|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for KAT6A |
 Gene summary |
| Gene information | Gene symbol | KAT6A | Gene ID | 7994 |
| Gene name | lysine acetyltransferase 6A | |
| Synonyms | MOZ|MRD32|MYST-3|MYST3|RUNXBP2|ZC2HC6A|ZNF220 | |
| Cytomap | 8p11.21 | |
| Type of gene | protein-coding | |
| Description | histone acetyltransferase KAT6AK(lysine) acetyltransferase 6AMOZ, YBF2/SAS3, SAS2 and TIP60 protein 3MYST histone acetyltransferase (monocytic leukemia) 3histone acetyltransferase MYST3monocytic leukemia zinc finger proteinrunt-related transcription | |
| Modification date | 20180523 | |
| UniProtAcc | Q92794 | |
| Context | PubMed: KAT6A [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| KAT6A | GO:0006473 | protein acetylation | 23431171 |
| KAT6A | GO:0016573 | histone acetylation | 11742995|17925393 |
| KAT6A | GO:0030099 | myeloid cell differentiation | 11742995 |
| KAT6A | GO:0043966 | histone H3 acetylation | 16387653 |
| KAT6A | GO:0045892 | negative regulation of transcription, DNA-templated | 11742995 |
| KAT6A | GO:0045893 | positive regulation of transcription, DNA-templated | 11742995|11965546|18794358 |
Top |
Exon skipping events across known transcript of Ensembl for KAT6A from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for KAT6A |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for KAT6A |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_489456 | 8 | 41798359:41798962:41800310:41800518:41801265:41801497 | 41800310:41800518 | ENSG00000083168.5 | ENST00000418721.1,ENST00000265713.2,ENST00000406337.1,ENST00000396930.3 |
| exon_skip_489457 | 8 | 41806739:41806881:41812813:41812929:41832221:41832340 | 41812813:41812929 | ENSG00000083168.5 | ENST00000485568.1,ENST00000265713.2,ENST00000406337.1,ENST00000396930.3 |
| exon_skip_489459 | 8 | 41839356:41839472:41844972:41845081:41905895:41906820 | 41844972:41845081 | ENSG00000083168.5 | ENST00000485568.1,ENST00000265713.2,ENST00000406337.1,ENST00000396930.3 |
| exon_skip_489460 | 8 | 41906687:41906820:41907093:41907225:41909418:41909505 | 41907093:41907225 | ENSG00000083168.5 | ENST00000426524.1,ENST00000396930.3 |
| exon_skip_489461 | 8 | 41906687:41906820:41907137:41907225:41909418:41909505 | 41907137:41907225 | ENSG00000083168.5 | ENST00000406337.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for KAT6A |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_489456 | 8 | 41798359:41798962:41800310:41800518:41801265:41801497 | 41800310:41800518 | ENSG00000083168.5 | ENST00000265713.2,ENST00000406337.1,ENST00000396930.3,ENST00000418721.1 |
| exon_skip_489457 | 8 | 41806739:41806881:41812813:41812929:41832221:41832340 | 41812813:41812929 | ENSG00000083168.5 | ENST00000265713.2,ENST00000406337.1,ENST00000396930.3,ENST00000485568.1 |
| exon_skip_489459 | 8 | 41839356:41839472:41844972:41845081:41905895:41906820 | 41844972:41845081 | ENSG00000083168.5 | ENST00000265713.2,ENST00000406337.1,ENST00000396930.3,ENST00000485568.1 |
| exon_skip_489460 | 8 | 41906687:41906820:41907093:41907225:41909418:41909505 | 41907093:41907225 | ENSG00000083168.5 | ENST00000396930.3,ENST00000426524.1 |
| exon_skip_489461 | 8 | 41906687:41906820:41907137:41907225:41909418:41909505 | 41907137:41907225 | ENSG00000083168.5 | ENST00000406337.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for KAT6A |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000396930 | 41907093 | 41907225 | 3UTR-3UTR |
| ENST00000265713 | 41800310 | 41800518 | Frame-shift |
| ENST00000396930 | 41800310 | 41800518 | Frame-shift |
| ENST00000265713 | 41812813 | 41812929 | Frame-shift |
| ENST00000396930 | 41812813 | 41812929 | Frame-shift |
| ENST00000265713 | 41844972 | 41845081 | Frame-shift |
| ENST00000396930 | 41844972 | 41845081 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000396930 | 41907093 | 41907225 | 3UTR-3UTR |
| ENST00000265713 | 41800310 | 41800518 | Frame-shift |
| ENST00000396930 | 41800310 | 41800518 | Frame-shift |
| ENST00000265713 | 41812813 | 41812929 | Frame-shift |
| ENST00000396930 | 41812813 | 41812929 | Frame-shift |
| ENST00000265713 | 41844972 | 41845081 | Frame-shift |
| ENST00000396930 | 41844972 | 41845081 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for KAT6A |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for KAT6A |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KIRC | TCGA-BP-5168-01 | exon_skip_489456 | 41800311 | 41800518 | 41800349 | 41800382 | Frame_Shift_Del | CGTTTTCTCCTTCCTCAGCCTCCTCTTCTTCCTC | - | p.789_800del |
| KIRC | TCGA-BP-5168-01 | exon_skip_489456 | 41800311 | 41800518 | 41800349 | 41800382 | Frame_Shift_Del | CGTTTTCTCCTTCCTCAGCCTCCTCTTCTTCCTC | - | p.EEEEEAEEGENE789fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_489456 | 41800311 | 41800518 | 41800351 | 41800351 | Frame_Shift_Del | T | - | p.N799fs |
| UCEC | TCGA-AP-A0LH-01 | exon_skip_489459 | 41844973 | 41845081 | 41845005 | 41845006 | Frame_Shift_Ins | - | C | p.E226fs |
| BLCA | TCGA-ZF-AA51-01 | exon_skip_489456 | 41800311 | 41800518 | 41800466 | 41800466 | Nonsense_Mutation | G | A | p.Q761* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 41800311 | 41800518 | 41800455 | 41800456 | Frame_Shift_Del | CA | - | p.L764fs |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 41800311 | 41800518 | 41800458 | 41800459 | Frame_Shift_Ins | - | GG | p.N763fs |
| SNUC1_LARGE_INTESTINE | 41800311 | 41800518 | 41800488 | 41800488 | Missense_Mutation | G | C | p.I753M |
| CW2_LARGE_INTESTINE | 41812814 | 41812929 | 41812842 | 41812842 | Missense_Mutation | A | G | p.S524P |
| SUPT11_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 41812814 | 41812929 | 41812883 | 41812883 | Missense_Mutation | G | C | p.S510C |
| NCIH661_LUNG | 41844973 | 41845081 | 41845039 | 41845039 | Missense_Mutation | T | C | p.T215A |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for KAT6A |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KAT6A |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for KAT6A |
Top |
RelatedDrugs for KAT6A |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for KAT6A |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| KAT6A | C0010606 | Adenoid Cystic Carcinoma | 1 | CTD_human |
| KAT6A | C0025149 | Medulloblastoma | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|