|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for TNFRSF10A |
 Gene summary |
| Gene information | Gene symbol | TNFRSF10A | Gene ID | 8797 |
| Gene name | TNF receptor superfamily member 10a | |
| Synonyms | APO2|CD261|DR4|TRAILR-1|TRAILR1 | |
| Cytomap | 8p21.3 | |
| Type of gene | protein-coding | |
| Description | tumor necrosis factor receptor superfamily member 10ATNF-related apoptosis-inducing ligand receptor 1TRAIL receptor 1TRAIL-R1cytotoxic TRAIL receptordeath receptor 4tumor necrosis factor receptor superfamily member 10a variant 2tumor necrosis facto | |
| Modification date | 20180522 | |
| UniProtAcc | O00220 | |
| Context | PubMed: TNFRSF10A [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| TNFRSF10A | GO:0036462 | TRAIL-activated apoptotic signaling pathway | 21785459 |
| TNFRSF10A | GO:0097191 | extrinsic apoptotic signaling pathway | 21785459 |
Top |
Exon skipping events across known transcript of Ensembl for TNFRSF10A from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for TNFRSF10A |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for TNFRSF10A |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_488782 | 8 | 23049326:23049526:23054644:23054717:23056778:23056961 | 23054644:23054717 | ENSG00000104689.5 | ENST00000221132.3 |
| exon_skip_488783 | 8 | 23057398:23057430:23058017:23058113:23058199:23058273 | 23058017:23058113 | ENSG00000104689.5 | ENST00000221132.3,ENST00000524158.1 |
| exon_skip_488784 | 8 | 23058017:23058113:23058199:23058273:23059320:23059432 | 23058199:23058273 | ENSG00000104689.5 | ENST00000221132.3,ENST00000524158.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for TNFRSF10A |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_488782 | 8 | 23049326:23049526:23054644:23054717:23056778:23056961 | 23054644:23054717 | ENSG00000104689.5 | ENST00000221132.3 |
| exon_skip_488783 | 8 | 23057398:23057430:23058017:23058113:23058199:23058273 | 23058017:23058113 | ENSG00000104689.5 | ENST00000221132.3,ENST00000524158.1 |
| exon_skip_488784 | 8 | 23058017:23058113:23058199:23058273:23059320:23059432 | 23058199:23058273 | ENSG00000104689.5 | ENST00000221132.3,ENST00000524158.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for TNFRSF10A |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000221132 | 23054644 | 23054717 | Frame-shift |
| ENST00000221132 | 23058199 | 23058273 | Frame-shift |
| ENST00000221132 | 23058017 | 23058113 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000221132 | 23054644 | 23054717 | Frame-shift |
| ENST00000221132 | 23058199 | 23058273 | Frame-shift |
| ENST00000221132 | 23058017 | 23058113 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for TNFRSF10A |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000221132 | 2731 | 468 | 23058017 | 23058113 | 769 | 864 | 234 | 266 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000221132 | 2731 | 468 | 23058017 | 23058113 | 769 | 864 | 234 | 266 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O00220 | 234 | 266 | 24 | 468 | Chain | ID=PRO_0000034579;Note=Tumor necrosis factor receptor superfamily member 10A |
| O00220 | 234 | 266 | 24 | 239 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| O00220 | 234 | 266 | 263 | 468 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| O00220 | 234 | 266 | 240 | 262 | Transmembrane | Note=Helical;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| O00220 | 234 | 266 | 24 | 468 | Chain | ID=PRO_0000034579;Note=Tumor necrosis factor receptor superfamily member 10A |
| O00220 | 234 | 266 | 24 | 239 | Topological domain | Note=Extracellular;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| O00220 | 234 | 266 | 263 | 468 | Topological domain | Note=Cytoplasmic;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| O00220 | 234 | 266 | 240 | 262 | Transmembrane | Note=Helical;Ontology_term=ECO:0000255;evidence=ECO:0000255 |
Top |
SNVs in the skipped exons for TNFRSF10A |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
TNFRSF10A_PAAD_exon_skip_488782_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| PAAD | TCGA-3A-A9IB-01 | exon_skip_488782 | 23054645 | 23054717 | 23054679 | 23054701 | Frame_Shift_Del | CAGCCTCCTCCTCTGAGACCCTT | - | p.EGSQRRRL344fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_488782 | 23054645 | 23054717 | 23054706 | 23054706 | Frame_Shift_Del | T | - | p.E342fs |
| LIHC | TCGA-G3-A3CJ-01 | 23058200 | 23058273 | 23058207 | 23058207 | Frame_Shift_Del | T | - | p.K232fs | |
| STAD | TCGA-CG-4442-01 | exon_skip_488783 | 23058018 | 23058113 | 23058108 | 23058108 | Nonsense_Mutation | C | A | p.G237* |
| STAD | TCGA-CG-4442-01 | exon_skip_488783 | 23058018 | 23058113 | 23058108 | 23058108 | Nonsense_Mutation | C | A | p.G237X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-3A-A9IB-01 |
| Cancer type: PAAD | |
| ESID: exon_skip_488782 | |
| Skipped exon start: 23054645 | |
| Skipped exon end: 23054717 | |
| Mutation start: 23054679 | |
| Mutation end: 23054701 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CAGCCTCCTCCTCTGAGACCCTT | |
| Mutation seq: - | |
| AAchange: p.EGSQRRRL344fs | |
exon_skip_488782_PAAD_TCGA-3A-A9IB-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| NCIH1299_LUNG | 23054645 | 23054717 | 23054648 | 23054648 | Missense_Mutation | C | T | p.E362K |
| A388_SKIN | 23054645 | 23054717 | 23054648 | 23054648 | Missense_Mutation | C | T | p.E362K |
| PCM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 23058018 | 23058113 | 23058066 | 23058066 | Missense_Mutation | G | C | p.P251A |
| IOMMLEE_CENTRAL_NERVOUS_SYSTEM | 23058200 | 23058273 | 23058235 | 23058235 | Missense_Mutation | G | T | p.P223H |
| CL34_LARGE_INTESTINE | 23058200 | 23058273 | 23058258 | 23058258 | Missense_Mutation | C | A | p.M215I |
| DV90_LUNG | 23058018 | 23058113 | 23058019 | 23058019 | Splice_Site | T | C | p.S266S |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for TNFRSF10A |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for TNFRSF10A |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for TNFRSF10A |
Top |
RelatedDrugs for TNFRSF10A |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for TNFRSF10A |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| TNFRSF10A | C0001418 | Adenocarcinoma | 1 | CTD_human |
| TNFRSF10A | C0002170 | Alopecia | 1 | CTD_human |
| TNFRSF10A | C0002871 | Anemia | 1 | CTD_human |
| TNFRSF10A | C0003123 | Anorexia | 1 | CTD_human |
| TNFRSF10A | C0009375 | Colonic Neoplasms | 1 | CTD_human |
| TNFRSF10A | C0013182 | Drug Allergy | 1 | CTD_human |
| TNFRSF10A | C0014859 | Esophageal Neoplasms | 1 | CTD_human |
| TNFRSF10A | C0015672 | Fatigue | 1 | CTD_human |
| TNFRSF10A | C0027497 | Nausea | 1 | CTD_human |
| TNFRSF10A | C0027947 | Neutropenia | 1 | CTD_human |
| TNFRSF10A | C0031117 | Peripheral Neuropathy | 1 | CTD_human |
| TNFRSF10A | C0033578 | Prostatic Neoplasms | 1 | CTD_human |
| TNFRSF10A | C0040034 | Thrombocytopenia | 1 | CTD_human |
| TNFRSF10A | C0242383 | Age related macular degeneration | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|