|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for XPR1 |
 Gene summary |
| Gene information | Gene symbol | XPR1 | Gene ID | 9213 |
| Gene name | xenotropic and polytropic retrovirus receptor 1 | |
| Synonyms | IBGC6|SLC53A1|SYG1|X3 | |
| Cytomap | 1q25.3 | |
| Type of gene | protein-coding | |
| Description | xenotropic and polytropic retrovirus receptor 1X-receptorprotein SYG1 homologsolute carrier family 53 (phosphate exporter), member 1xenotropic and polytropic murine leukemia virus receptor X3 | |
| Modification date | 20180523 | |
| UniProtAcc | Q9UBH6 | |
| Context | PubMed: XPR1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for XPR1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for XPR1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for XPR1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_14526 | 1 | 180601167:180601406:180651495:180651547:180756888:180756990 | 180651495:180651547 | ENSG00000143324.9 | ENST00000367589.3 |
| exon_skip_14529 | 1 | 180651495:180651547:180756888:180756990:180772523:180772747 | 180756888:180756990 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14533 | 1 | 180756888:180756990:180772523:180772747:180775197:180775347 | 180772523:180772747 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14536 | 1 | 180780542:180780624:180793888:180794079:180794300:180794480 | 180793888:180794079 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14542 | 1 | 180794300:180794480:180804009:180804181:180805657:180805852 | 180804009:180804181 | ENSG00000143324.9 | ENST00000367590.4 |
| exon_skip_14543 | 1 | 180794300:180794480:180804009:180804181:180832843:180833010 | 180804009:180804181 | ENSG00000143324.9 | ENST00000367589.3 |
| exon_skip_14547 | 1 | 180804009:180804181:180805657:180805852:180832843:180833010 | 180805657:180805852 | ENSG00000143324.9 | ENST00000367590.4 |
| exon_skip_14548 | 1 | 180832899:180833010:180842938:180843078:180849211:180849433 | 180842938:180843078 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14551 | 1 | 180842938:180843078:180849211:180849433:180853141:180855262 | 180849211:180849433 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for XPR1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_14526 | 1 | 180601167:180601406:180651495:180651547:180756888:180756990 | 180651495:180651547 | ENSG00000143324.9 | ENST00000367589.3 |
| exon_skip_14533 | 1 | 180756888:180756990:180772523:180772747:180775197:180775347 | 180772523:180772747 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14536 | 1 | 180780542:180780624:180793888:180794079:180794300:180794480 | 180793888:180794079 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| exon_skip_14542 | 1 | 180794300:180794480:180804009:180804181:180805657:180805852 | 180804009:180804181 | ENSG00000143324.9 | ENST00000367590.4 |
| exon_skip_14543 | 1 | 180794300:180794480:180804009:180804181:180832843:180833010 | 180804009:180804181 | ENSG00000143324.9 | ENST00000367589.3 |
| exon_skip_14547 | 1 | 180804009:180804181:180805657:180805852:180832843:180833010 | 180805657:180805852 | ENSG00000143324.9 | ENST00000367590.4 |
| exon_skip_14551 | 1 | 180842938:180843078:180849211:180849433:180853141:180855262 | 180849211:180849433 | ENSG00000143324.9 | ENST00000367590.4,ENST00000367589.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for XPR1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000367590 | 180772523 | 180772747 | Frame-shift |
| ENST00000367590 | 180793888 | 180794079 | Frame-shift |
| ENST00000367590 | 180804009 | 180804181 | Frame-shift |
| ENST00000367590 | 180842938 | 180843078 | Frame-shift |
| ENST00000367590 | 180756888 | 180756990 | In-frame |
| ENST00000367590 | 180805657 | 180805852 | In-frame |
| ENST00000367590 | 180849211 | 180849433 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000367590 | 180772523 | 180772747 | Frame-shift |
| ENST00000367590 | 180793888 | 180794079 | Frame-shift |
| ENST00000367590 | 180804009 | 180804181 | Frame-shift |
| ENST00000367590 | 180805657 | 180805852 | In-frame |
| ENST00000367590 | 180849211 | 180849433 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for XPR1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000367590 | 8491 | 696 | 180756888 | 180756990 | 320 | 421 | 40 | 74 |
| ENST00000367590 | 8491 | 696 | 180805657 | 180805852 | 1505 | 1699 | 435 | 500 |
| ENST00000367590 | 8491 | 696 | 180849211 | 180849433 | 2007 | 2228 | 603 | 676 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000367590 | 8491 | 696 | 180805657 | 180805852 | 1505 | 1699 | 435 | 500 |
| ENST00000367590 | 8491 | 696 | 180849211 | 180849433 | 2007 | 2228 | 603 | 676 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9UBH6 | 40 | 74 | 1 | 696 | Chain | ID=PRO_0000315853;Note=Xenotropic and polytropic retrovirus receptor 1 |
| Q9UBH6 | 40 | 74 | 1 | 177 | Domain | Note=SPX;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00714 |
| Q9UBH6 | 40 | 74 | 44 | 98 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5IJH |
| Q9UBH6 | 40 | 74 | 1 | 236 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 435 | 500 | 437 | 501 | Alternative sequence | ID=VSP_030748;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q9UBH6 | 435 | 500 | 1 | 696 | Chain | ID=PRO_0000315853;Note=Xenotropic and polytropic retrovirus receptor 1 |
| Q9UBH6 | 435 | 500 | 439 | 643 | Domain | Note=EXS;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00712 |
| Q9UBH6 | 435 | 500 | 491 | 491 | Natural variant | ID=VAR_038350;Note=T->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9990033;Dbxref=dbSNP:rs1061012,PMID:9990033 |
| Q9UBH6 | 435 | 500 | 424 | 473 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 435 | 500 | 497 | 507 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 435 | 500 | 474 | 496 | Transmembrane | Note=Helical;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 603 | 676 | 1 | 696 | Chain | ID=PRO_0000315853;Note=Xenotropic and polytropic retrovirus receptor 1 |
| Q9UBH6 | 603 | 676 | 439 | 643 | Domain | Note=EXS;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00712 |
| Q9UBH6 | 603 | 676 | 668 | 668 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:23186163 |
| Q9UBH6 | 603 | 676 | 529 | 696 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9UBH6 | 435 | 500 | 437 | 501 | Alternative sequence | ID=VSP_030748;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q9UBH6 | 435 | 500 | 1 | 696 | Chain | ID=PRO_0000315853;Note=Xenotropic and polytropic retrovirus receptor 1 |
| Q9UBH6 | 435 | 500 | 439 | 643 | Domain | Note=EXS;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00712 |
| Q9UBH6 | 435 | 500 | 491 | 491 | Natural variant | ID=VAR_038350;Note=T->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:9990033;Dbxref=dbSNP:rs1061012,PMID:9990033 |
| Q9UBH6 | 435 | 500 | 424 | 473 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 435 | 500 | 497 | 507 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 435 | 500 | 474 | 496 | Transmembrane | Note=Helical;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q9UBH6 | 603 | 676 | 1 | 696 | Chain | ID=PRO_0000315853;Note=Xenotropic and polytropic retrovirus receptor 1 |
| Q9UBH6 | 603 | 676 | 439 | 643 | Domain | Note=EXS;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00712 |
| Q9UBH6 | 603 | 676 | 668 | 668 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18669648,ECO:0000244|PubMed:23186163;Dbxref=PMID:18669648,PMID:23186163 |
| Q9UBH6 | 603 | 676 | 529 | 696 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for XPR1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| BLCA | TCGA-CU-A0YR-01 | exon_skip_14548 | 180842939 | 180843078 | 180843056 | 180843056 | Frame_Shift_Del | T | - | p.F596fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_14548 | 180842939 | 180843078 | 180843060 | 180843060 | Frame_Shift_Del | C | - | p.A597fs |
| SKCM | TCGA-EE-A2GB-06 | exon_skip_14551 | 180849212 | 180849433 | 180849298 | 180849298 | Frame_Shift_Del | C | - | p.A632fs |
| SKCM | TCGA-EE-A3J7-06 | exon_skip_14529 | 180756889 | 180756990 | 180756945 | 180756945 | Nonsense_Mutation | C | T | p.Q60* |
| SKCM | TCGA-EE-A3J7-06 | exon_skip_14529 | 180756889 | 180756990 | 180756945 | 180756945 | Nonsense_Mutation | C | T | p.Q60X |
| PAAD | TCGA-LB-A7SX-01 | exon_skip_14536 | 180793889 | 180794079 | 180793903 | 180793903 | Nonsense_Mutation | G | T | p.E260* |
| PAAD | TCGA-LB-A7SX-01 | exon_skip_14536 | 180793889 | 180794079 | 180793903 | 180793903 | Nonsense_Mutation | G | T | p.E260X |
| THYM | TCGA-ZT-A8OM-01 | exon_skip_14551 | 180849212 | 180849433 | 180849360 | 180849360 | Nonsense_Mutation | C | T | p.R653X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 180842939 | 180843078 | 180843027 | 180843047 | In_Frame_Del | CTCATTCTGGGGACATCATTG | - | p.HSGDIIA587del |
| SNUC1_LARGE_INTESTINE | 180651496 | 180651547 | 180651505 | 180651505 | Missense_Mutation | G | T | p.D27Y |
| NUGC3_STOMACH | 180756889 | 180756990 | 180756979 | 180756979 | Missense_Mutation | C | T | p.T71I |
| C32_SKIN | 180756889 | 180756990 | 180756988 | 180756988 | Missense_Mutation | C | T | p.S74L |
| PWR1E_PROSTATE | 180772524 | 180772747 | 180772589 | 180772589 | Missense_Mutation | G | T | p.A97S |
| DU145_PROSTATE | 180772524 | 180772747 | 180772605 | 180772605 | Missense_Mutation | C | T | p.T102I |
| SNU407_LARGE_INTESTINE | 180772524 | 180772747 | 180772617 | 180772617 | Missense_Mutation | C | T | p.T106M |
| CW2_LARGE_INTESTINE | 180772524 | 180772747 | 180772628 | 180772628 | Missense_Mutation | C | T | p.R110C |
| SNU1040_LARGE_INTESTINE | 180772524 | 180772747 | 180772644 | 180772644 | Missense_Mutation | T | A | p.F115Y |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 180793889 | 180794079 | 180793916 | 180793916 | Missense_Mutation | G | C | p.S264T |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 180793889 | 180794079 | 180793916 | 180793916 | Missense_Mutation | G | C | p.S264T |
| S117_SOFT_TISSUE | 180793889 | 180794079 | 180793916 | 180793916 | Missense_Mutation | G | C | p.S264T |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 180793889 | 180794079 | 180793918 | 180793918 | Missense_Mutation | A | G | p.I265V |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 180793889 | 180794079 | 180793918 | 180793918 | Missense_Mutation | A | G | p.I265V |
| S117_SOFT_TISSUE | 180793889 | 180794079 | 180793918 | 180793918 | Missense_Mutation | A | G | p.I265V |
| C33A_CERVIX | 180793889 | 180794079 | 180793943 | 180793943 | Missense_Mutation | G | A | p.R273Q |
| BC3C_URINARY_TRACT | 180793889 | 180794079 | 180793997 | 180793997 | Missense_Mutation | G | A | p.G291D |
| SNU1040_LARGE_INTESTINE | 180793889 | 180794079 | 180794023 | 180794023 | Missense_Mutation | G | A | p.V300I |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 180793889 | 180794079 | 180794051 | 180794051 | Missense_Mutation | G | A | p.S309N |
| EW7_BONE | 180793889 | 180794079 | 180794058 | 180794058 | Missense_Mutation | G | T | p.L311F |
| NCIH650_LUNG | 180804010 | 180804181 | 180804043 | 180804043 | Missense_Mutation | G | T | p.G390C |
| YD38_UPPER_AERODIGESTIVE_TRACT | 180804010 | 180804181 | 180804077 | 180804077 | Missense_Mutation | A | G | p.N401S |
| NCIH1184_LUNG | 180804010 | 180804181 | 180804119 | 180804119 | Missense_Mutation | G | T | p.C415F |
| HCC15_LUNG | 180804010 | 180804181 | 180804143 | 180804143 | Missense_Mutation | G | C | p.W423S |
| EW1_BONE | 180805658 | 180805852 | 180805666 | 180805666 | Missense_Mutation | A | G | p.I439V |
| OUMS23_LARGE_INTESTINE | 180842939 | 180843078 | 180843003 | 180843003 | Missense_Mutation | C | T | p.S578L |
| MDAPCA2B_PROSTATE | 180849212 | 180849433 | 180849214 | 180849214 | Missense_Mutation | G | A | p.R604Q |
| NCIH2286_LUNG | 180849212 | 180849433 | 180849279 | 180849279 | Missense_Mutation | G | T | p.V626L |
| SARC9371_BONE | 180849212 | 180849433 | 180849292 | 180849292 | Missense_Mutation | C | T | p.S630F |
| MDAMB453_BREAST | 180849212 | 180849433 | 180849348 | 180849348 | Missense_Mutation | G | A | p.D649N |
| HEC1A_ENDOMETRIUM | 180849212 | 180849433 | 180849387 | 180849387 | Missense_Mutation | A | G | p.K662E |
| KMS18_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 180756889 | 180756990 | 180756930 | 180756930 | Nonsense_Mutation | G | T | p.E55* |
| SNU1040_LARGE_INTESTINE | 180842939 | 180843078 | 180843077 | 180843077 | Splice_Site | C | T | p.R603W |
| SNU1040_LARGE_INTESTINE | 180849212 | 180849433 | 180849213 | 180849213 | Splice_Site | C | T | p.R604* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for XPR1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for XPR1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for XPR1 |
Top |
RelatedDrugs for XPR1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for XPR1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| XPR1 | C0004782 | Basal Ganglia Diseases | 1 | CTD_human |
| XPR1 | C0006663 | Calcinosis | 1 | CTD_human |
| XPR1 | C4225335 | BASAL GANGLIA CALCIFICATION, IDIOPATHIC, 6 | 1 | UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|