FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 13702

FusionGeneSummary for FNIP1_CYP3A4

check button Fusion gene summary
Fusion gene informationFusion gene name: FNIP1_CYP3A4
Fusion gene ID: 13702
HgeneTgene
Gene symbol

FNIP1

CYP3A4

Gene ID

96459

1576

Gene namefolliculin interacting protein 1cytochrome P450 family 3 subfamily A member 4
Synonyms-CP33|CP34|CYP3A|CYP3A3|CYPIIIA3|CYPIIIA4|HLP|NF-25|P450C3|P450PCN1
Cytomap

5q31.1

7q22.1

Type of geneprotein-codingprotein-coding
Descriptionfolliculin-interacting protein 1cytochrome P450 3A41,8-cineole 2-exo-monooxygenaseP450-III, steroid induciblealbendazole monooxygenasealbendazole sulfoxidasecholesterol 25-hydroxylasecytochrome P450 3A3cytochrome P450 HLpcytochrome P450 NF-25cytochrome P450, family 3, subfamily
Modification date2018051920180527
UniProtAcc

Q8TF40

P08684

Ensembl transtripts involved in fusion geneENST00000307968, ENST00000307954, 
ENST00000510461, ENST00000511848, 
ENST00000354593, ENST00000336411, 
Fusion gene scores* DoF score6 X 4 X 6=1444 X 4 X 3=48
# samples 84
** MAII scorelog2(8/144*10)=-0.84799690655495
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(4/48*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: FNIP1 [Title/Abstract] AND CYP3A4 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneFNIP1

GO:0000122

negative regulation of transcription by RNA polymerase II

21209915

HgeneFNIP1

GO:0001932

regulation of protein phosphorylation

18663353

HgeneFNIP1

GO:0031334

positive regulation of protein complex assembly

25126726

HgeneFNIP1

GO:0033138

positive regulation of peptidyl-serine phosphorylation

19914239

TgeneCYP3A4

GO:0002933

lipid hydroxylation

14559847

TgeneCYP3A4

GO:0008202

steroid metabolic process

14559847

TgeneCYP3A4

GO:0009822

alkaloid catabolic process

15039299

TgeneCYP3A4

GO:0016098

monoterpenoid metabolic process

16401082

TgeneCYP3A4

GO:0017144

drug metabolic process

15327587|19219744

TgeneCYP3A4

GO:0042737

drug catabolic process

15039299

TgeneCYP3A4

GO:0042738

exogenous drug catabolic process

18619574

TgeneCYP3A4

GO:0046483

heterocycle metabolic process

15327587

TgeneCYP3A4

GO:0055114

oxidation-reduction process

16401082|19219744

TgeneCYP3A4

GO:0070989

oxidative demethylation

15039299|18619574


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDLIHCTCGA-DD-A73F-01AFNIP1chr5

131132523

-CYP3A4chr7

99355851

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000307968ENST00000354593FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
In-frameENST00000307968ENST00000336411FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
Frame-shitENST00000307954ENST00000354593FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
In-frameENST00000307954ENST00000336411FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
Frame-shitENST00000510461ENST00000354593FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
In-frameENST00000510461ENST00000336411FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
Frame-shitENST00000511848ENST00000354593FNIP1chr5

131132523

-CYP3A4chr7

99355851

-
In-frameENST00000511848ENST00000336411FNIP1chr5

131132523

-CYP3A4chr7

99355851

-

Top

FusionProtFeatures for FNIP1_CYP3A4


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
FNIP1

Q8TF40

CYP3A4

P08684

Acts as a co-chaperone of HSP90AA1. Inhibits the ATPaseactivity of HSP90AA1 leading to reduction in its chaperoneactivity. Facilitates the binding of client protein FLCN toHSP90AA1. Competes with the activating co-chaperone AHSA1 forbinding to HSP90AA1, thereby providing a reciprocal regulatorymechanism for chaperoning of client proteins (PubMed:27353360).May be involved in energy and/or nutrient sensing through the AMPKand mTOR signaling pathways (PubMed:17028174). May regulatephosphorylation of RPS6KB1 (PubMed:18663353).{ECO:0000269|PubMed:17028174, ECO:0000269|PubMed:18663353,ECO:0000269|PubMed:27353360}. Cytochromes P450 are a group of heme-thiolatemonooxygenases. In liver microsomes, this enzyme is involved in anNADPH-dependent electron transport pathway. It performs a varietyof oxidation reactions (e.g. caffeine 8-oxidation, omeprazolesulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, includingsteroids, fatty acids, and xenobiotics. Acts as a 1,8-cineole 2-exo-monooxygenase. The enzyme also hydroxylates etoposide(PubMed:11159812). Catalyzes 4-beta-hydroxylation of cholesterol.May catalyze 25-hydroxylation of cholesterol in vitro(PubMed:21576599). {ECO:0000269|PubMed:11159812,ECO:0000269|PubMed:21576599}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for FNIP1_CYP3A4


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_FNIP1_ENST00000307968_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_62aa

>In-frame_FNIP1_ENST00000307954_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_62aa

>In-frame_FNIP1_ENST00000510461_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_62aa

>In-frame_FNIP1_ENST00000511848_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_62aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_FNIP1_ENST00000307968_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_188nt
ATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCGGGTTC
AGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTG

>In-frame_FNIP1_ENST00000307954_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_188nt
ATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCGGGTTC
AGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTG

>In-frame_FNIP1_ENST00000510461_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_188nt
ATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCGGGTTC
AGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTG

>In-frame_FNIP1_ENST00000511848_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_188nt
ATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCGGGTTC
AGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTG


* Fusion transcript sequences (Full-length transcript).
>In-frame_FNIP1_ENST00000307968_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_645nt
ATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCGGGTTC
AGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTG
GAGCCTGAATTTTCCTAAGGACTTCTGCTTTGCTCTTCAAGAAATCTGTGCCTGAGAACACCAGAGACCTCAAATTACTTTGTGAATAGA
ACTCTGAAATGAAGATGGGCTTCATCCAATGGACTGCATAAATAACCGGGGATTCTGTACATGCATTGAGCTCTCTCATTGTCTGTGTAG
AGTGTTATACTTGGGAATATAAAGGAGGTGACCAAATCAGTGTGAGGAGGTAGATTTGGCTCCTCTGCTTCTCACGGGACTATTTCCACC
ACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTCTGATAAGAGAATCAACATTTCTCAATAATTTCCTCCACAAATTATTAATGAAAAT
AAGAATTATTTTGATGGCTCTAACAATGACATTTATATCACATGTTTTCTCTGGAGTATTCTATAAGTTTTATGTTAAATCAATAAAGAC

>In-frame_FNIP1_ENST00000307954_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_674nt
GGAGCGACCCCTGCCTGGCCGTGGCTAGCATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCC
GCGACGCCCGGGACCCAGATTGCGGGTTCAGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAA
GGTTGAGTCAAGGGATGGCACCGTAAGTGGAGCCTGAATTTTCCTAAGGACTTCTGCTTTGCTCTTCAAGAAATCTGTGCCTGAGAACAC
CAGAGACCTCAAATTACTTTGTGAATAGAACTCTGAAATGAAGATGGGCTTCATCCAATGGACTGCATAAATAACCGGGGATTCTGTACA
TGCATTGAGCTCTCTCATTGTCTGTGTAGAGTGTTATACTTGGGAATATAAAGGAGGTGACCAAATCAGTGTGAGGAGGTAGATTTGGCT
CCTCTGCTTCTCACGGGACTATTTCCACCACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTCTGATAAGAGAATCAACATTTCTCAAT
AATTTCCTCCACAAATTATTAATGAAAATAAGAATTATTTTGATGGCTCTAACAATGACATTTATATCACATGTTTTCTCTGGAGTATTC

>In-frame_FNIP1_ENST00000510461_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_741nt
ATATGACTGAGGCGCCCATGGGGGTGGCGGGGCGGCTGTAGGAGCAGGGGCCTAGCAAGCGCCCAGCGGAGCGACCCCTGCCTGGCCGTG
GCTAGCATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGC
GGGTTCAGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCG
TAAGTGGAGCCTGAATTTTCCTAAGGACTTCTGCTTTGCTCTTCAAGAAATCTGTGCCTGAGAACACCAGAGACCTCAAATTACTTTGTG
AATAGAACTCTGAAATGAAGATGGGCTTCATCCAATGGACTGCATAAATAACCGGGGATTCTGTACATGCATTGAGCTCTCTCATTGTCT
GTGTAGAGTGTTATACTTGGGAATATAAAGGAGGTGACCAAATCAGTGTGAGGAGGTAGATTTGGCTCCTCTGCTTCTCACGGGACTATT
TCCACCACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTCTGATAAGAGAATCAACATTTCTCAATAATTTCCTCCACAAATTATTAAT
GAAAATAAGAATTATTTTGATGGCTCTAACAATGACATTTATATCACATGTTTTCTCTGGAGTATTCTATAAGTTTTATGTTAAATCAAT

>In-frame_FNIP1_ENST00000511848_chr5_131132523_-_CYP3A4_ENST00000336411_chr7_99355851_-_740nt
TATGACTGAGGCGCCCATGGGGGTGGCGGGGCGGCTGTAGGAGCAGGGGCCTAGCAAGCGCCCAGCGGAGCGACCCCTGCCTGGCCGTGG
CTAGCATGGCCCCTACGCTGTTCCAGAAGCTCTTCAGCAAGAGGACCGGGCTGGGCGCGCCCGGCCGCGACGCCCGGGACCCAGATTGCG
GGTTCAGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCAGAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGT
AAGTGGAGCCTGAATTTTCCTAAGGACTTCTGCTTTGCTCTTCAAGAAATCTGTGCCTGAGAACACCAGAGACCTCAAATTACTTTGTGA
ATAGAACTCTGAAATGAAGATGGGCTTCATCCAATGGACTGCATAAATAACCGGGGATTCTGTACATGCATTGAGCTCTCTCATTGTCTG
TGTAGAGTGTTATACTTGGGAATATAAAGGAGGTGACCAAATCAGTGTGAGGAGGTAGATTTGGCTCCTCTGCTTCTCACGGGACTATTT
CCACCACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTCTGATAAGAGAATCAACATTTCTCAATAATTTCCTCCACAAATTATTAATG
AAAATAAGAATTATTTTGATGGCTCTAACAATGACATTTATATCACATGTTTTCTCTGGAGTATTCTATAAGTTTTATGTTAAATCAATA


Top

FusionGenePPI for FNIP1_CYP3A4


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
FNIP1HSP90AA1, PRKAA1, PRKAB1, PRKAG1, FLCN, PRKAA2, FBXW11, COPS5, BTRC, HSPA5, GABARAP, HSPA1B, STIP1, CDC37, PTGES3, NR3C1, CDK4, BRAF, FNIP1, FNIP2, TRIM25CYP3A4AMFR, STUB1, PGRMC1, POR, CYB5A, GK, PRKACA, PRKCA, CYP3A4, UBE2G1, UBE2D1, HSPA8, UGT2B7, CYP2C9, UGT1A6, UGT1A1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for FNIP1_CYP3A4


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
TgeneCYP3A4P08684DB01267PaliperidoneCytochrome P450 3A4small moleculeapproved
TgeneCYP3A4P08684DB00951IsoniazidCytochrome P450 3A4small moleculeapproved|investigational
TgeneCYP3A4P08684DB11994DiacereinCytochrome P450 3A4small moleculeapproved|investigational
TgeneCYP3A4P08684DB00143GlutathioneCytochrome P450 3A4small moleculeapproved|investigational|nutraceutical

Top

RelatedDiseases for FNIP1_CYP3A4


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgeneCYP3A4C0019196Hepatitis C1CTD_human
TgeneCYP3A4C0029463Osteosarcoma1CTD_human
TgeneCYP3A4C0033578Prostatic Neoplasms1CTD_human
TgeneCYP3A4C0036341Schizophrenia1PSYGENET
TgeneCYP3A4C0040479Torsades de Pointes1CTD_human
TgeneCYP3A4C0086132Depressive Symptoms1PSYGENET
TgeneCYP3A4C0221765Chronic schizophrenia1PSYGENET
TgeneCYP3A4C1458155Mammary Neoplasms1CTD_human