FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 1020

FusionGeneSummary for AFF3_SAP130

check button Fusion gene summary
Fusion gene informationFusion gene name: AFF3_SAP130
Fusion gene ID: 1020
HgeneTgene
Gene symbol

AFF3

SAP130

Gene ID

3899

79595

Gene nameAF4/FMR2 family member 3Sin3A associated protein 130
SynonymsLAF4|MLLT2-like-
Cytomap

2q11.2

2q14.3

Type of geneprotein-codingprotein-coding
DescriptionAF4/FMR2 family member 3MLLT2-related proteinlymphoid nuclear protein 4lymphoid nuclear protein related to AF4protein LAF-4histone deacetylase complex subunit SAP130130 kDa Sin3-associated polypeptideSin3-associated polypeptide p130Sin3A associated protein 130kDa
Modification date2018052320180523
UniProtAcc

P51826

Q9H0E3

Ensembl transtripts involved in fusion geneENST00000409236, ENST00000356421, 
ENST00000317233, ENST00000409579, 
ENST00000483600, 
ENST00000357702, 
ENST00000259235, ENST00000259234, 
Fusion gene scores* DoF score12 X 9 X 5=5405 X 5 X 2=50
# samples 125
** MAII scorelog2(12/540*10)=-2.16992500144231
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(5/50*10)=0
Context

PubMed: AFF3 [Title/Abstract] AND SAP130 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DA775410AFF3chr2

100720862

-SAP130chr2

128770729

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000409236ENST00000357702AFF3chr2

100720862

-SAP130chr2

128770729

-
Frame-shitENST00000409236ENST00000259235AFF3chr2

100720862

-SAP130chr2

128770729

-
Frame-shitENST00000409236ENST00000259234AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000356421ENST00000357702AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000356421ENST00000259235AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000356421ENST00000259234AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000317233ENST00000357702AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000317233ENST00000259235AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000317233ENST00000259234AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000409579ENST00000357702AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000409579ENST00000259235AFF3chr2

100720862

-SAP130chr2

128770729

-
In-frameENST00000409579ENST00000259234AFF3chr2

100720862

-SAP130chr2

128770729

-
intron-3CDSENST00000483600ENST00000357702AFF3chr2

100720862

-SAP130chr2

128770729

-
intron-3CDSENST00000483600ENST00000259235AFF3chr2

100720862

-SAP130chr2

128770729

-
intron-3CDSENST00000483600ENST00000259234AFF3chr2

100720862

-SAP130chr2

128770729

-

Top

FusionProtFeatures for AFF3_SAP130


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
AFF3

P51826

SAP130

Q9H0E3

Acts as a transcriptional repressor. May function in theassembly and/or enzymatic activity of the mSin3A corepressorcomplex or in mediating interactions between the complex and otherregulatory complexes. {ECO:0000269|PubMed:12724404}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for AFF3_SAP130


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_AFF3_ENST00000356421_chr2_100720862_-_SAP130_ENST00000357702_chr2_128770729_-_3541nt
CTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCG
GCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGG
GACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAA
TGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCC
TGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAG
GCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACT
ACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGC
AGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTAC
CATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCA
GATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAA
TCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATA
CCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGC
CATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACA
TATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGG
CACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAA
GACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGT
GGTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCAC
AGATGGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACGTC
TGGGTCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATC
CAATCAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAG
TCCCCCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACC
TCCATCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGA
TATCATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCC
TACAAGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGA
GACAAACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGA
TGAGGAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCA
CCACTTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCG
TGCTCAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCT
GCAGGAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTG
TAAACTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAA
GAACGGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAA
GAATGATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAG
CAGAGGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTT
AAACCTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGC
CTTCCGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTA
TCTCTCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCA
GTGCCACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCA
AGTGAAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGA
TCCTTGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTA

>In-frame_AFF3_ENST00000356421_chr2_100720862_-_SAP130_ENST00000259235_chr2_128770729_-_3435nt
CTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCG
GCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGG
GACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAA
TGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCC
TGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAG
GCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACT
ACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGC
AGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTAC
CATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCA
GATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAA
TCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATA
CCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGC
CATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACA
TATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGG
CACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAA
GACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGT
GGTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCAC
AGATGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCCAATCAAAATAATGA
TCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGTCCCCCGTCACAACC
AGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCTCCATCAGTCACTGT
GGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGATATCATGAGGCCAGT
TTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCTACAAGTGACCTACC
ACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAGACAAACAGCACTGA
TGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGATGAGGAAGGTGTGAG
ATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCACCACTTTCAGAGGTA
CAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGTGCTCAAGGCTGGAA
AGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTGCAGGAAGGGATTAT
CCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGTAAACTTGTGATGGA
TCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAGAACGGGACTGTCAA
AAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAGAATGATGGTGGGGG
TGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGCAGAGGAACCCATGA
CATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTAAACCTGATCTGTGT
CATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCCTTCCGGTTTATAGA
CTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTATCTCTCTACACTGAA
AATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAGTGCCACGGCACCAA
GCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAAGTGAAATTGTTATA
TCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGATCCTTGTTCTGAAGT
ACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAATAAAGGACTCAAAG

>In-frame_AFF3_ENST00000356421_chr2_100720862_-_SAP130_ENST00000259234_chr2_128770729_-_3531nt
CTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCG
GCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGG
GACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAA
TGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCC
TGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAG
GCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACT
ACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGC
AGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTAC
CATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCA
GATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAA
TCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATA
CCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGC
CATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACA
TATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGG
CACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAA
GACTTCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGTGGT
GCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCACAGA
TGGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACGTCTGG
GTCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCCAA
TCAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGTCC
CCCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCTCC
ATCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGATAT
CATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCTAC
AAGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAGAC
AAACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGATGA
GGAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCACCA
CTTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGTGC
TCAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTGCA
GGAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGTAA
ACTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAGAA
CGGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAGAA
TGATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGCAG
AGGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTAAA
CCTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCCTT
CCGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTATCT
CTCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAGTG
CCACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAAGT
GAAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGATCC
TTGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAATA

>In-frame_AFF3_ENST00000317233_chr2_100720862_-_SAP130_ENST00000357702_chr2_128770729_-_3633nt
CGCCAGCGAGAAGAGAGCTCCACGCTCAGCCTCAGAAGAAAGACGTTCAACGACTTACTGGGGAGAGAAAGAAAAGGAACGGGAGCTGAG
AGCTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGG
CGGCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAAT
GGGACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCA
AATGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCT
CCTGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGT
AGGCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACA
CTACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCT
GCAGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGT
ACCATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAG
CAGATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCC
AATCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCA
TACCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCT
GCCATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGA
CATATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTT
GGCACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGA
AAGACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACC
GTGGTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCC
ACAGATGGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACG
TCTGGGTCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTA
TCCAATCAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCC
AGTCCCCCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCA
CCTCCATCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATG
GATATCATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATG
CCTACAAGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATG
GAGACAAACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATT
GATGAGGAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTAC
CACCACTTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGT
CGTGCTCAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAAC
CTGCAGGAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGG
TGTAAACTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAAC
AAGAACGGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATG
AAGAATGATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAA
AGCAGAGGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTG
TTAAACCTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCA
GCCTTCCGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGT
TATCTCTCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAG
CAGTGCCACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCC
CAAGTGAAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCA
GATCCTTGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGT

>In-frame_AFF3_ENST00000317233_chr2_100720862_-_SAP130_ENST00000259235_chr2_128770729_-_3527nt
CGCCAGCGAGAAGAGAGCTCCACGCTCAGCCTCAGAAGAAAGACGTTCAACGACTTACTGGGGAGAGAAAGAAAAGGAACGGGAGCTGAG
AGCTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGG
CGGCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAAT
GGGACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCA
AATGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCT
CCTGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGT
AGGCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACA
CTACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCT
GCAGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGT
ACCATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAG
CAGATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCC
AATCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCA
TACCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCT
GCCATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGA
CATATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTT
GGCACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGA
AAGACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACC
GTGGTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCC
ACAGATGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCCAATCAAAATAAT
GATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGTCCCCCGTCACAA
CCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCTCCATCAGTCACT
GTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGATATCATGAGGCCA
GTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCTACAAGTGACCTA
CCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAGACAAACAGCACT
GATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGATGAGGAAGGTGTG
AGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCACCACTTTCAGAGG
TACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGTGCTCAAGGCTGG
AAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTGCAGGAAGGGATT
ATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGTAAACTTGTGATG
GATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAGAACGGGACTGTC
AAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAGAATGATGGTGGG
GGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGCAGAGGAACCCAT
GACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTAAACCTGATCTGT
GTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCCTTCCGGTTTATA
GACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTATCTCTCTACACTG
AAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAGTGCCACGGCACC
AAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAAGTGAAATTGTTA
TATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGATCCTTGTTCTGAA
GTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAATAAAGGACTCAA

>In-frame_AFF3_ENST00000317233_chr2_100720862_-_SAP130_ENST00000259234_chr2_128770729_-_3623nt
CGCCAGCGAGAAGAGAGCTCCACGCTCAGCCTCAGAAGAAAGACGTTCAACGACTTACTGGGGAGAGAAAGAAAAGGAACGGGAGCTGAG
AGCTGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGG
CGGCCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAAT
GGGACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCA
AATGCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCT
CCTGCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGT
AGGCCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACA
CTACCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCT
GCAGCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGT
ACCATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAG
CAGATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCC
AATCCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCA
TACCCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCT
GCCATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGA
CATATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTT
GGCACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGA
AAGACTTCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGTG
GTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCACA
GATGGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACGTCT
GGGTCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCC
AATCAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGT
CCCCCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCT
CCATCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGAT
ATCATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCT
ACAAGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAG
ACAAACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGAT
GAGGAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCAC
CACTTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGT
GCTCAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTG
CAGGAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGT
AAACTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAG
AACGGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAG
AATGATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGC
AGAGGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTA
AACCTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCC
TTCCGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTAT
CTCTCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAG
TGCCACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAA
GTGAAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGAT
CCTTGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAA

>In-frame_AFF3_ENST00000409579_chr2_100720862_-_SAP130_ENST00000357702_chr2_128770729_-_3630nt
AAATCCGATCTCAAATAGGAAAGAAGTCTCATTGGCCTTTTGGTCTTCTACCTGTGTCCTGAATTGAGTTTGTTAATCCTCATTCGGAGC
TGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCGG
CCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGGG
ACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAAT
GCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCCT
GCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAGG
CCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACTA
CCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGCA
GCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTACC
ATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCAG
ATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAAT
CCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATAC
CCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGCC
ATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACAT
ATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGGC
ACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAAG
ACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGTG
GTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCACA
GATGGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACGTCT
GGGTCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCC
AATCAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGT
CCCCCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCT
CCATCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGAT
ATCATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCT
ACAAGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAG
ACAAACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGAT
GAGGAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCAC
CACTTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGT
GCTCAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTG
CAGGAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGT
AAACTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAG
AACGGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAG
AATGATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGC
AGAGGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTA
AACCTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCC
TTCCGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTAT
CTCTCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAG
TGCCACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAA
GTGAAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGAT
CCTTGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAA

>In-frame_AFF3_ENST00000409579_chr2_100720862_-_SAP130_ENST00000259235_chr2_128770729_-_3524nt
AAATCCGATCTCAAATAGGAAAGAAGTCTCATTGGCCTTTTGGTCTTCTACCTGTGTCCTGAATTGAGTTTGTTAATCCTCATTCGGAGC
TGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCGG
CCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGGG
ACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAAT
GCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCCT
GCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAGG
CCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACTA
CCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGCA
GCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTACC
ATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCAG
ATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAAT
CCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATAC
CCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGCC
ATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACAT
ATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGGC
ACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAAG
ACTTCAGCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGTG
GTGCAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCACA
GATGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCCAATCAAAATAATGAT
CAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGTCCCCCGTCACAACCA
GCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCTCCATCAGTCACTGTG
GGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGATATCATGAGGCCAGTT
TCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCTACAAGTGACCTACCA
CCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAGACAAACAGCACTGAT
GATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGATGAGGAAGGTGTGAGA
TATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCACCACTTTCAGAGGTAC
AGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGTGCTCAAGGCTGGAAA
GTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTGCAGGAAGGGATTATC
CCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGTAAACTTGTGATGGAT
CAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAGAACGGGACTGTCAAA
AAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAGAATGATGGTGGGGGT
GGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGCAGAGGAACCCATGAC
ATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTAAACCTGATCTGTGTC
ATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCCTTCCGGTTTATAGAC
TGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTATCTCTCTACACTGAAA
ATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAGTGCCACGGCACCAAG
CGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAAGTGAAATTGTTATAT
CGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGATCCTTGTTCTGAAGTA
CATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAATAAAGGACTCAAAGA

>In-frame_AFF3_ENST00000409579_chr2_100720862_-_SAP130_ENST00000259234_chr2_128770729_-_3620nt
AAATCCGATCTCAAATAGGAAAGAAGTCTCATTGGCCTTTTGGTCTTCTACCTGTGTCCTGAATTGAGTTTGTTAATCCTCATTCGGAGC
TGATCACCTGCCTTTCCAGACCGGAGACGGGCGGCAAGTTTGAAGTCGACACCCAGAGGCCAGTTTGTCCCCCTTCCCGCGCGCGGGCGG
CCCGAGCCTCGGCGGCGGCGGTAGCGGCGGCGGCGACGCTGACACCTCCCACCATGGACAGCTTCGACTTAGCCCTGCTCCAGGAATGGG
ACCTCGAGTCACTGTGGTGCAGCTGCTGCTGCTGTGATGTCCAGTTCTAAAGTAACCACAGTCCTGAGGCCGACCTCACAGCTGCCAAAT
GCTGCTACTGCTCAGCCAGCAGTACAGCACATCATTCACCAACCAATCCAGTCTCGGCCACCTGTGACCACCTCCAATGCCATCCCTCCT
GCTGTGGTAGCAACTGTCTCAGCCACCAGAGCTCAGTCTCCAGTCATCACTACGACAGCGGCGCATGCTACTGATTCAGCACTTAGTAGG
CCAACCTTGTCTATCCAGCATCCTCCATCTGCAGCAATCAGTATTCAGCGTCCTGCCCAGTCACGAGATGTCACAACAAGAATCACACTA
CCATCTCACCCTGCATTAGGGACGCCAAAACAGCAGCTTCATACAATGGCTCAGAAAACAATCTTCAGTACTGGCACGCCAGTGGCTGCA
GCCACAGTAGCACCTATTTTGGCAACCAACACCATTCCTTCAGCGACCACAGCTGGATCTGTGTCACACACGCAAGCTCCCACAAGTACC
ATTGTTACCATGACAGTACCCTCCCATTCCTCCCATGCTACTGCTGTGACCACCTCAAACATCCCAGTCGCCAAGGTGGTGCCCCAGCAG
ATCACGCACACTTCTCCTCGGATCCAGCCAGACTACCCTGCCGAGAGGAGTAGCCTGATTCCCATCTCCGGACATCGGGCCTCTCCCAAT
CCTGTGGCCATGGAAACCCGAAGTGACAACAGACCGTCTGTTCCCGTTCAGTTCCAATATTTTTTGCCAACTTACCCCCCTTCTGCATAC
CCACTGGCGGCACATACCTACACCCCAATCACCAGTTCCGTGTCCACTATCCGACAGTATCCAGTTTCAGCTCAGGCTCCAAACTCTGCC
ATCACAGCTCAGACTGGTGTTGGGGTAGCGTCTACCGTCCACCTAAACCCCATGCAGTTGATGACAGTGGATGCATCGCATGCTCGACAT
ATTCAAGGGATCCAGCCAGCACCCATCAGTACCCAGGGTATCCAGCCGGCCCCCATTGGGACCCCAGGGATACAGCCTGCACCACTTGGC
ACACAGGGAATTCACTCAGCAACCCCAATCAACACACAAGGGCTTCAGCCTGCACCTATGGGTACTCAGCAGCCTCAGCCTGAAGGAAAG
ACTTCAGTGGTGTTGGCAGATGGAGCCACAATTGTGGCCAACCCTATTAGCAATCCATTCAGTGCTGCTCCAGCAGCAACAACCGTGGTG
CAGACCCACAGCCAGAGTGCTAGCACCAACGCTCCCGCCCAGGGCTCATCGCCACGGCCAAGCATACTCCGGAAGAAACCTGCCACAGAT
GGAATGGCAGTTCGGAAAACCCTCATTCCTCCTCAGCCTCCTGATGTTGCTAGTCCTCGAGTGGAAAGCTCTATGCGGAGTACGTCTGGG
TCACCTAGGCCTGCAGGTGCCAAACCCAAGTCTGAAATCCACGTGTCTATGGCCACTCCGGTCACTGTGTCCATGGAGACTGTATCCAAT
CAAAATAATGATCAGCCTACCATTGCCGTCCCTCCAACTGCCCAGCAGCCCCCACCGACCATTCCAACTATGATTGCAGCAGCCAGTCCC
CCGTCACAACCAGCCGTTGCCCTTTCAACCATTCCTGGAGCGGTCCCCATCACTCCACCCATCACCACCATTGCAGCTGCACCACCTCCA
TCAGTCACTGTGGGTGGCAGTCTTTCCTCCGTCTTGGGCCCTCCCGTTCCTGAAATTAAAGTGAAAGAAGAAGTAGAACCAATGGATATC
ATGAGGCCAGTTTCTGCAGTTCCTCCACTGGCTACCAACACTGTGTCTCCATCTCTTGCATTGCTGGCAAACAACTTGTCCATGCCTACA
AGTGACCTACCACCTGGTGCCTCCCCAAGGAAAAAGCCTCGAAAGCAACAGCATGTGATCTCAACAGAAGAAGGTGACATGATGGAGACA
AACAGCACTGATGATGAGAAGTCCACTGCCAAGAGTCTTCTGGTGAAGGCTGAGAAGCGCAAGTCTCCTCCCAAGGAGTATATTGATGAG
GAAGGTGTGAGATATGTCCCAGTGCGTCCAAGACCCCCCATTACTTTGCTTCGTCACTATCGGAACCCCTGGAAAGCTGCTTACCACCAC
TTTCAGAGGTACAGTGACGTCCGGGTCAAAGAGGAGAAGAAAGCTATGCTGCAGGAAATAGCTAATCAGAAAGGAGTATCCTGTCGTGCT
CAAGGCTGGAAAGTCCACCTCTGTGCTGCCCAGTTACTACAGCTGACGAATCTAGAACATGATGTCTATGAAAGACTTACTAACCTGCAG
GAAGGGATTATCCCAAAGAAAAAAGCAGCAACAGATGATGATCTCCACCGAATAAACGAACTGATACAGGGAAATATGCAGAGGTGTAAA
CTTGTGATGGATCAAATCAGTGAAGCCAGAGACTCCATGCTTAAGGTTTTAGATCATAAAGACCGTGTCCTGAAGCTGCTTAACAAGAAC
GGGACTGTCAAAAAAGTGTCCAAATTGAAGCGAAAGGAAAAAGTCTAGACCCAGAACAATCAGGAGATTGGAAGCAAATTTATGAAGAAT
GATGGTGGGGGTGGGGGGAGGGTTTTGGTTTTTTCCAAAGTGGAACATTGAAATAAAGGAAGTGTTCCTTAGTTCCCGTGTGAAAGCAGA
GGAACCCATGACATCCAAGGGCGTGAAAGGATCAGAGCTGACTGGACATAGTGAGCTGCCTTCTTGCGTTCGGGTGCACCCCTGTTAAAC
CTGATCTGTGTCATAAGTGACTCCGGATGCATCAGTGTCCACCAGTTGGAAGCAATGACAAGGATGGCTGGCTGGTGTTTTTCAGCCTTC
CGGTTTATAGACTGTATTTATCTAGTGGATTCCTGCAGGCCCCATACTGAGCCTGGACTGAAAGTATCCACTCGGACCATCTGTTATCTC
TCTACACTGAAAATAAAACCTCTTCCACCCACCCCATTCGGTTCTTCTGCCTGACCTTCAAATGCCCATGTTGGCCTTTTACAGCAGTGC
CACGGCACCAAGCGAGCTGCCACATCTCACACTCTAAAGGGTTTGAACTATTAGTTCTTGTCATTTTTTAAAAAAAACCATTCCCAAGTG
AAATTGTTATATCGTCTGTCTTGCGTGTGTCAGAACTGGGTTTTTGTGGAGGTTCAGAGCAGGCAACACCATAAGTTGCTCTCAGATCCT
TGTTCTGAAGTACATTCTTGGTTATCTGTACTTCTGTAGCTGGTGTGATGCTGTTAATTGTATGTACCACACATCTCCAGACGTTAATAA


Top

FusionGenePPI for AFF3_SAP130


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
AFF3MLLT3, CDK9, PIP4K2ASAP130SIN3A, HDAC1, HDAC2, SUDS3, ARID4B, MYC, COPS5, CUL2, SF3B1, CUL1, CUL4A, VHL, TCEB2, ING2, SAP25, PML, RARA, H3F3A, TAF10, EMD, TAF3, TFAP4, SUPT3H, SMAD3, SOX2, DDB1, CUL4B, MXD1, RBBP7, GPS1, DYNLT1, SYN1, SAP30, KIF20A, TPX2, SIN3B, MAX, FOXK1, FOXK2, NANOG, GATAD1, FAM60A, ZNF704, MXD3, PHF23, PRDM5


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for AFF3_SAP130


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for AFF3_SAP130


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneAFF3C0003873Rheumatoid Arthritis2CTD_human
HgeneAFF3C0236969Substance-Related Disorders1CTD_human