|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for SNX29 |
 Gene summary |
| Gene information | Gene symbol | SNX29 | Gene ID | 92017 |
| Gene name | sorting nexin 29 | |
| Synonyms | A-388D4.1|RUNDC2A | |
| Cytomap | 16p13.13-p13.12 | |
| Type of gene | protein-coding | |
| Description | sorting nexin-29RUN domain containing 2ARUN domain-containing protein 2A | |
| Modification date | 20180519 | |
| UniProtAcc | Q8TEQ0 | |
| Context | PubMed: SNX29 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for SNX29 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for SNX29 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for SNX29 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_133466 | 16 | 12070601:12070670:12093153:12093215:12096847:12096900 | 12093153:12093215 | ENSG00000048471.9 | ENST00000564111.1,ENST00000566228.1 |
| exon_skip_133469 | 16 | 12093153:12093215:12096847:12096900:12121176:12121301 | 12096847:12096900 | ENSG00000048471.9 | ENST00000564111.1,ENST00000566228.1,ENST00000569801.1 |
| exon_skip_133470 | 16 | 12096847:12096900:12121176:12121301:12136753:12136854 | 12121176:12121301 | ENSG00000048471.9 | ENST00000564111.1,ENST00000566228.1 |
| exon_skip_133471 | 16 | 12121176:12121301:12123469:12123591:12136753:12136854 | 12123469:12123591 | ENSG00000048471.9 | ENST00000569801.1 |
| exon_skip_133472 | 16 | 12121176:12121301:12136753:12136934:12140240:12140311 | 12136753:12136934 | ENSG00000048471.9 | ENST00000564111.1,ENST00000566228.1 |
| exon_skip_133475 | 16 | 12146054:12146079:12155384:12155503:12162913:12162983 | 12155384:12155503 | ENSG00000048471.9 | ENST00000306030.3,ENST00000563308.1,ENST00000566228.1,ENST00000323433.4 |
| exon_skip_133478 | 16 | 12223553:12223615:12293457:12293540:12371789:12371893 | 12293457:12293540 | ENSG00000048471.9 | ENST00000306030.3,ENST00000564791.1,ENST00000566228.1,ENST00000323433.4 |
| exon_skip_133479 | 16 | 12371789:12371893:12450019:12450136:12492302:12492358 | 12450019:12450136 | ENSG00000048471.9 | ENST00000306030.3,ENST00000564791.1,ENST00000566228.1,ENST00000323433.4 |
| exon_skip_133481 | 16 | 12450109:12450136:12492302:12492358:12497304:12497386 | 12492302:12492358 | ENSG00000048471.9 | ENST00000562510.1,ENST00000306030.3,ENST00000564791.1,ENST00000566228.1,ENST00000323433.4 |
| exon_skip_133482 | 16 | 12497304:12497386:12571575:12571716:12618558:12618698 | 12571575:12571716 | ENSG00000048471.9 | ENST00000306030.3,ENST00000564791.1,ENST00000566228.1,ENST00000323433.4 |
| exon_skip_133483 | 16 | 12571575:12571716:12618558:12618698:12662362:12668145 | 12618558:12618698 | ENSG00000048471.9 | ENST00000306030.3,ENST00000566228.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for SNX29 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_133466 | 16 | 12070601:12070670:12093153:12093215:12096847:12096900 | 12093153:12093215 | ENSG00000048471.9 | ENST00000566228.1,ENST00000564111.1 |
| exon_skip_133469 | 16 | 12093153:12093215:12096847:12096900:12121176:12121301 | 12096847:12096900 | ENSG00000048471.9 | ENST00000569801.1,ENST00000566228.1,ENST00000564111.1 |
| exon_skip_133470 | 16 | 12096847:12096900:12121176:12121301:12136753:12136854 | 12121176:12121301 | ENSG00000048471.9 | ENST00000566228.1,ENST00000564111.1 |
| exon_skip_133471 | 16 | 12121176:12121301:12123469:12123591:12136753:12136854 | 12123469:12123591 | ENSG00000048471.9 | ENST00000569801.1 |
| exon_skip_133472 | 16 | 12121176:12121301:12136753:12136934:12140240:12140311 | 12136753:12136934 | ENSG00000048471.9 | ENST00000566228.1,ENST00000564111.1 |
| exon_skip_133475 | 16 | 12146054:12146079:12155384:12155503:12162913:12162983 | 12155384:12155503 | ENSG00000048471.9 | ENST00000566228.1,ENST00000563308.1,ENST00000306030.3,ENST00000323433.4 |
| exon_skip_133478 | 16 | 12223553:12223615:12293457:12293540:12371789:12371893 | 12293457:12293540 | ENSG00000048471.9 | ENST00000566228.1,ENST00000306030.3,ENST00000323433.4,ENST00000564791.1 |
| exon_skip_133479 | 16 | 12371789:12371893:12450019:12450136:12492302:12492358 | 12450019:12450136 | ENSG00000048471.9 | ENST00000566228.1,ENST00000306030.3,ENST00000323433.4,ENST00000564791.1 |
| exon_skip_133481 | 16 | 12450109:12450136:12492302:12492358:12497304:12497386 | 12492302:12492358 | ENSG00000048471.9 | ENST00000566228.1,ENST00000306030.3,ENST00000323433.4,ENST00000564791.1,ENST00000562510.1 |
| exon_skip_133482 | 16 | 12497304:12497386:12571575:12571716:12618558:12618698 | 12571575:12571716 | ENSG00000048471.9 | ENST00000566228.1,ENST00000306030.3,ENST00000323433.4,ENST00000564791.1 |
| exon_skip_133483 | 16 | 12571575:12571716:12618558:12618698:12662362:12668145 | 12618558:12618698 | ENSG00000048471.9 | ENST00000566228.1,ENST00000306030.3 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for SNX29 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000566228 | 12093153 | 12093215 | Frame-shift |
| ENST00000566228 | 12096847 | 12096900 | Frame-shift |
| ENST00000566228 | 12121176 | 12121301 | Frame-shift |
| ENST00000566228 | 12136753 | 12136934 | Frame-shift |
| ENST00000566228 | 12155384 | 12155503 | Frame-shift |
| ENST00000566228 | 12293457 | 12293540 | Frame-shift |
| ENST00000566228 | 12492302 | 12492358 | Frame-shift |
| ENST00000566228 | 12618558 | 12618698 | Frame-shift |
| ENST00000566228 | 12450019 | 12450136 | In-frame |
| ENST00000566228 | 12571575 | 12571716 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000566228 | 12093153 | 12093215 | Frame-shift |
| ENST00000566228 | 12096847 | 12096900 | Frame-shift |
| ENST00000566228 | 12121176 | 12121301 | Frame-shift |
| ENST00000566228 | 12136753 | 12136934 | Frame-shift |
| ENST00000566228 | 12155384 | 12155503 | Frame-shift |
| ENST00000566228 | 12293457 | 12293540 | Frame-shift |
| ENST00000566228 | 12492302 | 12492358 | Frame-shift |
| ENST00000566228 | 12618558 | 12618698 | Frame-shift |
| ENST00000566228 | 12450019 | 12450136 | In-frame |
| ENST00000566228 | 12571575 | 12571716 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for SNX29 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000566228 | 8188 | 813 | 12450019 | 12450136 | 1852 | 1968 | 594 | 633 |
| ENST00000566228 | 8188 | 813 | 12571575 | 12571716 | 2107 | 2247 | 679 | 726 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000566228 | 8188 | 813 | 12450019 | 12450136 | 1852 | 1968 | 594 | 633 |
| ENST00000566228 | 8188 | 813 | 12571575 | 12571716 | 2107 | 2247 | 679 | 726 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q8TEQ0 | 594 | 633 | 1 | 813 | Chain | ID=PRO_0000297565;Note=Sorting nexin-29 |
| Q8TEQ0 | 679 | 726 | 1 | 813 | Chain | ID=PRO_0000297565;Note=Sorting nexin-29 |
| Q8TEQ0 | 679 | 726 | 656 | 779 | Domain | Note=PX;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00147 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q8TEQ0 | 594 | 633 | 1 | 813 | Chain | ID=PRO_0000297565;Note=Sorting nexin-29 |
| Q8TEQ0 | 679 | 726 | 1 | 813 | Chain | ID=PRO_0000297565;Note=Sorting nexin-29 |
| Q8TEQ0 | 679 | 726 | 656 | 779 | Domain | Note=PX;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00147 |
Top |
SNVs in the skipped exons for SNX29 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_133481 | 12492303 | 12492358 | 12492322 | 12492322 | Frame_Shift_Del | A | - | p.Q640fs |
| STAD | TCGA-BR-7703-01 | exon_skip_133481 | 12492303 | 12492358 | 12492337 | 12492338 | Frame_Shift_Del | AG | - | p.645_645del |
| STAD | TCGA-BR-7703-01 | exon_skip_133481 | 12492303 | 12492358 | 12492337 | 12492338 | Frame_Shift_Del | AG | - | p.Q260fs |
| STAD | TCGA-BR-8591-01 | exon_skip_133481 | 12492303 | 12492358 | 12492337 | 12492338 | Frame_Shift_Del | AG | - | p.645_645del |
| STAD | TCGA-BR-8591-01 | exon_skip_133481 | 12492303 | 12492358 | 12492337 | 12492338 | Frame_Shift_Del | AG | - | p.Q260fs |
| SKCM | TCGA-FR-A7U9-06 | exon_skip_133470 | 12121177 | 12121301 | 12121235 | 12121235 | Nonsense_Mutation | C | T | p.R61* |
| THYM | TCGA-XU-AAXW-01 | exon_skip_133472 | 12136754 | 12136934 | 12136798 | 12136798 | Nonsense_Mutation | G | T | p.E98X |
| CHOL | TCGA-3X-AAVE-01 | exon_skip_133472 | 12136754 | 12136934 | 12136879 | 12136879 | Nonsense_Mutation | G | T | p.E125X |
| SKCM | TCGA-FR-A726-01 | exon_skip_133483 | 12618559 | 12618698 | 12618679 | 12618679 | Nonsense_Mutation | C | T | p.Q767* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JHOS3_OVARY | 12293458 | 12293540 | 12293474 | 12293499 | Frame_Shift_Del | AAAGTCCAACTGAAGAAATATGTAGG | - | p.KVQLKKYVG538fs |
| 22RV1_PROSTATE | 12096848 | 12096900 | 12096857 | 12096857 | Missense_Mutation | C | T | p.R27C |
| LS411N_LARGE_INTESTINE | 12121177 | 12121301 | 12121271 | 12121271 | Missense_Mutation | G | A | p.A73T |
| MZ7MEL_SKIN | 12121177 | 12121301 | 12121283 | 12121283 | Missense_Mutation | G | A | p.A77T |
| 22RV1_PROSTATE | 12136754 | 12136934 | 12136808 | 12136808 | Missense_Mutation | G | A | p.R101H |
| NCIH2172_LUNG | 12136754 | 12136934 | 12136808 | 12136808 | Missense_Mutation | G | A | p.R101H |
| JHUEM2_ENDOMETRIUM | 12136754 | 12136934 | 12136813 | 12136813 | Missense_Mutation | T | C | p.Y103H |
| MOLT16_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 12136754 | 12136934 | 12136823 | 12136823 | Missense_Mutation | G | A | p.R106H |
| HT115_LARGE_INTESTINE | 12136754 | 12136934 | 12136879 | 12136879 | Missense_Mutation | G | A | p.E125K |
| RCHACV_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 12136754 | 12136934 | 12136895 | 12136895 | Missense_Mutation | G | A | p.R130H |
| HEC108_ENDOMETRIUM | 12136754 | 12136934 | 12136898 | 12136898 | Missense_Mutation | A | G | p.Y131C |
| PCM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 12450020 | 12450136 | 12450054 | 12450054 | Missense_Mutation | A | G | p.N606S |
| SNU175_LARGE_INTESTINE | 12450020 | 12450136 | 12450069 | 12450069 | Missense_Mutation | G | A | p.R611K |
| C2BBE1_LARGE_INTESTINE | 12450020 | 12450136 | 12450129 | 12450129 | Missense_Mutation | G | A | p.R631Q |
| NCIH2342_LUNG | 12571576 | 12571716 | 12571586 | 12571586 | Missense_Mutation | G | A | p.R683Q |
| JM1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 12571576 | 12571716 | 12571612 | 12571612 | Missense_Mutation | T | G | p.Y692D |
| OC316_OVARY | 12571576 | 12571716 | 12571613 | 12571613 | Missense_Mutation | A | G | p.Y692C |
| SNU1040_LARGE_INTESTINE | 12571576 | 12571716 | 12571616 | 12571616 | Missense_Mutation | G | A | p.R693H |
| SW48_LARGE_INTESTINE | 12618559 | 12618698 | 12618607 | 12618607 | Missense_Mutation | C | T | p.R743C |
| HEC6_ENDOMETRIUM | 12618559 | 12618698 | 12618608 | 12618608 | Missense_Mutation | G | A | p.R743H |
| NCIH1703_LUNG | 12618559 | 12618698 | 12618612 | 12618612 | Missense_Mutation | C | A | p.S744R |
| NCIH1755_LUNG | 12618559 | 12618698 | 12618618 | 12618618 | Missense_Mutation | G | T | p.M746I |
| AN3CA_ENDOMETRIUM | 12618559 | 12618698 | 12618679 | 12618679 | Missense_Mutation | C | A | p.Q767K |
| SLVL_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 12121177 | 12121301 | 12121186 | 12121186 | Nonsense_Mutation | T | A | p.C44* |
| JAR_PLACENTA | 12571576 | 12571716 | 12571600 | 12571600 | Nonsense_Mutation | G | T | p.E688* |
| NCIH1930_LUNG | 12155385 | 12155503 | 12155385 | 12155385 | Splice_Site | G | A | p.K375K |
| HEC6_ENDOMETRIUM | 12618559 | 12618698 | 12618697 | 12618697 | Splice_Site | G | A | p.V773I |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for SNX29 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SNX29 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SNX29 |
Top |
RelatedDrugs for SNX29 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SNX29 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|