGTGAAGCAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGACCCAGAGGTTACCCAGCAGACCATAGAGCTGAA
GGAAGAGTGCAAAGACTTTGTGGACAGTGGAATAACACTCCCATGGATGAAGCACTGCACTTTGGACACCATGATGTATTTAAAATTCTC
CAAGAATACCAAGTCCAGTACACACCTCAAGGAGATTCTGACAACGGGAAGGAAAATCAAACCGTCCATAAGAATCTTGATGGATTGTTG
TAATGGTCTCAAATCCCAAGATTTAAATCACTTACCTATTTAATTGTGGAAAATGATTATGAAGAACATGTGTATTTCTATCTGGTAGTG
ATGTATATTTTACATTTGTCATTTCAGTGTTACTGGAGTTTTCTTCATTGTGCACACAGGACAAATCTGATCTCTTTGGGAAAAAATAGA
AATAAAACAATCTCCCTCCATAATGTGAGCAATATTACCTCGTGCATTGTATAATTTGATGTAAAAGAAATAGTTACCAATGCTAGCTTG
TGTGGTCTTCCATGATTTATTTGTGTTTTGTGAATTTTCAATTTATGGTGATGATCTGCTGATATGCATTTATAAAGTAAGCTCTGTTGT
ACAGTCTGTCCAAATGGGTCAAGGTTGCCTTTAGAAGCAAATAGTGTGATTTTCAAGACTTCAAATACAAATTTAGTTTAAGTGTTTGAA
CAACTATATGCACTTACGGTTGTGTGTTTAAAATGTCTCTCTCACCCCCTAGCTTCATGATGTGACTCTTAAAAAACTATAATAGTTAAC
AACTGTTAGTAAGATAGACCAATTCTGATTAGACTTTATCAGGGAATCTGTTTAAGATATGTTTGGTGACCAAAACGTATGTGTGAATGT
AGTTATAATGCTTTTGAAAAATTTTCCTTTTTCTATATCCCCTTAGTCCAGCCTCTCTTCTCAGACATTTAGCTATCTGCCTCTTTCCTT
TAGCTGGGAAAGTGAGAGCTGGCATACTATGCAGTTTTTATGTTTTCCATAGTAAGTCAGAAAATGCCTCCTATTTCTGGCATCAGAACT
TTGCCATTTGTCTACAGAAGACGAACCAGAGACAAAATTACTAAGTATAAATTAGTCAAGTTTATCAGTCTAAAAAACGAAGGGATGTGC
AACTGCAGCTCTTTAAGAAGTTTTTTTTTTTTAGCTTCTAGGGTAAAGATAAATTCAGAAATGCTCTAAGCTACCAAAGTTATTCTGAAA
GTATGGGAACTGCTACAACTAACAAACATTTGTTTCCAAGCCTGTCATTAAGAGTCTGCATCAAGAGATTTGTCCTCCTTGGGGGACCAC
TGGATCATTCCAGATTTCTTGTGATTTTTCTATTGTGTAATTCTTGGTGGGCTCTGTAGTTTAATAATAAGAAAAAGGCCATTTCATTTT
AAATTGTGACCTATAATTCTTTGTCTTGGGTTGGTAATTCAGGATTCATTTGGAAAGTGGGTAAAAGGGGCTTCAAAAAACGGATAGAAC
AGGATTTTCTAGGAGTTACACATACATTTTATCCTGTCATACCTCGAGATAAAGTGGCATGTTAGTGAGGAGTTCTGATATTAAGCACAC
ACACACATGCACACAAATGGACTTCTCTGAAGCTGTGTTTAGTGAAATGAGCTCAAGTACATGAATGTTAGTTGTTATCACATACAGCAA
ATTCCTTTTTTTTTCTTTTTCTATGAGCACACTCTGCTGCTTCTAAACTTTACATGCCTGATGGCACCTTACTCCAGCAGCCTCCAGGTG
CTTTCATTTTCACTTCCAGTCTAAGCCAGTGGCTCCTGCCACTGCCCTCCCATTACCTAGATGGCACCTCCTTTGGTGAAACCACGGCCA
ATGTTCCTTAGCTGCACCAGGCCCGAAGCTGTTCCCATGCTTGAGCTTCCATGGGGAGGATGCTGAGTGAGCAGTTTCCTACCCCGTGGA
TCTAGCAAGCCATGGAGACAGGTAGCATTTGTAAGATGCTGCACAGGAGCAGCATTATCCCCAAAGATATTACAGGGTAGACACGTTTTA
ACTGAAATCAATCAAGATAACTTTATTCAAAGAGCAGCCCGCTTTGTGTGACTAAAATGAAACAAGACAGTTGAATTGTGTGACTTGAAG
ATTACCAATGATTTTGAGGCTTTTCTATAATAAAAAGAGGTTCTAACCATTATTTGGGAACAAAGAGAGTTTTCATCTTTTTTCAGATCA
AAACCATTCTGTAAAATCTTTGTTGTTTAATTAAATGTGCCGTTATTTACCCCTGATGTTATTTATGACTATGTGCCGATTCCTGCTCGG
GCTGTTTGCTGTTGGCTGGTAATAATATATTTGATTTAAATGCTGTTGACTGTGCTATTAACTGCTGCCGTCAGTAAACTCCAAAGATCT
TTTTGTTTTGGCTTTAGTATCATATGTGCTTTTTCTGTATCCTGAGCGCTCTATATGATCATGTTAATTTAAAGCTTTATACACATTGTT
GTTTTTGCTGGTCTCATCTTTGGTAATATGCTATACCCCACTGCTGCCCGACACTGCCCTTTAGCTGCAGAGCTGGATTAGCTGTTGACC
ATTTGATGCTGTTGTCTGTCTGGCAGGGACTGAATGACCTGATGTCAGATTTAGATTCTTCCTGGGGATTACACAGCTATGAATGTATTT
GCTTCTAAAACCTCCCAAAGTGAATCTAATCTTAAAACTACAAGTTGTAAGTATTCTGAAATTGGGAAACATTTATTTTAAATGCAATCA

>In-frame_IFT20_ENST00000578122_chr17_26658882_-_GLS_ENST00000320717_chr2_191827556_+_3185nt
GGCAGGCTGGCTGGGTACCGGCTGTCGCTGACCCAGGAGAAGCTGCCTGTCTACATCAGCCTGGGCTGCAGCGCGCTGCCGCCGCGGGGC
CGGCAGCTGAACTATGTGCTCTTCAGGGCGGGCACCGTGTTGCATTCATCTTTGTACCCCCAGCATCTAGCAGTGTTGGCATGTAGTAGG
CACTCAAGAAATGTGTGTTGAATGAACGATGCCTGTGACAAGCAAGCGGACTTTATTCTTTCCTGACCCTTGCTCCTATGACACACCTCC
TCCTGACTGCCACTGTCACTCCTTCAGAGCAGAACTCCTCTAGGGAACCTGGATGGGAAACAGCCATGGCCAAGGACATCCTGGGTGAAG
CAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGACCCAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAGTGCAAAG
ACTTTGTGGACAGTGGAATAACACTCCCATGGATGAAGCACTGCACTTTGGACACCATGATGTATTTAAAATTCTCCAAGAATACCAAGT
CCAGTACACACCTCAAGGAGATTCTGACAACGGGAAGGAAAATCAAACCGTCCATAAGAATCTTGATGGATTGTTGTAATGGTCTCAAAT
CCCAAGATTTAAATCACTTACCTATTTAATTGTGGAAAATGATTATGAAGAACATGTGTATTTCTATCTGGTAGTGATGTATATTTTACA
TTTGTCATTTCAGTGTTACTGGAGTTTTCTTCATTGTGCACACAGGACAAATCTGATCTCTTTGGGAAAAAATAGAAATAAAACAATCTC
CCTCCATAATGTGAGCAATATTACCTCGTGCATTGTATAATTTGATGTAAAAGAAATAGTTACCAATGCTAGCTTGTGTGGTCTTCCATG
ATTTATTTGTGTTTTGTGAATTTTCAATTTATGGTGATGATCTGCTGATATGCATTTATAAAGTAAGCTCTGTTGTACAGTCTGTCCAAA
TGGGTCAAGGTTGCCTTTAGAAGCAAATAGTGTGATTTTCAAGACTTCAAATACAAATTTAGTTTAAGTGTTTGAACAACTATATGCACT
TACGGTTGTGTGTTTAAAATGTCTCTCTCACCCCCTAGCTTCATGATGTGACTCTTAAAAAACTATAATAGTTAACAACTGTTAGTAAGA
TAGACCAATTCTGATTAGACTTTATCAGGGAATCTGTTTAAGATATGTTTGGTGACCAAAACGTATGTGTGAATGTAGTTATAATGCTTT
TGAAAAATTTTCCTTTTTCTATATCCCCTTAGTCCAGCCTCTCTTCTCAGACATTTAGCTATCTGCCTCTTTCCTTTAGCTGGGAAAGTG
AGAGCTGGCATACTATGCAGTTTTTATGTTTTCCATAGTAAGTCAGAAAATGCCTCCTATTTCTGGCATCAGAACTTTGCCATTTGTCTA
CAGAAGACGAACCAGAGACAAAATTACTAAGTATAAATTAGTCAAGTTTATCAGTCTAAAAAACGAAGGGATGTGCAACTGCAGCTCTTT
AAGAAGTTTTTTTTTTTTAGCTTCTAGGGTAAAGATAAATTCAGAAATGCTCTAAGCTACCAAAGTTATTCTGAAAGTATGGGAACTGCT
ACAACTAACAAACATTTGTTTCCAAGCCTGTCATTAAGAGTCTGCATCAAGAGATTTGTCCTCCTTGGGGGACCACTGGATCATTCCAGA
TTTCTTGTGATTTTTCTATTGTGTAATTCTTGGTGGGCTCTGTAGTTTAATAATAAGAAAAAGGCCATTTCATTTTAAATTGTGACCTAT
AATTCTTTGTCTTGGGTTGGTAATTCAGGATTCATTTGGAAAGTGGGTAAAAGGGGCTTCAAAAAACGGATAGAACAGGATTTTCTAGGA
GTTACACATACATTTTATCCTGTCATACCTCGAGATAAAGTGGCATGTTAGTGAGGAGTTCTGATATTAAGCACACACACACATGCACAC
AAATGGACTTCTCTGAAGCTGTGTTTAGTGAAATGAGCTCAAGTACATGAATGTTAGTTGTTATCACATACAGCAAATTCCTTTTTTTTT
CTTTTTCTATGAGCACACTCTGCTGCTTCTAAACTTTACATGCCTGATGGCACCTTACTCCAGCAGCCTCCAGGTGCTTTCATTTTCACT
TCCAGTCTAAGCCAGTGGCTCCTGCCACTGCCCTCCCATTACCTAGATGGCACCTCCTTTGGTGAAACCACGGCCAATGTTCCTTAGCTG
CACCAGGCCCGAAGCTGTTCCCATGCTTGAGCTTCCATGGGGAGGATGCTGAGTGAGCAGTTTCCTACCCCGTGGATCTAGCAAGCCATG
GAGACAGGTAGCATTTGTAAGATGCTGCACAGGAGCAGCATTATCCCCAAAGATATTACAGGGTAGACACGTTTTAACTGAAATCAATCA
AGATAACTTTATTCAAAGAGCAGCCCGCTTTGTGTGACTAAAATGAAACAAGACAGTTGAATTGTGTGACTTGAAGATTACCAATGATTT
TGAGGCTTTTCTATAATAAAAAGAGGTTCTAACCATTATTTGGGAACAAAGAGAGTTTTCATCTTTTTTCAGATCAAAACCATTCTGTAA
AATCTTTGTTGTTTAATTAAATGTGCCGTTATTTACCCCTGATGTTATTTATGACTATGTGCCGATTCCTGCTCGGGCTGTTTGCTGTTG
GCTGGTAATAATATATTTGATTTAAATGCTGTTGACTGTGCTATTAACTGCTGCCGTCAGTAAACTCCAAAGATCTTTTTGTTTTGGCTT
TAGTATCATATGTGCTTTTTCTGTATCCTGAGCGCTCTATATGATCATGTTAATTTAAAGCTTTATACACATTGTTGTTTTTGCTGGTCT
CATCTTTGGTAATATGCTATACCCCACTGCTGCCCGACACTGCCCTTTAGCTGCAGAGCTGGATTAGCTGTTGACCATTTGATGCTGTTG
TCTGTCTGGCAGGGACTGAATGACCTGATGTCAGATTTAGATTCTTCCTGGGGATTACACAGCTATGAATGTATTTGCTTCTAAAACCTC
CCAAAGTGAATCTAATCTTAAAACTACAAGTTGTAAGTATTCTGAAATTGGGAAACATTTATTTTAAATGCAATCAGGTAGTGTTGCTTT

>In-frame_IFT20_ENST00000578985_chr17_26658882_-_GLS_ENST00000320717_chr2_191827556_+_3190nt
GCCGTGGCAGGCTGGCTGGGTACCGGCTGTCGCTGACCCAGGAGAAGCTGCCTGTCTACATCAGCCTGGGCTGCAGCGCGCTGCCGCCGC
GGGGCCGGCAGCTGAACTATGTGCTCTTCAGGGCGGGCACCGTGTTGCATTCATCTTTGTACCCCCAGCATCTAGCAGTGTTGGCATGTA
GTAGGCACTCAAGAAATGTGTGTTGAATGAACGATGCCTGTGACAAGCAAGCGGACTTTATTCTTTCCTGACCCTTGCTCCTATGACACA
CCTCCTCCTGACTGCCACTGTCACTCCTTCAGAGCAGAACTCCTCTAGGGAACCTGGATGGGAAACAGCCATGGCCAAGGACATCCTGGG
TGAAGCAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGACCCAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAGTG
CAAAGACTTTGTGGACAGTGGAATAACACTCCCATGGATGAAGCACTGCACTTTGGACACCATGATGTATTTAAAATTCTCCAAGAATAC
CAAGTCCAGTACACACCTCAAGGAGATTCTGACAACGGGAAGGAAAATCAAACCGTCCATAAGAATCTTGATGGATTGTTGTAATGGTCT
CAAATCCCAAGATTTAAATCACTTACCTATTTAATTGTGGAAAATGATTATGAAGAACATGTGTATTTCTATCTGGTAGTGATGTATATT
TTACATTTGTCATTTCAGTGTTACTGGAGTTTTCTTCATTGTGCACACAGGACAAATCTGATCTCTTTGGGAAAAAATAGAAATAAAACA
ATCTCCCTCCATAATGTGAGCAATATTACCTCGTGCATTGTATAATTTGATGTAAAAGAAATAGTTACCAATGCTAGCTTGTGTGGTCTT
CCATGATTTATTTGTGTTTTGTGAATTTTCAATTTATGGTGATGATCTGCTGATATGCATTTATAAAGTAAGCTCTGTTGTACAGTCTGT
CCAAATGGGTCAAGGTTGCCTTTAGAAGCAAATAGTGTGATTTTCAAGACTTCAAATACAAATTTAGTTTAAGTGTTTGAACAACTATAT
GCACTTACGGTTGTGTGTTTAAAATGTCTCTCTCACCCCCTAGCTTCATGATGTGACTCTTAAAAAACTATAATAGTTAACAACTGTTAG
TAAGATAGACCAATTCTGATTAGACTTTATCAGGGAATCTGTTTAAGATATGTTTGGTGACCAAAACGTATGTGTGAATGTAGTTATAAT
GCTTTTGAAAAATTTTCCTTTTTCTATATCCCCTTAGTCCAGCCTCTCTTCTCAGACATTTAGCTATCTGCCTCTTTCCTTTAGCTGGGA
AAGTGAGAGCTGGCATACTATGCAGTTTTTATGTTTTCCATAGTAAGTCAGAAAATGCCTCCTATTTCTGGCATCAGAACTTTGCCATTT
GTCTACAGAAGACGAACCAGAGACAAAATTACTAAGTATAAATTAGTCAAGTTTATCAGTCTAAAAAACGAAGGGATGTGCAACTGCAGC
TCTTTAAGAAGTTTTTTTTTTTTAGCTTCTAGGGTAAAGATAAATTCAGAAATGCTCTAAGCTACCAAAGTTATTCTGAAAGTATGGGAA
CTGCTACAACTAACAAACATTTGTTTCCAAGCCTGTCATTAAGAGTCTGCATCAAGAGATTTGTCCTCCTTGGGGGACCACTGGATCATT
CCAGATTTCTTGTGATTTTTCTATTGTGTAATTCTTGGTGGGCTCTGTAGTTTAATAATAAGAAAAAGGCCATTTCATTTTAAATTGTGA
CCTATAATTCTTTGTCTTGGGTTGGTAATTCAGGATTCATTTGGAAAGTGGGTAAAAGGGGCTTCAAAAAACGGATAGAACAGGATTTTC
TAGGAGTTACACATACATTTTATCCTGTCATACCTCGAGATAAAGTGGCATGTTAGTGAGGAGTTCTGATATTAAGCACACACACACATG
CACACAAATGGACTTCTCTGAAGCTGTGTTTAGTGAAATGAGCTCAAGTACATGAATGTTAGTTGTTATCACATACAGCAAATTCCTTTT
TTTTTCTTTTTCTATGAGCACACTCTGCTGCTTCTAAACTTTACATGCCTGATGGCACCTTACTCCAGCAGCCTCCAGGTGCTTTCATTT
TCACTTCCAGTCTAAGCCAGTGGCTCCTGCCACTGCCCTCCCATTACCTAGATGGCACCTCCTTTGGTGAAACCACGGCCAATGTTCCTT
AGCTGCACCAGGCCCGAAGCTGTTCCCATGCTTGAGCTTCCATGGGGAGGATGCTGAGTGAGCAGTTTCCTACCCCGTGGATCTAGCAAG
CCATGGAGACAGGTAGCATTTGTAAGATGCTGCACAGGAGCAGCATTATCCCCAAAGATATTACAGGGTAGACACGTTTTAACTGAAATC
AATCAAGATAACTTTATTCAAAGAGCAGCCCGCTTTGTGTGACTAAAATGAAACAAGACAGTTGAATTGTGTGACTTGAAGATTACCAAT
GATTTTGAGGCTTTTCTATAATAAAAAGAGGTTCTAACCATTATTTGGGAACAAAGAGAGTTTTCATCTTTTTTCAGATCAAAACCATTC
TGTAAAATCTTTGTTGTTTAATTAAATGTGCCGTTATTTACCCCTGATGTTATTTATGACTATGTGCCGATTCCTGCTCGGGCTGTTTGC
TGTTGGCTGGTAATAATATATTTGATTTAAATGCTGTTGACTGTGCTATTAACTGCTGCCGTCAGTAAACTCCAAAGATCTTTTTGTTTT
GGCTTTAGTATCATATGTGCTTTTTCTGTATCCTGAGCGCTCTATATGATCATGTTAATTTAAAGCTTTATACACATTGTTGTTTTTGCT
GGTCTCATCTTTGGTAATATGCTATACCCCACTGCTGCCCGACACTGCCCTTTAGCTGCAGAGCTGGATTAGCTGTTGACCATTTGATGC
TGTTGTCTGTCTGGCAGGGACTGAATGACCTGATGTCAGATTTAGATTCTTCCTGGGGATTACACAGCTATGAATGTATTTGCTTCTAAA
ACCTCCCAAAGTGAATCTAATCTTAAAACTACAAGTTGTAAGTATTCTGAAATTGGGAAACATTTATTTTAAATGCAATCAGGTAGTGTT


Top

FusionGenePPI for IFT20_GLS


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
IFT20EXOC7, KXD1, FBF1, TREX1, ABI2, DISC1, HTT, PTPN12, KPNA2, BLOC1S6, GOLGA2, KRT13, PSMA1, WASF1, NDC80, EMILIN1, NUP62, MED4, CCDC53, NUP54, USHBP1, DTNBP1, CROCCP2, HAUS1, FSD2, CCDC67, ZDHHC17, IFT57, CORO1A, LCA5, PCM1, SCLT1, TTC30B, TTC30A, EXOC3, TRAF3IP1, CLUAP1, IFT172, IFT80, IFT88, BLOC1S2, IFT74, NME8, HSPB11, IFT81, IFT46, IFT22, TTC26, IFT52GLSSNTA1, CUL5, ATXN10, ATF2, CAPN1, EIF5A, GDA, GNS, MVD, MYL12A, PEPD, MRPL43, METTL20, C21orf33, NUFIP1, MRPL4, PPA2, ATF6B, HMGCL, ETFA, MRM1, RARS2, TNF, OXLD1, UNK, SIRT5, MCM2, SPATA20, COQ9, PTPMT1, CISD3, CCL22, NDUFS7, SNRNP27, CFAP45, TRMT61B, YBEY, OTC, ACAD9, FGB, LAMP3, ATCAY


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for IFT20_GLS


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
TgeneGLSO94925DB00142Glutamic AcidGlutaminase kidney isoform, mitochondrialsmall moleculeapproved|nutraceutical

Top

RelatedDiseases for IFT20_GLS


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgeneGLSC0000786Spontaneous abortion1CTD_human
TgeneGLSC0023893Liver Cirrhosis, Experimental1CTD_human
TgeneGLSC0029408Degenerative polyarthritis1CTD_human
TgeneGLSC0036341Schizophrenia1PSYGENET