FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 13737

FusionGeneSummary for FOSL1_HN1

check button Fusion gene summary
Fusion gene informationFusion gene name: FOSL1_HN1
Fusion gene ID: 13737
HgeneTgene
Gene symbol

FOSL1

HN1

Gene ID

8061

Gene nameFOS like 1, AP-1 transcription factor subunit
SynonymsFRA|FRA1|fra-1
Cytomap

11q13.1

Type of geneprotein-coding
Descriptionfos-related antigen 1FOS like 1, AP-1 trancription factor subunitFOS-like antigen-1
Modification date20180523
UniProtAcc

P15407

Ensembl transtripts involved in fusion geneENST00000448083, ENST00000312562, 
ENST00000531493, ENST00000532401, 
ENST00000476258, ENST00000405458, 
ENST00000409753, ENST00000482348, 
ENST00000356033, ENST00000470924, 
ENST00000481647, ENST00000392566, 
ENST00000581874, ENST00000465454, 
Fusion gene scores* DoF score3 X 2 X 3=187 X 4 X 6=168
# samples 37
** MAII scorelog2(3/18*10)=0.736965594166206
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
log2(7/168*10)=-1.26303440583379
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: FOSL1 [Title/Abstract] AND HN1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneFOSL1

GO:0061614

pri-miRNA transcription by RNA polymerase II

21673316

HgeneFOSL1

GO:2000144

positive regulation of DNA-templated transcription, initiation

23027619


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDBLCATCGA-DK-AA75-01AFOSL1chr11

65667712

-HN1chr17

73132345

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000448083ENST00000476258FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000448083ENST00000405458FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000448083ENST00000409753FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000448083ENST00000482348FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000448083ENST00000356033FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000448083ENST00000470924FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000448083ENST00000481647FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000448083ENST00000392566FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-3UTRENST00000448083ENST00000581874FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-intronENST00000448083ENST00000465454FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000476258FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000405458FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000312562ENST00000409753FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000482348FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000356033FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000470924FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000312562ENST00000481647FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000312562ENST00000392566FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-3UTRENST00000312562ENST00000581874FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-intronENST00000312562ENST00000465454FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000476258FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000405458FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000531493ENST00000409753FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000482348FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000356033FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000470924FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000531493ENST00000481647FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000531493ENST00000392566FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-3UTRENST00000531493ENST00000581874FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-intronENST00000531493ENST00000465454FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000476258FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000405458FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000532401ENST00000409753FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000482348FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000356033FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000470924FOSL1chr11

65667712

-HN1chr17

73132345

-
Frame-shitENST00000532401ENST00000481647FOSL1chr11

65667712

-HN1chr17

73132345

-
In-frameENST00000532401ENST00000392566FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-3UTRENST00000532401ENST00000581874FOSL1chr11

65667712

-HN1chr17

73132345

-
5CDS-intronENST00000532401ENST00000465454FOSL1chr11

65667712

-HN1chr17

73132345

-

Top

FusionProtFeatures for FOSL1_HN1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
FOSL1

P15407

HN1

Lectin that binds to various sugars: galactose > mannose= fucose > N-acetylglucosamine > N-acetylgalactosamine(PubMed:10224141). Acts as a chemoattractant, probably involved inthe regulation of cell migration (PubMed:28301481).{ECO:0000269|PubMed:10224141, ECO:0000269|PubMed:28301481}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for FOSL1_HN1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_82aa

>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_83aa

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_82aa

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_83aa

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_82aa

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_83aa

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_82aa

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_83aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_248nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGG

>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_250nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCC

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_248nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGG

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_250nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCC

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_248nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGG

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_250nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCC

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_248nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGG

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_250nt
ATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCA
GCCCAGCAGAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCC


* Fusion transcript sequences (Full-length transcript).
>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_1182nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
AAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCGGC
CCCAGTGCCATCCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAGCTCTGACTGTCCTGAACGCTGTCGTTCTGTCT
GTTTCCTCCATGCTTGTGAACTGCACAACTTGAGCCTGACTGTACATCTCTTGGATTTGTTTCATTAAAAAGAAGCACTTTATGTACTGC
TGTCTTTTTTTTTTTTCTTTTGAAGAACAGGTTTCTCTCTGTCCTTGACTCTTGGGTCTGTGGGCCATGGCATGAGTGTTTTCTAGTAGT
AGATTGGAGGGAAAGCTTTGTGACACTTAGTACTGTGTTTTTAAGAAGAAATAATTTGGTTCCAGATGTGTTAGAGGATCTTTTGTACTG
AGGTTTTTAACACTTTACTTGGGTTTACCAAGCCTCAACTGGACAGACCATAAACAGTCCACAGGCACCGTTCCTGCCAGGCCCCAACCC
ACAGGGAGTCTCTCCGCAGAGCCTTCTTGGTGTTGCCCTAACTTGCCAGTGGCCTTTGCTCAGAGCCTCCTCCTGTGACATGTGAACAAT
GAAGAGGCCTGCGCCTCCTGCCTTGCCGCCTGCAAAGCAAAGAAACTGCCTTTTATTTTTTAACCTTAAAAAGTAGCCAGATAGTAACAA
GACTGGCTGGCTGATGAGCAAAGCCTTTGCTCTCACGCAGAGGAAGGCTTGGATGTACAATGAAACTGCCTGGAACTAAAAGCAGTGAAG
CAAGGGAGGCAATCACACTGAAGCGGGTCTTCCTCCAGGAACGGGGTCCCACAGGCGTGTTGTTTTAAATAACCTGATGCTGTGTGCATG
ATGCTGGTGCTTGACCATGAAAGGAAAGTCTCATCCTTAAAATGTGTTGTACTTCACAATCCTGGACTGTTGCTTCAAGTAAACAATATC

>In-frame_FOSL1_ENST00000448083_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_330nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
GAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCG

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_1289nt
ACGGGCCAAGGCGGCGCGTCTCGGGGGTGGAGCCTGGAGGTGACCGCGCCGCTGCAACGCCCCCACCCCCCGCGGTCGCAGTGGTTCAGC
CCGAGAACTTTTCATTCATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGC
CCCGGGCATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGC
GCAGGCAGCCCAGCAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCC
AGCCCGGTGGCCCCGGCCCCAGTGCCATCCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAGCTCTGACTGTCCTGA
ACGCTGTCGTTCTGTCTGTTTCCTCCATGCTTGTGAACTGCACAACTTGAGCCTGACTGTACATCTCTTGGATTTGTTTCATTAAAAAGA
AGCACTTTATGTACTGCTGTCTTTTTTTTTTTTCTTTTGAAGAACAGGTTTCTCTCTGTCCTTGACTCTTGGGTCTGTGGGCCATGGCAT
GAGTGTTTTCTAGTAGTAGATTGGAGGGAAAGCTTTGTGACACTTAGTACTGTGTTTTTAAGAAGAAATAATTTGGTTCCAGATGTGTTA
GAGGATCTTTTGTACTGAGGTTTTTAACACTTTACTTGGGTTTACCAAGCCTCAACTGGACAGACCATAAACAGTCCACAGGCACCGTTC
CTGCCAGGCCCCAACCCACAGGGAGTCTCTCCGCAGAGCCTTCTTGGTGTTGCCCTAACTTGCCAGTGGCCTTTGCTCAGAGCCTCCTCC
TGTGACATGTGAACAATGAAGAGGCCTGCGCCTCCTGCCTTGCCGCCTGCAAAGCAAAGAAACTGCCTTTTATTTTTTAACCTTAAAAAG
TAGCCAGATAGTAACAAGACTGGCTGGCTGATGAGCAAAGCCTTTGCTCTCACGCAGAGGAAGGCTTGGATGTACAATGAAACTGCCTGG
AACTAAAAGCAGTGAAGCAAGGGAGGCAATCACACTGAAGCGGGTCTTCCTCCAGGAACGGGGTCCCACAGGCGTGTTGTTTTAAATAAC
CTGATGCTGTGTGCATGATGCTGGTGCTTGACCATGAAAGGAAAGTCTCATCCTTAAAATGTGTTGTACTTCACAATCCTGGACTGTTGC

>In-frame_FOSL1_ENST00000312562_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_437nt
ACGGGCCAAGGCGGCGCGTCTCGGGGGTGGAGCCTGGAGGTGACCGCGCCGCTGCAACGCCCCCACCCCCCGCGGTCGCAGTGGTTCAGC
CCGAGAACTTTTCATTCATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGC
CCCGGGCATGTTCCGAGACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGC
GCAGGCAGCCCAGCAGAGAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGC

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_1182nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
AAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCGGC
CCCAGTGCCATCCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAGCTCTGACTGTCCTGAACGCTGTCGTTCTGTCT
GTTTCCTCCATGCTTGTGAACTGCACAACTTGAGCCTGACTGTACATCTCTTGGATTTGTTTCATTAAAAAGAAGCACTTTATGTACTGC
TGTCTTTTTTTTTTTTCTTTTGAAGAACAGGTTTCTCTCTGTCCTTGACTCTTGGGTCTGTGGGCCATGGCATGAGTGTTTTCTAGTAGT
AGATTGGAGGGAAAGCTTTGTGACACTTAGTACTGTGTTTTTAAGAAGAAATAATTTGGTTCCAGATGTGTTAGAGGATCTTTTGTACTG
AGGTTTTTAACACTTTACTTGGGTTTACCAAGCCTCAACTGGACAGACCATAAACAGTCCACAGGCACCGTTCCTGCCAGGCCCCAACCC
ACAGGGAGTCTCTCCGCAGAGCCTTCTTGGTGTTGCCCTAACTTGCCAGTGGCCTTTGCTCAGAGCCTCCTCCTGTGACATGTGAACAAT
GAAGAGGCCTGCGCCTCCTGCCTTGCCGCCTGCAAAGCAAAGAAACTGCCTTTTATTTTTTAACCTTAAAAAGTAGCCAGATAGTAACAA
GACTGGCTGGCTGATGAGCAAAGCCTTTGCTCTCACGCAGAGGAAGGCTTGGATGTACAATGAAACTGCCTGGAACTAAAAGCAGTGAAG
CAAGGGAGGCAATCACACTGAAGCGGGTCTTCCTCCAGGAACGGGGTCCCACAGGCGTGTTGTTTTAAATAACCTGATGCTGTGTGCATG
ATGCTGGTGCTTGACCATGAAAGGAAAGTCTCATCCTTAAAATGTGTTGTACTTCACAATCCTGGACTGTTGCTTCAAGTAAACAATATC

>In-frame_FOSL1_ENST00000531493_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_330nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
GAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCG

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000409753_chr17_73132345_-_1182nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
AAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCGGC
CCCAGTGCCATCCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAGCTCTGACTGTCCTGAACGCTGTCGTTCTGTCT
GTTTCCTCCATGCTTGTGAACTGCACAACTTGAGCCTGACTGTACATCTCTTGGATTTGTTTCATTAAAAAGAAGCACTTTATGTACTGC
TGTCTTTTTTTTTTTTCTTTTGAAGAACAGGTTTCTCTCTGTCCTTGACTCTTGGGTCTGTGGGCCATGGCATGAGTGTTTTCTAGTAGT
AGATTGGAGGGAAAGCTTTGTGACACTTAGTACTGTGTTTTTAAGAAGAAATAATTTGGTTCCAGATGTGTTAGAGGATCTTTTGTACTG
AGGTTTTTAACACTTTACTTGGGTTTACCAAGCCTCAACTGGACAGACCATAAACAGTCCACAGGCACCGTTCCTGCCAGGCCCCAACCC
ACAGGGAGTCTCTCCGCAGAGCCTTCTTGGTGTTGCCCTAACTTGCCAGTGGCCTTTGCTCAGAGCCTCCTCCTGTGACATGTGAACAAT
GAAGAGGCCTGCGCCTCCTGCCTTGCCGCCTGCAAAGCAAAGAAACTGCCTTTTATTTTTTAACCTTAAAAAGTAGCCAGATAGTAACAA
GACTGGCTGGCTGATGAGCAAAGCCTTTGCTCTCACGCAGAGGAAGGCTTGGATGTACAATGAAACTGCCTGGAACTAAAAGCAGTGAAG
CAAGGGAGGCAATCACACTGAAGCGGGTCTTCCTCCAGGAACGGGGTCCCACAGGCGTGTTGTTTTAAATAACCTGATGCTGTGTGCATG
ATGCTGGTGCTTGACCATGAAAGGAAAGTCTCATCCTTAAAATGTGTTGTACTTCACAATCCTGGACTGTTGCTTCAAGTAAACAATATC

>In-frame_FOSL1_ENST00000532401_chr11_65667712_-_HN1_ENST00000392566_chr17_73132345_-_330nt
ATAAAAAGAAAAGACTCCGCACGGCGCGGGTGAGTCAGAACCCAGCAGCCGTGTACCCCGCAGAGCCGCCAGCCCCGGGCATGTTCCGAG
ACTTCGGGGAACCCGGCCCGAGCTCCGGGAACGGCGGCGGGTACGGCGGCCCCGCGCAGCCCCCGGCCGCAGCGCAGGCAGCCCAGCAGA
GAAAATGTGGACACAGACTTGCCAGGCAGCCTGGGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCG


Top

FusionGenePPI for FOSL1_HN1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
FOSL1LDOC1, CALCOCO1, JUNB, USF1, JUN, TRIM24, HDAC1, CREBBP, EP300, PSMC3, ATXN1, MYC, MAFB, MAF, ATF3, ATF4, ATF2, CEBPE, CEBPA, CEBPG, DDIT3, PARVG, KPNA1, TAB2, WFDC1, CREB5, NME7, DNMT3L, TICAM1, TRAF3HN1ARHGAP44, SFPQ, KPNA2, CPLX1, PMPCB, SEPT9, UNK, CFL1, COTL1, HSPB1, PLIN3, SNCG, STMN1, TRIM28, CDH1, EGFR


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for FOSL1_HN1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for FOSL1_HN1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource