FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 12014

FusionGeneSummary for ERG_RPS18

check button Fusion gene summary
Fusion gene informationFusion gene name: ERG_RPS18
Fusion gene ID: 12014
HgeneTgene
Gene symbol

ERG

RPS18

Gene ID

2078

6222

Gene nameERG, ETS transcription factorribosomal protein S18
Synonymserg-3|p55D6S218E|HKE3|KE-3|KE3|S18
Cytomap

21q22.2

6p21.32

Type of geneprotein-codingprotein-coding
Descriptiontranscriptional regulator ERGFUS/ERG fusion proteinTMPRSS2/ERG fusionerythroblast transformation-specific transcription factor ERG variant 10ets-relatedtranscriptional regulator ERG (transforming protein ERG)v-ets avian erythroblastosis virus E26 on40S ribosomal protein S18rhabdomyosarcoma antigen MU-RMS-40.21small ribosomal subunit protein uS13
Modification date2018052320180523
UniProtAcc

P11308

P62269

Ensembl transtripts involved in fusion geneENST00000398907, ENST00000398905, 
ENST00000288319, ENST00000398897, 
ENST00000398911, ENST00000398910, 
ENST00000417133, ENST00000442448, 
ENST00000453032, ENST00000398919, 
ENST00000429727, ENST00000485493, 
ENST00000439602, ENST00000474973, 
ENST00000476222, ENST00000454021, 
ENST00000486781, ENST00000484321, 
ENST00000457341, ENST00000476337, 
ENST00000494232, ENST00000434122, 
ENST00000470276, ENST00000211372, 
ENST00000477055, ENST00000476288, 
ENST00000440980, ENST00000497078, 
Fusion gene scores* DoF score15 X 4 X 3=1803 X 2 X 3=18
# samples 193
** MAII scorelog2(19/180*10)=0.0780025120012732
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
log2(3/18*10)=0.736965594166206
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: ERG [Title/Abstract] AND RPS18 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneERG

GO:0045944

positive regulation of transcription by RNA polymerase II

18195090|23913826


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDPRADTCGA-VN-A88L-01AERGchr21

39947586

-RPS18chr6

33240405

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
intron-3CDSENST00000398907ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
intron-5UTRENST00000398907ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3UTRENST00000398907ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398907ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3CDSENST00000398905ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
intron-5UTRENST00000398905ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3UTRENST00000398905ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000398905ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3CDSENST00000288319ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
intron-5UTRENST00000288319ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3UTRENST00000288319ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000288319ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-3CDSENST00000398897ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-5UTRENST00000398897ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-3UTRENST00000398897ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000398897ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
In-frameENST00000398911ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-5UTRENST00000398911ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-3UTRENST00000398911ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398911ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
Frame-shitENST00000398910ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-5UTRENST00000398910ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-3UTRENST00000398910ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398910ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
Frame-shitENST00000417133ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-5UTRENST00000417133ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-3UTRENST00000417133ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000417133ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
Frame-shitENST00000442448ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-5UTRENST00000442448ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-3UTRENST00000442448ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000442448ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3CDSENST00000453032ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
intron-5UTRENST00000453032ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3UTRENST00000453032ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000453032ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
In-frameENST00000398919ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-5UTRENST00000398919ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-3UTRENST00000398919ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5CDS-intronENST00000398919ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3CDSENST00000429727ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
intron-5UTRENST00000429727ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
intron-3UTRENST00000429727ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
intron-intronENST00000429727ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-3CDSENST00000485493ENST00000439602ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-5UTRENST00000485493ENST00000474973ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-3UTRENST00000485493ENST00000476222ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000454021ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000486781ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000484321ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000457341ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000476337ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000494232ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000434122ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000470276ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000211372ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000477055ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000476288ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000440980ERGchr21

39947586

-RPS18chr6

33240405

+
5UTR-intronENST00000485493ENST00000497078ERGchr21

39947586

-RPS18chr6

33240405

+

Top

FusionProtFeatures for ERG_RPS18


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
ERG

P11308

RPS18

P62269

Transcriptional regulator. May participate intranscriptional regulation through the recruitment of SETDB1histone methyltransferase and subsequent modification of localchromatin structure. Located at the top of the head of the 40S subunit, itcontacts several helices of the 18S rRNA. {ECO:0000250}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for ERG_RPS18


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_ERG_ENST00000398911_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_165aa
MIQTVPDPAAHIKSLVIPEKFQHILRVLNTNIDGRRKIAFAITAIKGVGRRTAHVVLRKADIDLTKRAGELTEDEVERVITIMQNPRQYK

>In-frame_ERG_ENST00000398919_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_165aa
MIQTVPDPAAHIKSLVIPEKFQHILRVLNTNIDGRRKIAFAITAIKGVGRRTAHVVLRKADIDLTKRAGELTEDEVERVITIMQNPRQYK


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_ERG_ENST00000398911_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_495nt
ATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGTCTCTAGTGATCCCTGAAAAGTTCCAGCATATTTTGCGAGTACTCAACACC
AACATCGATGGGCGGCGGAAAATAGCCTTTGCCATCACTGCCATTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGGAAAGCA
GACATTGACCTCACCAAGAGGGCGGGAGAACTCACTGAGGATGAGGTGGAACGTGTGATCACCATTATGCAGAATCCACGCCAGTACAAG
ATCCCAGACTGGTTCTTGAACAGACAGAAGGATGTAAAGGATGGAAAATACAGCCAGGTCCTAGCCAATGGTCTGGACAACAAGCTCCGT
GAAGACCTGGAGCGACTGAAGAAGATTCGGGCCCATAGAGGGCTGCGTCACTTCTGGGGCCTTCGTGTCCGAGGCCAGCACACCAAGACC

>In-frame_ERG_ENST00000398919_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_495nt
ATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGTCTCTAGTGATCCCTGAAAAGTTCCAGCATATTTTGCGAGTACTCAACACC
AACATCGATGGGCGGCGGAAAATAGCCTTTGCCATCACTGCCATTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGGAAAGCA
GACATTGACCTCACCAAGAGGGCGGGAGAACTCACTGAGGATGAGGTGGAACGTGTGATCACCATTATGCAGAATCCACGCCAGTACAAG
ATCCCAGACTGGTTCTTGAACAGACAGAAGGATGTAAAGGATGGAAAATACAGCCAGGTCCTAGCCAATGGTCTGGACAACAAGCTCCGT
GAAGACCTGGAGCGACTGAAGAAGATTCGGGCCCATAGAGGGCTGCGTCACTTCTGGGGCCTTCGTGTCCGAGGCCAGCACACCAAGACC


* Fusion transcript sequences (Full-length transcript).
>In-frame_ERG_ENST00000398911_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_688nt
GTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAA
GGGCAACTAAAGCCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTGAAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTC
ATATCAAGTCTCTAGTGATCCCTGAAAAGTTCCAGCATATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTTG
CCATCACTGCCATTAAGGGTGTGGGCCGAAGATATGCTCATGTGGTGTTGAGGAAAGCAGACATTGACCTCACCAAGAGGGCGGGAGAAC
TCACTGAGGATGAGGTGGAACGTGTGATCACCATTATGCAGAATCCACGCCAGTACAAGATCCCAGACTGGTTCTTGAACAGACAGAAGG
ATGTAAAGGATGGAAAATACAGCCAGGTCCTAGCCAATGGTCTGGACAACAAGCTCCGTGAAGACCTGGAGCGACTGAAGAAGATTCGGG
CCCATAGAGGGCTGCGTCACTTCTGGGGCCTTCGTGTCCGAGGCCAGCACACCAAGACCACTGGCCGCCGTGGCCGCACCGTGGGTGTGT

>In-frame_ERG_ENST00000398919_chr21_39947586_-_RPS18_ENST00000439602_chr6_33240405_+_834nt
GCTGAGCCCGTCGGCGCCGAGGGAGTTAGTGCGACCCGGCTCGGCGCGCACGGCCAAGGCACGCGCGCTGGCACACGCGGGCGCGGACAC
GCGCGGACACACACGTGCGGGACACGCCCTCCCCCGACGGCGGCGCTAACCTCTCGGTTATTCCAGGATCTTTGGAGACCCGAGGAAAGC
CGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAGCCGTCAGGTTCTGAACAGCTGG
TAGATGGGCTGGCTTACTGAAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGTCTCTAGTGATCCCTGAAAAGTTCCA
GCATATTTTGCGAGTACTCAACACCAACATCGATGGGCGGCGGAAAATAGCCTTTGCCATCACTGCCATTAAGGGTGTGGGCCGAAGATA
TGCTCATGTGGTGTTGAGGAAAGCAGACATTGACCTCACCAAGAGGGCGGGAGAACTCACTGAGGATGAGGTGGAACGTGTGATCACCAT
TATGCAGAATCCACGCCAGTACAAGATCCCAGACTGGTTCTTGAACAGACAGAAGGATGTAAAGGATGGAAAATACAGCCAGGTCCTAGC
CAATGGTCTGGACAACAAGCTCCGTGAAGACCTGGAGCGACTGAAGAAGATTCGGGCCCATAGAGGGCTGCGTCACTTCTGGGGCCTTCG
TGTCCGAGGCCAGCACACCAAGACCACTGGCCGCCGTGGCCGCACCGTGGGTGTGTCCAAGAAGAAATAAGTCTGTAGGCCTTGTCTGTT


Top

FusionGenePPI for ERG_RPS18


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
ERGJUN, ETS2, AR, HSPA4, HSPA8, NEDD4, PRKDC, XRCC5, XRCC6, PARP1, XRCC4, NME1, DDX3X, PCBP1, HNRNPA2B1, DDX5, TRIM21, TPM1, HNRNPM, EIF2S1, RPLP0, PRPF8, RPL7A, HNRNPDL, TUBB, CAD, ACTB, ATP5A1, RPS18, HNRNPU, SPTAN1, DNAJA1, DNAJA2, DNAJA4, APP, USP9X, ADAR, CDC5L, CLTC, DDX21, DDX23, DKC1, EEF1A2, ELAVL1, FBL, HNRNPA1, HNRNPAB, HNRNPC, HNRNPD, HNRNPF, HNRNPH1, HNRNPH3, HNRNPUL1, HNRNPUL2, HSPD1, ILF2, ILF3, LANCL1, MATR3, NCL, NOLC1, NONO, NPM1, NUMA1, POLR2A, PRPF40A, PUF60, RCC2, SF3B1, SF3B2, SF3B3, SFPQ, SNRNP200, SYN1, TOP1, TOP2B, XRN2, CUL3, SPOP, TRIM25, UBR5, TRIM33, RING1, UBR4, RNF2, TRIP12, HUWE1, STUB1, UHRF1, HERC2, BRD4, BRD2, BRD3RPS18CAMK2D, AGO4, RAD21, SENP3, PARD3, ERG, CUL3, CUL4A, CUL4B, CUL2, CDK2, CUL1, COPS5, CAND1, RPS4X, APP, RPS15, MRPL3, MRPL2, TCIRG1, MRPL22, MRPL51, DNAJA3, MRPL43, ATP6V1D, LAMTOR3, MRPL4, ICT1, MRPL52, MRPS9, ATP6V0A1, ESR1, SMURF1, ESR2, VCAM1, FN1, CSNK2A1, NOS2, UBL4A, ITGA4, PAN2, CD81, IGSF8, ICAM1, TARDBP, EIF3A, EIF3E, RPSA, LARP1, RPS10, RPS12, RPS13, RPS14, RPS15A, RPS16, EIF3CL, EIF3D, EIF3L, FAU, GNB2L1, RPL28, RPS19, RPS2, RPS20, RPS23, RPS24, RPS29, RPS21, RPS25, RPS26, RPS27, RPS28, RPS3A, RPS3, RPS5, RPS6, RPS7, RPS8, RPS9, TSR1, WIBG, CEP250, CEP57, TUBG1, TUBGCP3, TP53, HUWE1, PHF6, CUL7, CCDC8, WDR76, RPS6KB2, MRPL24, MRPS10, RPL10A, RPL26, RPL26L1, RPL3, RPL31, RPL35, RPL3L, RPS11, ATP1B2, KRR1, RPL10, RPL11, RPL12, RPL13, RPL13A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21, RPL22, RPL23, RPL23A, RPL24, RPL27, RPL27A, RPL30, RPL34, RPL35A, RPL36, RPL37A, RPL38, RPL39, RPL4, RPL5, RPL6, RPL7, RPL7A, RPL8, RPL9, RPLP0, RPLP1, RPLP2, LOC101929876, SFN, BTRC, XPO1, HIST1H3E, AHSA1, HNRNPU, NPM1, TRIM29, MCM2, MCM5, CCNB1, RRS1, H2AFX, NCL, CYLD, HEY1, BRCA1, MTF1, HDAC6


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for ERG_RPS18


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
TgeneRPS18P62269DB11638Artenimol40S ribosomal protein S18small moleculeapproved|investigational

Top

RelatedDiseases for ERG_RPS18


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneERGC0033578Prostatic Neoplasms5CTD_human
HgeneERGC0023418leukemia1CTD_human
HgeneERGC0023467Leukemia, Myelocytic, Acute1CTD_human
HgeneERGC1961102Precursor Cell Lymphoblastic Leukemia Lymphoma1CTD_human