|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for KLF4 |
 Gene summary |
| Gene information | Gene symbol | KLF4 | Gene ID | 9314 |
| Gene name | Kruppel like factor 4 | |
| Synonyms | EZF|GKLF | |
| Cytomap | 9q31.2 | |
| Type of gene | protein-coding | |
| Description | Krueppel-like factor 4Kruppel-like factor 4 (gut)endothelial Kruppel-like zinc finger proteinepithelial zinc finger protein EZFgut Kruppel-like factorgut-enriched krueppel-like factor | |
| Modification date | 20180527 | |
| UniProtAcc | O43474 | |
| Context | PubMed: KLF4 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| KLF4 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 20551324 |
| KLF4 | GO:0016525 | negative regulation of angiogenesis | 23867820 |
| KLF4 | GO:0032088 | negative regulation of NF-kappaB transcription factor activity | 20551324 |
| KLF4 | GO:0034115 | negative regulation of heterotypic cell-cell adhesion | 20551324 |
| KLF4 | GO:0043154 | negative regulation of cysteine-type endopeptidase activity involved in apoptotic process | 20551324 |
| KLF4 | GO:0045415 | negative regulation of interleukin-8 biosynthetic process | 20551324 |
| KLF4 | GO:0045892 | negative regulation of transcription, DNA-templated | 9422764 |
| KLF4 | GO:0045893 | positive regulation of transcription, DNA-templated | 27431648 |
| KLF4 | GO:0051973 | positive regulation of telomerase activity | 20629177 |
| KLF4 | GO:0060761 | negative regulation of response to cytokine stimulus | 20551324 |
| KLF4 | GO:0061614 | pri-miRNA transcription by RNA polymerase II | 23867820 |
| KLF4 | GO:0071363 | cellular response to growth factor stimulus | 20551324 |
| KLF4 | GO:0090051 | negative regulation of cell migration involved in sprouting angiogenesis | 20551324 |
| KLF4 | GO:2000134 | negative regulation of G1/S transition of mitotic cell cycle | 23867820 |
| KLF4 | GO:2000342 | negative regulation of chemokine (C-X-C motif) ligand 2 production | 20551324 |
Top |
Exon skipping events across known transcript of Ensembl for KLF4 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for KLF4 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for KLF4 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_505486 | 9 | 110249308:110249473:110249575:110250548:110251210:110251327 | 110249575:110250548 | ENSG00000136826.10 | ENST00000374672.4 |
| exon_skip_505488 | 9 | 110249949:110250548:110251210:110251331:110251448:110251718 | 110251210:110251331 | ENSG00000136826.10 | ENST00000493306.1,ENST00000374672.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for KLF4 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_505486 | 9 | 110249308:110249473:110249575:110250548:110251210:110251327 | 110249575:110250548 | ENSG00000136826.10 | ENST00000374672.4 |
| exon_skip_505488 | 9 | 110249949:110250548:110251210:110251331:110251448:110251718 | 110251210:110251331 | ENSG00000136826.10 | ENST00000493306.1,ENST00000374672.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for KLF4 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000374672 | 110249575 | 110250548 | Frame-shift |
| ENST00000374672 | 110251210 | 110251331 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000374672 | 110249575 | 110250548 | Frame-shift |
| ENST00000374672 | 110251210 | 110251331 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for KLF4 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for KLF4 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_505486 | 110249576 | 110250548 | 110250354 | 110250354 | Frame_Shift_Del | A | - | p.F107fs |
| ACC | TCGA-OR-A5L4-01 | exon_skip_505488 | 110251211 | 110251331 | 110251263 | 110251293 | Frame_Shift_Del | GACGCGAACGTGGAGAAAGATGGGAGCAGCG | - | p.15_25del |
| ACC | TCGA-OR-A5L4-01 | exon_skip_505488 | 110251211 | 110251331 | 110251263 | 110251293 | Frame_Shift_Del | GACGCGAACGTGGAGAAAGATGGGAGCAGCG | - | p.ALLPSFSTFAS15fs |
| PAAD | TCGA-FB-A545-01 | exon_skip_505486 | 110249576 | 110250548 | 110249719 | 110249720 | Frame_Shift_Ins | - | G | p.G319fs |
| PAAD | TCGA-FB-A545-01 | exon_skip_505486 | 110249576 | 110250548 | 110249719 | 110249720 | Frame_Shift_Ins | - | G | p.L319fs |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HCT116_LARGE_INTESTINE | 110249576 | 110250548 | 110249635 | 110249635 | Missense_Mutation | T | C | p.N347S |
| DU145_PROSTATE | 110249576 | 110250548 | 110249740 | 110249740 | Missense_Mutation | G | T | p.P312H |
| CPCN_LUNG | 110249576 | 110250548 | 110249788 | 110249788 | Missense_Mutation | T | C | p.N296S |
| SNUC4_LARGE_INTESTINE | 110249576 | 110250548 | 110249990 | 110249990 | Missense_Mutation | A | G | p.F229L |
| A2780_OVARY | 110249576 | 110250548 | 110250059 | 110250059 | Missense_Mutation | G | C | p.P206A |
| SNUC2A_LARGE_INTESTINE | 110249576 | 110250548 | 110250061 | 110250061 | Missense_Mutation | C | T | p.R205Q |
| LU99_LUNG | 110249576 | 110250548 | 110250098 | 110250098 | Missense_Mutation | C | A | p.V193L |
| A2058_SKIN | 110249576 | 110250548 | 110250161 | 110250161 | Missense_Mutation | G | A | p.L172F |
| HEC108_ENDOMETRIUM | 110249576 | 110250548 | 110250188 | 110250188 | Missense_Mutation | C | T | p.A163T |
| HEC6_ENDOMETRIUM | 110249576 | 110250548 | 110250313 | 110250313 | Missense_Mutation | G | A | p.A121V |
| A673_BONE | 110249576 | 110250548 | 110250334 | 110250334 | Missense_Mutation | G | A | p.T114I |
| HCC2450_LUNG | 110249576 | 110250548 | 110250386 | 110250386 | Missense_Mutation | C | G | p.E97Q |
| RERFLCAD1_LUNG | 110249576 | 110250548 | 110250443 | 110250443 | Missense_Mutation | C | T | p.G78R |
| SNGM_ENDOMETRIUM | 110249576 | 110250548 | 110250473 | 110250473 | Missense_Mutation | C | T | p.A68T |
| KYSE220_OESOPHAGUS | 110249576 | 110250548 | 110250487 | 110250487 | Missense_Mutation | T | C | p.Y63C |
| MDAPCA2B_PROSTATE | 110249576 | 110250548 | 110250493 | 110250493 | Missense_Mutation | C | T | p.R61H |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 110251211 | 110251331 | 110251218 | 110251218 | Missense_Mutation | G | A | p.P40L |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 110251211 | 110251331 | 110251230 | 110251230 | Missense_Mutation | T | G | p.Q36P |
| MFE319_ENDOMETRIUM | 110251211 | 110251331 | 110251260 | 110251260 | Missense_Mutation | C | T | p.G26D |
| CCRFCEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 110251211 | 110251331 | 110251272 | 110251272 | Missense_Mutation | G | A | p.T22M |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for KLF4 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KLF4 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KLF4 |
Top |
RelatedDrugs for KLF4 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for KLF4 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| KLF4 | C0000768 | Congenital Abnormality | 1 | CTD_human |
| KLF4 | C0018798 | Congenital Heart Defects | 1 | CTD_human |
| KLF4 | C0040053 | Thrombosis | 1 | CTD_human |
| KLF4 | C0151744 | Myocardial Ischemia | 1 | CTD_human |
| KLF4 | C3495559 | Juvenile arthritis | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|