|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RPL23 |
 Gene summary |
| Gene information | Gene symbol | RPL23 | Gene ID | 9349 |
| Gene name | ribosomal protein L23 | |
| Synonyms | L23|rpL17 | |
| Cytomap | 17q12 | |
| Type of gene | protein-coding | |
| Description | 60S ribosomal protein L2360S ribosomal protein L17large ribosomal subunit protein uL14ribosomal protein L17 | |
| Modification date | 20180523 | |
| UniProtAcc | P62829 | |
| Context | PubMed: RPL23 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| RPL23 | GO:0032986 | protein-DNA complex disassembly | 19160485 |
| RPL23 | GO:1904667 | negative regulation of ubiquitin protein ligase activity | 15314173 |
| RPL23 | GO:2000059 | negative regulation of ubiquitin-dependent protein catabolic process | 15314173 |
Top |
Exon skipping events across known transcript of Ensembl for RPL23 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RPL23 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RPL23 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_288721 | 17 | 37004117:37004292:37006369:37006467:37006614:37006728 | 37006369:37006467 | ENSG00000125691.8 | ENST00000394332.1 |
| exon_skip_288729 | 17 | 37006369:37006467:37006614:37006728:37008856:37008867 | 37006614:37006728 | ENSG00000125691.8 | ENST00000479035.2,ENST00000245857.5,ENST00000394332.1 |
| exon_skip_288736 | 17 | 37006691:37006728:37008856:37008985:37009274:37009358 | 37008856:37008985 | ENSG00000125691.8 | ENST00000577407.1,ENST00000479035.2,ENST00000245857.5,ENST00000394332.1,ENST00000378096.3,ENST00000470646.1 |
| exon_skip_288743 | 17 | 37008856:37008985:37009274:37009358:37009950:37009975 | 37009274:37009358 | ENSG00000125691.8 | ENST00000577407.1,ENST00000479035.2,ENST00000394333.1,ENST00000584912.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RPL23 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_288721 | 17 | 37004117:37004292:37006369:37006467:37006614:37006728 | 37006369:37006467 | ENSG00000125691.8 | ENST00000394332.1 |
| exon_skip_288729 | 17 | 37006369:37006467:37006614:37006728:37008856:37008867 | 37006614:37006728 | ENSG00000125691.8 | ENST00000394332.1,ENST00000479035.2,ENST00000245857.5 |
| exon_skip_288736 | 17 | 37006691:37006728:37008856:37008985:37009274:37009358 | 37008856:37008985 | ENSG00000125691.8 | ENST00000394332.1,ENST00000479035.2,ENST00000245857.5,ENST00000577407.1,ENST00000470646.1,ENST00000378096.3 |
| exon_skip_288743 | 17 | 37008856:37008985:37009274:37009358:37009950:37009975 | 37009274:37009358 | ENSG00000125691.8 | ENST00000394333.1,ENST00000479035.2,ENST00000584912.1,ENST00000577407.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RPL23 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394332 | 37006369 | 37006467 | 5CDS-5UTR |
| ENST00000394332 | 37006614 | 37006728 | In-frame |
| ENST00000479035 | 37006614 | 37006728 | In-frame |
| ENST00000394332 | 37008856 | 37008985 | In-frame |
| ENST00000479035 | 37008856 | 37008985 | In-frame |
| ENST00000479035 | 37009274 | 37009358 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394332 | 37006369 | 37006467 | 5CDS-5UTR |
| ENST00000394332 | 37006614 | 37006728 | In-frame |
| ENST00000479035 | 37006614 | 37006728 | In-frame |
| ENST00000394332 | 37008856 | 37008985 | In-frame |
| ENST00000479035 | 37008856 | 37008985 | In-frame |
| ENST00000479035 | 37009274 | 37009358 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for RPL23 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000479035 | 2838 | 140 | 37009274 | 37009358 | 147 | 230 | 4 | 32 |
| ENST00000394332 | 642 | 140 | 37008856 | 37008985 | 110 | 238 | 32 | 75 |
| ENST00000479035 | 2838 | 140 | 37008856 | 37008985 | 231 | 359 | 32 | 75 |
| ENST00000394332 | 642 | 140 | 37006614 | 37006728 | 239 | 352 | 75 | 113 |
| ENST00000479035 | 2838 | 140 | 37006614 | 37006728 | 360 | 473 | 75 | 113 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000479035 | 2838 | 140 | 37009274 | 37009358 | 147 | 230 | 4 | 32 |
| ENST00000394332 | 642 | 140 | 37008856 | 37008985 | 110 | 238 | 32 | 75 |
| ENST00000479035 | 2838 | 140 | 37008856 | 37008985 | 231 | 359 | 32 | 75 |
| ENST00000394332 | 642 | 140 | 37006614 | 37006728 | 239 | 352 | 75 | 113 |
| ENST00000479035 | 2838 | 140 | 37006614 | 37006728 | 360 | 473 | 75 | 113 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P62829 | 4 | 32 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 4 | 32 | 17 | 17 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18691976;Dbxref=PMID:18691976 |
| P62829 | 32 | 75 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 32 | 75 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 32 | 75 | 38 | 38 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:15592455;Dbxref=PMID:15592455 |
| P62829 | 32 | 75 | 38 | 38 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:15592455;Dbxref=PMID:15592455 |
| P62829 | 75 | 113 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 75 | 113 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 75 | 113 | 77 | 77 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P62829 | 75 | 113 | 77 | 77 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P62829 | 4 | 32 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 4 | 32 | 17 | 17 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:18691976;Dbxref=PMID:18691976 |
| P62829 | 32 | 75 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 32 | 75 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 32 | 75 | 38 | 38 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:15592455;Dbxref=PMID:15592455 |
| P62829 | 32 | 75 | 38 | 38 | Modified residue | Note=Phosphotyrosine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:15592455;Dbxref=PMID:15592455 |
| P62829 | 75 | 113 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 75 | 113 | 1 | 140 | Chain | ID=PRO_0000128612;Note=60S ribosomal protein L23 |
| P62829 | 75 | 113 | 77 | 77 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| P62829 | 75 | 113 | 77 | 77 | Sequence conflict | Note=H->R;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for RPL23 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_288736 | 37008857 | 37008985 | 37008859 | 37008859 | Frame_Shift_Del | T | - | p.K75fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_288736 | 37008857 | 37008985 | 37008859 | 37008859 | Frame_Shift_Del | T | - | p.K75fs |
| BLCA | TCGA-BT-A42C-01 | exon_skip_288736 | 37008857 | 37008985 | 37008873 | 37008892 | Frame_Shift_Del | TGGTTTGCCTTTCTTGACTG | - | p.T64fs |
| BLCA | TCGA-BT-A42C-01 | exon_skip_288736 | 37008857 | 37008985 | 37008873 | 37008892 | Frame_Shift_Del | TGGTTTGCCTTTCTTGACTG | - | p.TVKKGKP64fs |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| CCRFCEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 37008857 | 37008985 | 37008975 | 37008976 | Frame_Shift_Ins | - | T | p.N36fs |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 37006370 | 37006467 | 37006431 | 37006431 | Missense_Mutation | G | A | p.A126V |
| BT483_BREAST | 37006615 | 37006728 | 37006701 | 37006701 | Missense_Mutation | C | T | p.R85Q |
| NCIH2110_LUNG | 37008857 | 37008985 | 37008925 | 37008925 | Missense_Mutation | G | A | p.P53L |
| BHY_UPPER_AERODIGESTIVE_TRACT | 37009275 | 37009358 | 37009289 | 37009289 | Missense_Mutation | C | A | p.C28F |
| HCC95_LUNG | 37006615 | 37006728 | 37006708 | 37006708 | Nonsense_Mutation | G | A | p.R83* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RPL23 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RPL23 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RPL23 |
Top |
RelatedDrugs for RPL23 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RPL23 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|