FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 12229

FusionGeneSummary for EWSR1_ATP1A1

check button Fusion gene summary
Fusion gene informationFusion gene name: EWSR1_ATP1A1
Fusion gene ID: 12229
HgeneTgene
Gene symbol

EWSR1

ATP1A1

Gene ID

2130

480

Gene nameEWS RNA binding protein 1ATPase Na+/K+ transporting subunit alpha 4
SynonymsEWS|EWS-FLI1|bK984G1.4ATP1A1|ATP1AL2
Cytomap

22q12.2

1q23.2

Type of geneprotein-codingprotein-coding
DescriptionRNA-binding protein EWSEWS RNA-binding protein variant 6Ewing sarcoma breakpoint region 1Ewings sarcoma EWS-Fli1 (type 1) oncogenesodium/potassium-transporting ATPase subunit alpha-4ATPase, Na+/K+ transporting, alpha 4 polypeptideATPase, Na+/K+ transporting, alpha polypeptide-like 2Na(+)/K(+) ATPase alpha-4 subunitNa+/K+ ATPase 4Na+/K+ ATPase, alpha-D polypeptideNa,K-ATPase su
Modification date2018052720180523
UniProtAcc

Q01844

P05023

Ensembl transtripts involved in fusion geneENST00000332050, ENST00000397938, 
ENST00000406548, ENST00000331029, 
ENST00000414183, ENST00000333395, 
ENST00000332035, 
ENST00000295598, 
ENST00000537345, ENST00000369496, 
ENST00000491156, 
Fusion gene scores* DoF score17 X 31 X 5=263513 X 20 X 3=780
# samples 5321
** MAII scorelog2(53/2635*10)=-2.31373869707402
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(21/780*10)=-1.89308479608349
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: EWSR1 [Title/Abstract] AND ATP1A1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneATP1A1

GO:0030317

flagellated sperm motility

12112599

TgeneATP1A1

GO:0030641

regulation of cellular pH

12112599


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1BU629169EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000332050ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000332050ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000332050ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000332050ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000397938ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000397938ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000397938ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000397938ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000406548ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000406548ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000406548ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000406548ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000331029ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000331029ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000331029ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000331029ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000414183ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000414183ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000414183ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000414183ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
intron-3CDSENST00000333395ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
intron-3CDSENST00000333395ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
intron-3CDSENST00000333395ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
intron-3CDSENST00000333395ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000332035ENST00000295598EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000332035ENST00000537345EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
Frame-shitENST00000332035ENST00000369496EWSR1chr22

29695819

-ATP1A1chr1

116931346

-
In-frameENST00000332035ENST00000491156EWSR1chr22

29695819

-ATP1A1chr1

116931346

-

Top

FusionProtFeatures for EWSR1_ATP1A1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
EWSR1

Q01844

ATP1A1

P05023

Might normally function as a transcriptional repressor.EWS-fusion-proteins (EFPS) may play a role in the tumorigenicprocess. They may disturb gene expression by mimicking, orinterfering with the normal function of CTD-POLII within thetranscription initiation complex. They may also contribute to anaberrant activation of the fusion protein target genes.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for EWSR1_ATP1A1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_EWSR1_ENST00000332050_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa

>In-frame_EWSR1_ENST00000397938_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa

>In-frame_EWSR1_ENST00000406548_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa

>In-frame_EWSR1_ENST00000331029_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa

>In-frame_EWSR1_ENST00000414183_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa

>In-frame_EWSR1_ENST00000332035_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_44aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_EWSR1_ENST00000332050_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG

>In-frame_EWSR1_ENST00000397938_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG

>In-frame_EWSR1_ENST00000406548_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG

>In-frame_EWSR1_ENST00000331029_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG

>In-frame_EWSR1_ENST00000414183_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG

>In-frame_EWSR1_ENST00000332035_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_132nt
ATGAAGGACTGAACCATGAATGCAAACTCTGCAGCCAGACCTTTGACTCTCCTGCCAAACTCCAGTGCCACCTGATAGAGCACAGCTTCG


* Fusion transcript sequences (Full-length transcript).
>In-frame_EWSR1_ENST00000332050_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA

>In-frame_EWSR1_ENST00000397938_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA

>In-frame_EWSR1_ENST00000406548_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA

>In-frame_EWSR1_ENST00000331029_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA

>In-frame_EWSR1_ENST00000414183_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA

>In-frame_EWSR1_ENST00000332035_chr22_29695819_-_ATP1A1_ENST00000491156_chr1_116931346_-_666nt
CCGAATTCCTGCTGACCTCAGAATCATATCTGCAAATGGCTGCAAGGTGGATAACTCCTCGCTCACTGGTGAATCAGAACCCCAGACTAG
GTCTCCAGATTTCACAAATGAAAACCCCCTGGAGACGAGGAACATTGCCTTCTTTTCAACCAATTGTGTTGAAGGCACCGCACGTGGTAT
TGTTGTCTACACTGGGGATCGCACTGTGATGGGAAGAATTGCCACACTTGCTTCTGGGCTGGAAGGAGGCCAGACCCCCATTGCTGCAGA
AATTGAACATTTTATCCACATCATCACGGGTGTGGCTGTGTTCCTGGGTGTGTCTTTCTTCATCCTTTCTCTCATCCTTGAGTACACCTG
GCTTGAGGCTGTCATCTTCCTCATCGGTATCATCGTAGCCAATGTGCCGGAAGGTTTGCTGGCCACTGTCACGGTAAGAGGCAGGTGATG
GTCACCCTGACTCAGATCAGCTTGCACGAATGTTACACTCTTCCGCTATCCTATTCTAAGGTATTGCCAACTTATGTTTTATTCTGGATG
TTTGATATAGTTCTTCTTGAGAGCCACATCACGTGGTGAATTTTGACAGTGAGAAAACCTCAGCATTTGTTTATACGTAAGATAACCCCA


Top

FusionGenePPI for EWSR1_ATP1A1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for EWSR1_ATP1A1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
TgeneATP1A1P05023DB00390DigoxinSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB00511AcetyldigitoxinSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB01078DeslanosideSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB01092OuabainSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB01119DiazoxideSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB01430AlmitrineSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved
TgeneATP1A1P05023DB00774HydroflumethiazideSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB00903Etacrynic acidSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB01188CiclopiroxSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB01345PotassiumSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB01370AluminiumSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB01396DigitoxinSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|investigational
TgeneATP1A1P05023DB01378MagnesiumSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|nutraceutical
TgeneATP1A1P05023DB01021TrichlormethiazideSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|vet_approved
TgeneATP1A1P05023DB01244BepridilSodium/potassium-transporting ATPase subunit alpha-1small moleculeapproved|withdrawn

Top

RelatedDiseases for EWSR1_ATP1A1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneEWSR1C0553580Ewings sarcoma3CTD_human;HPO;ORPHANET
HgeneEWSR1C0206663Neuroectodermal Tumor, Primitive1CTD_human
TgeneATP1A1C0001430Adenoma2CTD_human
TgeneATP1A1C0005586Bipolar Disorder1PSYGENET
TgeneATP1A1C0020428Hyperaldosteronism1CTD_human
TgeneATP1A1C0020538Hypertensive disease1CTD_human
TgeneATP1A1C0042594Vestibular Diseases1CTD_human
TgeneATP1A1C0151744Myocardial Ischemia1CTD_human