FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 168

FusionGeneSummary for ABCC5_TGFBI

check button Fusion gene summary
Fusion gene informationFusion gene name: ABCC5_TGFBI
Fusion gene ID: 168
HgeneTgene
Gene symbol

ABCC5

TGFBI

Gene ID

10057

7045

Gene nameATP binding cassette subfamily C member 5transforming growth factor beta induced
SynonymsABC33|EST277145|MOAT-C|MOATC|MRP5|SMRP|pABC11BIGH3|CDB1|CDG2|CDGG1|CSD|CSD1|CSD2|CSD3|EBMD|LCD1
Cytomap

3q27.1

5q31.1

Type of geneprotein-codingprotein-coding
Descriptionmultidrug resistance-associated protein 5ATP-binding cassette, sub-family C (CFTR/MRP), member 5canalicular multispecific organic anion transporter Cmulti-specific organic anion transporter Ctransforming growth factor-beta-induced protein ig-h3RGD-CAPRGD-containing collagen-associated proteinbeta ig-h3betaig-h3kerato-epithelintransforming growth factor beta-induced 68kDatransforming growth factor, beta-induced, 68kD
Modification date2018052320180527
UniProtAcc

O15440

Q15582

Ensembl transtripts involved in fusion geneENST00000334444, ENST00000265586, 
ENST00000492216, ENST00000427120, 
ENST00000392579, ENST00000382494, 
ENST00000446941, 
ENST00000442011, 
ENST00000305126, ENST00000508076, 
ENST00000504185, 
Fusion gene scores* DoF score8 X 6 X 4=1926 X 7 X 2=84
# samples 78
** MAII scorelog2(7/192*10)=-1.45567948377619
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(8/84*10)=-0.070389327891398
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: ABCC5 [Title/Abstract] AND TGFBI [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1BC007229ABCC5chr3

183705558

-TGFBIchr5

135397183

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000334444ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000334444ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000334444ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
5CDS-intronENST00000334444ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000265586ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000265586ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000265586ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
5CDS-intronENST00000265586ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000492216ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000492216ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000492216ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-intronENST00000492216ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000427120ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000427120ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000427120ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-intronENST00000427120ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000392579ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000392579ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
Frame-shitENST00000392579ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
5CDS-intronENST00000392579ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
In-frameENST00000382494ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
In-frameENST00000382494ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
In-frameENST00000382494ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
5CDS-intronENST00000382494ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000446941ENST00000442011ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000446941ENST00000305126ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-3CDSENST00000446941ENST00000508076ABCC5chr3

183705558

-TGFBIchr5

135397183

+
intron-intronENST00000446941ENST00000504185ABCC5chr3

183705558

-TGFBIchr5

135397183

+

Top

FusionProtFeatures for ABCC5_TGFBI


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
ABCC5

O15440

TGFBI

Q15582


check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for ABCC5_TGFBI


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_ABCC5_ENST00000382494_chr3_183705558_-_TGFBI_ENST00000442011_chr5_135397183_+_1443nt
GGCTCATGCTCGGGAGCGTGGTTGAGCGGCTGGCGCGGTTGTCCTGGAGCAGGGGCGCAGGAATTCTGATGTGAAACTAACAGTCTGTGA
GCCCTGGAACCTCCACTCAGAGAAGATGAAGGATATCGACATAGGAAAAGAGTATATCATCCCCAGTCCTGGGTATAGAAGTGTGAGGGA
GAGAACCAGCACTTCTGGGACGCACAGAGACCGTGAAGATTCCAAGTTCAGGAGAACTCGACCGTTGGAATGCCAAGATGCCTTGGAAAC
AGCAGCCCGAGCCGAGGGCCTCTCTCTTGATGCCTCCATGCATTCTCAGCTCAGAATCCTGGATGAGGAGCATCCCAAGGGAAAGTACCA
TCATGGCTTGAGTGCTCTGAAGCCCATCCGGACTACTTCCAAACACCAGCACCCAGTGGACAATGCTGGGCTTTTTTCCTGTATGACTTT
TTCGTGGCTTTCTTCTCTGGCCCGTGTGGCCCACAAGAAGGGGGAGCTCTCAATGGAAGACGTGTGGTCTCTGTCCAAGCACGAGTCTTC
TGACGTGAACTGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACGCTGCTTCCCTGCGAAGGGTTGTGTG
GATCTTCTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGATGATCACGCAGCTGGCTGGCTTCAGTGGACCACCAACAGACCTCAG
GAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTA
GCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTT
CTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAG
CCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAAC
TTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCT
TCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTG
GAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCC
TGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAA

>In-frame_ABCC5_ENST00000382494_chr3_183705558_-_TGFBI_ENST00000305126_chr5_135397183_+_1441nt
GGCTCATGCTCGGGAGCGTGGTTGAGCGGCTGGCGCGGTTGTCCTGGAGCAGGGGCGCAGGAATTCTGATGTGAAACTAACAGTCTGTGA
GCCCTGGAACCTCCACTCAGAGAAGATGAAGGATATCGACATAGGAAAAGAGTATATCATCCCCAGTCCTGGGTATAGAAGTGTGAGGGA
GAGAACCAGCACTTCTGGGACGCACAGAGACCGTGAAGATTCCAAGTTCAGGAGAACTCGACCGTTGGAATGCCAAGATGCCTTGGAAAC
AGCAGCCCGAGCCGAGGGCCTCTCTCTTGATGCCTCCATGCATTCTCAGCTCAGAATCCTGGATGAGGAGCATCCCAAGGGAAAGTACCA
TCATGGCTTGAGTGCTCTGAAGCCCATCCGGACTACTTCCAAACACCAGCACCCAGTGGACAATGCTGGGCTTTTTTCCTGTATGACTTT
TTCGTGGCTTTCTTCTCTGGCCCGTGTGGCCCACAAGAAGGGGGAGCTCTCAATGGAAGACGTGTGGTCTCTGTCCAAGCACGAGTCTTC
TGACGTGAACTGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACGCTGCTTCCCTGCGAAGGGTTGTGTG
GATCTTCTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGATGATCACGCAGCTGGCTGGCTTCAGTGGACCACCAACAGACCTCAG
GAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGCCTGAGCAGCCTCAGGTCCTCTGT
TCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTT
CTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAG
CCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAAC
TTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCT
TCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTG
GAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCC
TGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAA

>In-frame_ABCC5_ENST00000382494_chr3_183705558_-_TGFBI_ENST00000508076_chr5_135397183_+_1441nt
GGCTCATGCTCGGGAGCGTGGTTGAGCGGCTGGCGCGGTTGTCCTGGAGCAGGGGCGCAGGAATTCTGATGTGAAACTAACAGTCTGTGA
GCCCTGGAACCTCCACTCAGAGAAGATGAAGGATATCGACATAGGAAAAGAGTATATCATCCCCAGTCCTGGGTATAGAAGTGTGAGGGA
GAGAACCAGCACTTCTGGGACGCACAGAGACCGTGAAGATTCCAAGTTCAGGAGAACTCGACCGTTGGAATGCCAAGATGCCTTGGAAAC
AGCAGCCCGAGCCGAGGGCCTCTCTCTTGATGCCTCCATGCATTCTCAGCTCAGAATCCTGGATGAGGAGCATCCCAAGGGAAAGTACCA
TCATGGCTTGAGTGCTCTGAAGCCCATCCGGACTACTTCCAAACACCAGCACCCAGTGGACAATGCTGGGCTTTTTTCCTGTATGACTTT
TTCGTGGCTTTCTTCTCTGGCCCGTGTGGCCCACAAGAAGGGGGAGCTCTCAATGGAAGACGTGTGGTCTCTGTCCAAGCACGAGTCTTC
TGACGTGAACTGCAGAAGACTAGAGAGACTGTGGCAAGAAGAGCTGAATGAAGTTGGGCCAGACGCTGCTTCCCTGCGAAGGGTTGTGTG
GATCTTCTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGATGATCACGCAGCTGGCTGGCTTCAGTGGACCACCAACAGACCTCAG
GAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTA
GCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTT
CTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAG
CCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAAC
TTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCT
TCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTG
GAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCC
TGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAA


Top

FusionGenePPI for ABCC5_TGFBI


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
ABCC5SMC2, SERPINA3, AK2, RBP5, SHMT2, MOV10, NXF1, TMEM17, NUPL1, TRDN, SCN3BTGFBIFN1, FAM9B


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for ABCC5_TGFBI


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for ABCC5_TGFBI


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneABCC5C0003873Rheumatoid Arthritis1CTD_human
HgeneABCC5C0009404Colorectal Neoplasms1CTD_human
HgeneABCC5C0023893Liver Cirrhosis, Experimental1CTD_human
TgeneTGFBIC1690006Lattice corneal dystrophy Type I12CTD_human;ORPHANET;UNIPROT
TgeneTGFBIC1641846Groenouw corneal dystrophy type I (disorder)7CTD_human;ORPHANET;UNIPROT
TgeneTGFBIC1275685Avellino corneal dystrophy6CTD_human;ORPHANET;UNIPROT
TgeneTGFBIC0339278Reis-Bucklers' corneal dystrophy5CTD_human;ORPHANET;UNIPROT
TgeneTGFBIC1837974Corneal Dystrophy, Lattice Type IIIA5CTD_human;UNIPROT
TgeneTGFBIC1562894Thiel-Behnke corneal dystrophy4CTD_human;ORPHANET;UNIPROT
TgeneTGFBIC0000786Spontaneous abortion1CTD_human
TgeneTGFBIC0011881Diabetic Nephropathy1CTD_human
TgeneTGFBIC0521723Corneal dystrophy, epithelial basement membrane1CTD_human;ORPHANET;UNIPROT