|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RBM10 |
 Gene summary |
| Gene information | Gene symbol | RBM10 | Gene ID | 8241 |
| Gene name | RNA binding motif protein 10 | |
| Synonyms | DXS8237E|GPATC9|GPATCH9|S1-1|TARPS|ZRANB5 | |
| Cytomap | Xp11.3 | |
| Type of gene | protein-coding | |
| Description | RNA-binding protein 10RNA-binding protein S1-1g patch domain-containing protein 9 | |
| Modification date | 20180520 | |
| UniProtAcc | P98175 | |
| Context | PubMed: RBM10 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for RBM10 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RBM10 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RBM10 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_509936 | X | 47004677:47004884:47006755:47006897:47028713:47028897 | 47006755:47006897 | ENSG00000182872.11 | ENST00000345781.6,ENST00000329236.7 |
| exon_skip_509942 | X | 47028713:47028897:47030426:47030657:47032526:47032596 | 47030426:47030657 | ENSG00000182872.11 | ENST00000377604.3 |
| exon_skip_509943 | X | 47032526:47032596:47034417:47034491:47035898:47035985 | 47034417:47034491 | ENSG00000182872.11 | ENST00000345781.6,ENST00000377604.3,ENST00000329236.7 |
| exon_skip_509944 | X | 47034417:47034491:47035898:47035985:47038501:47038562 | 47035898:47035985 | ENSG00000182872.11 | ENST00000345781.6,ENST00000377604.3,ENST00000329236.7 |
| exon_skip_509946 | X | 47038501:47038562:47038717:47038894:47039278:47039436 | 47038717:47038894 | ENSG00000182872.11 | ENST00000345781.6,ENST00000377604.3,ENST00000329236.7 |
| exon_skip_509949 | X | 47038717:47038894:47039082:47039180:47039278:47039436 | 47039082:47039180 | ENSG00000182872.11 | ENST00000478410.1 |
| exon_skip_509950 | X | 47038717:47038894:47039278:47039436:47039610:47039708 | 47039278:47039436 | ENSG00000182872.11 | ENST00000329236.7 |
| exon_skip_509951 | X | 47038717:47038894:47039278:47039439:47039610:47039708 | 47039278:47039439 | ENSG00000182872.11 | ENST00000345781.6,ENST00000377604.3 |
| exon_skip_509952 | X | 47039610:47039708:47039817:47039905:47040613:47040800 | 47039817:47039905 | ENSG00000182872.11 | ENST00000345781.6,ENST00000478410.1,ENST00000377604.3,ENST00000329236.7 |
| exon_skip_509954 | X | 47044453:47044603:47044700:47044766:47044840:47045029 | 47044700:47044766 | ENSG00000182872.11 | ENST00000345781.6,ENST00000377604.3,ENST00000329236.7 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RBM10 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_509936 | X | 47004677:47004884:47006755:47006897:47028713:47028897 | 47006755:47006897 | ENSG00000182872.11 | ENST00000329236.7,ENST00000345781.6 |
| exon_skip_509942 | X | 47028713:47028897:47030426:47030657:47032526:47032596 | 47030426:47030657 | ENSG00000182872.11 | ENST00000377604.3 |
| exon_skip_509943 | X | 47032526:47032596:47034417:47034491:47035898:47035985 | 47034417:47034491 | ENSG00000182872.11 | ENST00000377604.3,ENST00000329236.7,ENST00000345781.6 |
| exon_skip_509944 | X | 47034417:47034491:47035898:47035985:47038501:47038562 | 47035898:47035985 | ENSG00000182872.11 | ENST00000377604.3,ENST00000329236.7,ENST00000345781.6 |
| exon_skip_509946 | X | 47038501:47038562:47038717:47038894:47039278:47039436 | 47038717:47038894 | ENSG00000182872.11 | ENST00000377604.3,ENST00000329236.7,ENST00000345781.6 |
| exon_skip_509949 | X | 47038717:47038894:47039082:47039180:47039278:47039436 | 47039082:47039180 | ENSG00000182872.11 | ENST00000478410.1 |
| exon_skip_509950 | X | 47038717:47038894:47039278:47039436:47039610:47039708 | 47039278:47039436 | ENSG00000182872.11 | ENST00000329236.7 |
| exon_skip_509951 | X | 47038717:47038894:47039278:47039439:47039610:47039708 | 47039278:47039439 | ENSG00000182872.11 | ENST00000377604.3,ENST00000345781.6 |
| exon_skip_509952 | X | 47039610:47039708:47039817:47039905:47040613:47040800 | 47039817:47039905 | ENSG00000182872.11 | ENST00000377604.3,ENST00000329236.7,ENST00000345781.6,ENST00000478410.1 |
| exon_skip_509954 | X | 47044453:47044603:47044700:47044766:47044840:47045029 | 47044700:47044766 | ENSG00000182872.11 | ENST00000377604.3,ENST00000329236.7,ENST00000345781.6 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RBM10 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000377604 | 47034417 | 47034491 | Frame-shift |
| ENST00000377604 | 47039278 | 47039439 | Frame-shift |
| ENST00000377604 | 47039817 | 47039905 | Frame-shift |
| ENST00000377604 | 47030426 | 47030657 | In-frame |
| ENST00000377604 | 47035898 | 47035985 | In-frame |
| ENST00000377604 | 47038717 | 47038894 | In-frame |
| ENST00000377604 | 47044700 | 47044766 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000377604 | 47034417 | 47034491 | Frame-shift |
| ENST00000377604 | 47039278 | 47039439 | Frame-shift |
| ENST00000377604 | 47039817 | 47039905 | Frame-shift |
| ENST00000377604 | 47030426 | 47030657 | In-frame |
| ENST00000377604 | 47035898 | 47035985 | In-frame |
| ENST00000377604 | 47038717 | 47038894 | In-frame |
| ENST00000377604 | 47044700 | 47044766 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for RBM10 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000377604 | 3764 | 930 | 47030426 | 47030657 | 944 | 1174 | 67 | 144 |
| ENST00000377604 | 3764 | 930 | 47035898 | 47035985 | 1319 | 1405 | 192 | 221 |
| ENST00000377604 | 3764 | 930 | 47038717 | 47038894 | 1467 | 1643 | 241 | 300 |
| ENST00000377604 | 3764 | 930 | 47044700 | 47044766 | 2843 | 2908 | 700 | 722 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000377604 | 3764 | 930 | 47030426 | 47030657 | 944 | 1174 | 67 | 144 |
| ENST00000377604 | 3764 | 930 | 47035898 | 47035985 | 1319 | 1405 | 192 | 221 |
| ENST00000377604 | 3764 | 930 | 47038717 | 47038894 | 1467 | 1643 | 241 | 300 |
| ENST00000377604 | 3764 | 930 | 47044700 | 47044766 | 2843 | 2908 | 700 | 722 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P98175 | 67 | 144 | 68 | 144 | Alternative sequence | ID=VSP_036173;Note=In isoform 3 and isoform 4. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:14702039,ECO:0000303|PubMed:15489334;Dbxref=PMID:14702039,PMID:15489334 |
| P98175 | 67 | 144 | 130 | 134 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 67 | 144 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 67 | 144 | 80 | 87 | Compositional bias | Note=Poly-Arg |
| P98175 | 67 | 144 | 113 | 125 | Compositional bias | Note=Poly-Glu |
| P98175 | 67 | 144 | 129 | 209 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 67 | 144 | 142 | 152 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 67 | 144 | 89 | 89 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:20068231,ECO:0000244|PubMed:23186163,ECO:0000244|PubMed:24275569;Dbxref=PMID:20068231,PMID:23186163,PMID:24275569 |
| P98175 | 192 | 221 | 194 | 197 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 200 | 205 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 220 | 222 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2MXV |
| P98175 | 192 | 221 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 192 | 221 | 129 | 209 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 192 | 221 | 190 | 193 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 212 | 242 | Zinc finger | Note=RanBP2-type;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00322 |
| P98175 | 241 | 300 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 241 | 300 | 300 | 384 | Domain | Note=RRM 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 241 | 300 | 212 | 242 | Zinc finger | Note=RanBP2-type;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00322 |
| P98175 | 700 | 722 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 700 | 722 | 718 | 718 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:20068231,ECO:0000244|PubMed:21406692,ECO:0000244|PubMed:24275569;Dbxref=PMID:20068231,PMID:21406692,PMID:24275569 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P98175 | 67 | 144 | 68 | 144 | Alternative sequence | ID=VSP_036173;Note=In isoform 3 and isoform 4. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:14702039,ECO:0000303|PubMed:15489334;Dbxref=PMID:14702039,PMID:15489334 |
| P98175 | 67 | 144 | 130 | 134 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 67 | 144 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 67 | 144 | 80 | 87 | Compositional bias | Note=Poly-Arg |
| P98175 | 67 | 144 | 113 | 125 | Compositional bias | Note=Poly-Glu |
| P98175 | 67 | 144 | 129 | 209 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 67 | 144 | 142 | 152 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 67 | 144 | 89 | 89 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:20068231,ECO:0000244|PubMed:23186163,ECO:0000244|PubMed:24275569;Dbxref=PMID:20068231,PMID:23186163,PMID:24275569 |
| P98175 | 192 | 221 | 194 | 197 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 200 | 205 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 220 | 222 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2MXV |
| P98175 | 192 | 221 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 192 | 221 | 129 | 209 | Domain | Note=RRM 1;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 192 | 221 | 190 | 193 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2LXI |
| P98175 | 192 | 221 | 212 | 242 | Zinc finger | Note=RanBP2-type;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00322 |
| P98175 | 241 | 300 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 241 | 300 | 300 | 384 | Domain | Note=RRM 2;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00176 |
| P98175 | 241 | 300 | 212 | 242 | Zinc finger | Note=RanBP2-type;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00322 |
| P98175 | 700 | 722 | 1 | 930 | Chain | ID=PRO_0000081767;Note=RNA-binding protein 10 |
| P98175 | 700 | 722 | 718 | 718 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:20068231,ECO:0000244|PubMed:21406692,ECO:0000244|PubMed:24275569;Dbxref=PMID:20068231,PMID:21406692,PMID:24275569 |
Top |
SNVs in the skipped exons for RBM10 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
RBM10_LUAD_exon_skip_509946_psi_boxplot.png |
RBM10_TGCT_exon_skip_509942_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_509936 | 47006756 | 47006897 | 47006891 | 47006891 | Frame_Shift_Del | A | - | p.E4fs |
| TGCT | TCGA-2G-AAF8-01 | exon_skip_509942 | 47030427 | 47030657 | 47030570 | 47030672 | Frame_Shift_Del | GGAGGAGGAGGAGGATGAGGAGGAGGAGGAGAAGGCCAGTAACATCGTCATGCTGAGGATGCTGCCACAGGCAGCCACTGAGGATGACGTACGTGCCCCCCAT | - | p.180_209del |
| COAD | TCGA-AZ-6599-01 | exon_skip_509943 | 47034418 | 47034491 | 47034427 | 47034427 | Frame_Shift_Del | G | - | p.R94fs |
| LUAD | TCGA-64-5775-01 | exon_skip_509946 | 47038718 | 47038894 | 47038768 | 47038768 | Frame_Shift_Del | C | - | p.P259fs |
| PAAD | TCGA-FB-AAQ2-01 | exon_skip_509950 | 47039279 | 47039436 | 47039289 | 47039289 | Frame_Shift_Del | G | - | p.L304fs |
| PAAD | TCGA-FB-AAQ2-01 | exon_skip_509951 | 47039279 | 47039439 | 47039289 | 47039289 | Frame_Shift_Del | G | - | p.L304fs |
| LUAD | TCGA-35-3615-01 | exon_skip_509943 | 47034418 | 47034491 | 47034469 | 47034470 | Frame_Shift_Ins | - | A | p.T185fs |
| BLCA | TCGA-ZF-AA53-01 | exon_skip_509944 | 47035899 | 47035985 | 47035961 | 47035962 | Frame_Shift_Ins | - | A | p.N214fs |
| HNSC | TCGA-CV-A463-01 | exon_skip_509943 | 47034418 | 47034491 | 47034420 | 47034420 | Nonsense_Mutation | C | T | p.Q169* |
| LUAD | TCGA-05-4424-01 | exon_skip_509943 | 47034418 | 47034491 | 47034444 | 47034444 | Nonsense_Mutation | G | T | p.E177* |
| UCEC | TCGA-BG-A0MG-01 | exon_skip_509943 | 47034418 | 47034491 | 47034471 | 47034471 | Nonsense_Mutation | C | T | p.R186* |
| UCEC | TCGA-BG-A0MG-01 | exon_skip_509943 | 47034418 | 47034491 | 47034471 | 47034471 | Nonsense_Mutation | C | T | p.R251* |
| SKCM | TCGA-EE-A181-06 | exon_skip_509944 | 47035899 | 47035985 | 47035920 | 47035920 | Nonsense_Mutation | C | T | p.Q200* |
| LUAD | TCGA-55-A490-01 | exon_skip_509946 | 47038718 | 47038894 | 47038783 | 47038783 | Nonsense_Mutation | G | T | p.E264* |
| BLCA | TCGA-KQ-A41R-01 | exon_skip_509946 | 47038718 | 47038894 | 47038822 | 47038822 | Nonsense_Mutation | C | T | p.Q277* |
| BLCA | TCGA-CU-A72E-01 | exon_skip_509946 | 47038718 | 47038894 | 47038856 | 47038856 | Nonsense_Mutation | C | G | p.S288* |
| COAD | TCGA-AD-6965-01 | exon_skip_509954 | 47044701 | 47044766 | 47044719 | 47044719 | Nonsense_Mutation | C | T | p.Q630X |
| LUAD | TCGA-44-2655-01 | exon_skip_509954 | 47044701 | 47044766 | 47044719 | 47044719 | Nonsense_Mutation | C | T | p.Q707* |
| LUAD | TCGA-75-6214-01 | exon_skip_509943 | 47034418 | 47034491 | 47034417 | 47034417 | Splice_Site | G | C | p.G168_splice |
| LUAD | TCGA-78-7148-01 | exon_skip_509943 | 47034418 | 47034491 | 47034417 | 47034417 | Splice_Site | G | A | p.G168_splice |
| LUAD | TCGA-49-4494-01 | exon_skip_509943 | 47034418 | 47034491 | 47034492 | 47034492 | Splice_Site | G | T | p.Q192_splice |
| LUAD | TCGA-73-7498-01 | exon_skip_509952 | 47039818 | 47039905 | 47039816 | 47039816 | Splice_Site | A | T | p.R387_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-55-A490-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_509946 | |
| Skipped exon start: 47038718 | |
| Skipped exon end: 47038894 | |
| Mutation start: 47038783 | |
| Mutation end: 47038783 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: T | |
| AAchange: p.E264* | |
exon_skip_425073_LUAD_TCGA-55-A490-01.png | |
exon_skip_432050_LUAD_TCGA-55-A490-01.png | |
exon_skip_509946_LUAD_TCGA-55-A490-01.png | |
exon_skip_517484_LUAD_TCGA-55-A490-01.png | |
exon_skip_517493_LUAD_TCGA-55-A490-01.png | |
exon_skip_517500_LUAD_TCGA-55-A490-01.png | |
exon_skip_517501_LUAD_TCGA-55-A490-01.png | |
 | Sample: TCGA-2G-AAF8-01 |
| Cancer type: TGCT | |
| ESID: exon_skip_509942 | |
| Skipped exon start: 47030427 | |
| Skipped exon end: 47030657 | |
| Mutation start: 47030570 | |
| Mutation end: 47030672 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: GGAGGAGGAGGAGGATGAGGAGGAGGAGGAGAAGGCCAGTAACATCGTCATGCTGAGGATGCTGCCACAGGCAGCCACTGAGGATGACGTACGTGCCCCCCAT | |
| Mutation seq: - | |
| AAchange: p.180_209del | |
exon_skip_509942_TGCT_TCGA-2G-AAF8-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JHUEM1_ENDOMETRIUM | 47006756 | 47006897 | 47006885 | 47006885 | Missense_Mutation | A | G | p.E2G |
| 639V_URINARY_TRACT | 47030427 | 47030657 | 47030439 | 47030439 | Missense_Mutation | G | A | p.A72T |
| HEC59_ENDOMETRIUM | 47030427 | 47030657 | 47030470 | 47030470 | Missense_Mutation | G | A | p.R82Q |
| MM127_SKIN | 47030427 | 47030657 | 47030479 | 47030479 | Missense_Mutation | G | C | p.R85P |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 47030427 | 47030657 | 47030582 | 47030582 | Missense_Mutation | G | T | p.E119D |
| HEC1A_ENDOMETRIUM | 47030427 | 47030657 | 47030582 | 47030582 | Missense_Mutation | G | T | p.E119D |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 47030427 | 47030657 | 47030582 | 47030582 | Missense_Mutation | G | T | p.E119D |
| SNU1040_LARGE_INTESTINE | 47034418 | 47034491 | 47034426 | 47034426 | Missense_Mutation | C | T | p.R171W |
| NCIH1435_LUNG | 47034418 | 47034491 | 47034427 | 47034427 | Missense_Mutation | G | A | p.R171Q |
| MEWO_SKIN | 47035899 | 47035985 | 47035903 | 47035903 | Missense_Mutation | C | T | p.S194F |
| RCCER_KIDNEY | 47038718 | 47038894 | 47038804 | 47038805 | Missense_Mutation | CC | AT | p.P271I |
| MZ1PC_PANCREAS | 47038718 | 47038894 | 47038841 | 47038841 | Missense_Mutation | C | A | p.A283D |
| MELJUSO_SKIN | 47038718 | 47038894 | 47038892 | 47038892 | Missense_Mutation | A | G | p.D300G |
| SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 47039279 | 47039436 | 47039291 | 47039291 | Missense_Mutation | G | A | p.R305H |
| SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 47039279 | 47039439 | 47039291 | 47039291 | Missense_Mutation | G | A | p.R305H |
| HCC2108_LUNG | 47039279 | 47039436 | 47039372 | 47039372 | Missense_Mutation | G | T | p.R332L |
| HCC2108_LUNG | 47039279 | 47039439 | 47039372 | 47039372 | Missense_Mutation | G | T | p.R332L |
| CMLT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 47039279 | 47039436 | 47039374 | 47039374 | Missense_Mutation | G | A | p.V333I |
| CMLT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 47039279 | 47039439 | 47039374 | 47039374 | Missense_Mutation | G | A | p.V333I |
| A427_LUNG | 47039279 | 47039436 | 47039420 | 47039420 | Missense_Mutation | T | A | p.I348N |
| A427_LUNG | 47039279 | 47039439 | 47039420 | 47039420 | Missense_Mutation | T | A | p.I348N |
| LS411N_LARGE_INTESTINE | 47039818 | 47039905 | 47039844 | 47039844 | Missense_Mutation | G | A | p.R396H |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 47039818 | 47039905 | 47039850 | 47039850 | Missense_Mutation | G | A | p.S398N |
| MFE319_ENDOMETRIUM | 47039818 | 47039905 | 47039883 | 47039883 | Missense_Mutation | C | T | p.A409V |
| NCIH2444_LUNG | 47044701 | 47044766 | 47044713 | 47044713 | Missense_Mutation | G | A | p.E705K |
| MCC13_SKIN | 47034418 | 47034491 | 47034476 | 47034476 | Nonsense_Mutation | G | A | p.W187* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RBM10 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RBM10 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RBM10 |
Top |
RelatedDrugs for RBM10 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RBM10 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|