|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for PEAK1 |
 Gene summary |
| Gene information | Gene symbol | PEAK1 | Gene ID | 79834 |
| Gene name | pseudopodium enriched atypical kinase 1 | |
| Synonyms | SGK269 | |
| Cytomap | 15q24.3 | |
| Type of gene | protein-coding | |
| Description | pseudopodium-enriched atypical kinase 1NKF3 kinase family membersugen kinase 269tyrosine-protein kinase SgK269 | |
| Modification date | 20180523 | |
| UniProtAcc | Q9H792 | |
| Context | PubMed: PEAK1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| PEAK1 | GO:0016477 | cell migration | 20534451 |
| PEAK1 | GO:0034446 | substrate adhesion-dependent cell spreading | 20534451 |
| PEAK1 | GO:0046777 | protein autophosphorylation | 20534451 |
| PEAK1 | GO:0051893 | regulation of focal adhesion assembly | 23105102 |
Top |
Exon skipping events across known transcript of Ensembl for PEAK1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for PEAK1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for PEAK1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_129842 | 15 | 77400499:77407661:77425346:77426092:77450844:77451038 | 77425346:77426092 | ENSG00000173517.6 | ENST00000312493.4,ENST00000560626.2 |
| exon_skip_129843 | 15 | 77425346:77426092:77450844:77451038:77471131:77471489 | 77450844:77451038 | ENSG00000173517.6 | ENST00000312493.4,ENST00000560626.2 |
| exon_skip_129844 | 15 | 77450844:77451038:77471131:77474382:77544708:77544868 | 77471131:77474382 | ENSG00000173517.6 | ENST00000560626.2 |
| exon_skip_129849 | 15 | 77474320:77474382:77544708:77544868:77578764:77578846 | 77544708:77544868 | ENSG00000173517.6 | ENST00000558305.1 |
| exon_skip_129857 | 15 | 77544840:77544868:77576224:77576372:77577299:77577397 | 77576224:77576372 | ENSG00000173517.6 | ENST00000569819.1,ENST00000567337.1,ENST00000569159.1 |
| exon_skip_129859 | 15 | 77544840:77544868:77577299:77577420:77578764:77578846 | 77577299:77577420 | ENSG00000173517.6 | ENST00000567808.1 |
| exon_skip_129861 | 15 | 77544708:77544868:77578764:77578846:77657504:77657567 | 77578764:77578846 | ENSG00000173517.6 | ENST00000558305.1 |
| exon_skip_129875 | 15 | 77578764:77578846:77657504:77657567:77712347:77712436 | 77657504:77657567 | ENSG00000173517.6 | ENST00000558305.1,ENST00000564328.1,ENST00000569159.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for PEAK1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_129842 | 15 | 77400499:77407661:77425346:77426092:77450844:77451038 | 77425346:77426092 | ENSG00000173517.6 | ENST00000312493.4,ENST00000560626.2 |
| exon_skip_129843 | 15 | 77425346:77426092:77450844:77451038:77471131:77471489 | 77450844:77451038 | ENSG00000173517.6 | ENST00000312493.4,ENST00000560626.2 |
| exon_skip_129844 | 15 | 77450844:77451038:77471131:77474382:77544708:77544868 | 77471131:77474382 | ENSG00000173517.6 | ENST00000560626.2 |
| exon_skip_129849 | 15 | 77474320:77474382:77544708:77544868:77578764:77578846 | 77544708:77544868 | ENSG00000173517.6 | ENST00000558305.1 |
| exon_skip_129857 | 15 | 77544840:77544868:77576224:77576372:77577299:77577397 | 77576224:77576372 | ENSG00000173517.6 | ENST00000567337.1,ENST00000569819.1,ENST00000569159.1 |
| exon_skip_129859 | 15 | 77544840:77544868:77577299:77577420:77578764:77578846 | 77577299:77577420 | ENSG00000173517.6 | ENST00000567808.1 |
| exon_skip_129861 | 15 | 77544708:77544868:77578764:77578846:77657504:77657567 | 77578764:77578846 | ENSG00000173517.6 | ENST00000558305.1 |
| exon_skip_129875 | 15 | 77578764:77578846:77657504:77657567:77712347:77712436 | 77657504:77657567 | ENSG00000173517.6 | ENST00000558305.1,ENST00000564328.1,ENST00000569159.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for PEAK1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000560626 | 77471131 | 77474382 | 3UTR-3CDS |
| ENST00000312493 | 77425346 | 77426092 | Frame-shift |
| ENST00000560626 | 77425346 | 77426092 | Frame-shift |
| ENST00000312493 | 77450844 | 77451038 | Frame-shift |
| ENST00000560626 | 77450844 | 77451038 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000560626 | 77471131 | 77474382 | 3UTR-3CDS |
| ENST00000312493 | 77425346 | 77426092 | Frame-shift |
| ENST00000560626 | 77425346 | 77426092 | Frame-shift |
| ENST00000312493 | 77450844 | 77451038 | Frame-shift |
| ENST00000560626 | 77450844 | 77451038 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for PEAK1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for PEAK1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
PEAK1_COAD_exon_skip_129842_psi_boxplot.png |
PEAK1_PAAD_exon_skip_129842_psi_boxplot.png |
PEAK1_STAD_exon_skip_129842_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| COAD | TCGA-A6-6780-01 | exon_skip_129842 | 77425347 | 77426092 | 77425467 | 77425467 | Frame_Shift_Del | A | - | p.G1320fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_129842 | 77425347 | 77426092 | 77425820 | 77425820 | Frame_Shift_Del | A | - | p.S1202fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_129842 | 77425347 | 77426092 | 77425841 | 77425841 | Frame_Shift_Del | C | - | p.D1195fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_129842 | 77425347 | 77426092 | 77425902 | 77425902 | Frame_Shift_Del | T | - | p.K1174fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_129842 | 77425347 | 77426092 | 77425963 | 77425963 | Frame_Shift_Del | G | - | p.P1154fs |
| CHOL | TCGA-W5-AA39-01 | exon_skip_129843 | 77450845 | 77451038 | 77450866 | 77450885 | Frame_Shift_Del | TACAAGGGTTCGGGTCCATA | - | p.1098_1104del |
| CHOL | TCGA-W5-AA39-01 | exon_skip_129843 | 77450845 | 77451038 | 77450866 | 77450885 | Frame_Shift_Del | TACAAGGGTTCGGGTCCATA | - | p.PMDPNPCS1097fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_129843 | 77450845 | 77451038 | 77450976 | 77450976 | Frame_Shift_Del | T | - | p.K1067fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_129844 | 77471132 | 77474382 | 77471293 | 77471293 | Frame_Shift_Del | C | - | p.R992fs |
| KIRC | TCGA-B0-5711-01 | exon_skip_129844 | 77471132 | 77474382 | 77471481 | 77471481 | Frame_Shift_Del | T | - | p.S930fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_129844 | 77471132 | 77474382 | 77471654 | 77471654 | Frame_Shift_Del | G | - | p.P873fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_129844 | 77471132 | 77474382 | 77472174 | 77472174 | Frame_Shift_Del | T | - | p.R699fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_129844 | 77471132 | 77474382 | 77472298 | 77472298 | Frame_Shift_Del | G | - | p.T658fs |
| SKCM | TCGA-RP-A690-06 | exon_skip_129844 | 77471132 | 77474382 | 77472300 | 77472300 | Frame_Shift_Del | T | - | p.T657fs |
| SKCM | TCGA-RP-A690-06 | exon_skip_129844 | 77471132 | 77474382 | 77472300 | 77472300 | Frame_Shift_Del | T | - | p.T658fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_129844 | 77471132 | 77474382 | 77472525 | 77472525 | Frame_Shift_Del | T | - | p.T582fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_129844 | 77471132 | 77474382 | 77472771 | 77472771 | Frame_Shift_Del | T | - | p.S503fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_129844 | 77471132 | 77474382 | 77473383 | 77473383 | Frame_Shift_Del | G | - | p.L296fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_129844 | 77471132 | 77474382 | 77473399 | 77473399 | Frame_Shift_Del | T | - | p.K290fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_129844 | 77471132 | 77474382 | 77474065 | 77474065 | Frame_Shift_Del | T | - | p.K68fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_129844 | 77471132 | 77474382 | 77474065 | 77474065 | Frame_Shift_Del | T | - | p.K68fs |
| STAD | TCGA-CD-A4MG-01 | exon_skip_129844 | 77471132 | 77474382 | 77474065 | 77474065 | Frame_Shift_Del | T | - | p.P69fs |
| STAD | TCGA-IN-8663-01 | exon_skip_129842 | 77425347 | 77426092 | 77425646 | 77425647 | Frame_Shift_Ins | - | C | p.P1260fs |
| UCEC | TCGA-D1-A0ZZ-01 | exon_skip_129844 | 77471132 | 77474382 | 77472763 | 77472764 | Frame_Shift_Ins | - | T | p.S502fs |
| PAAD | TCGA-IB-7651-01 | exon_skip_129842 | 77425347 | 77426092 | 77425553 | 77425553 | Nonsense_Mutation | G | A | p.R1291* |
| LIHC | TCGA-DD-A1EA-01 | exon_skip_129842 | 77425347 | 77426092 | 77425574 | 77425574 | Nonsense_Mutation | C | A | p.E1284* |
| LIHC | TCGA-DD-A1EA-01 | exon_skip_129842 | 77425347 | 77426092 | 77425574 | 77425574 | Nonsense_Mutation | C | A | p.E1284X |
| LIHC | TCGA-DD-A1EE-01 | exon_skip_129842 | 77425347 | 77426092 | 77425574 | 77425574 | Nonsense_Mutation | C | A | p.E1284X |
| LUSC | TCGA-66-2780-01 | exon_skip_129842 | 77425347 | 77426092 | 77425619 | 77425619 | Nonsense_Mutation | G | A | p.Q1269* |
| LUAD | TCGA-44-6774-01 | exon_skip_129844 | 77471132 | 77474382 | 77471208 | 77471208 | Nonsense_Mutation | C | A | p.E1021* |
| LUAD | TCGA-75-5126-01 | exon_skip_129844 | 77471132 | 77474382 | 77471964 | 77471964 | Nonsense_Mutation | G | A | p.Q769* |
| LUAD | TCGA-75-5126-01 | exon_skip_129844 | 77471132 | 77474382 | 77472167 | 77472167 | Nonsense_Mutation | G | C | p.S701* |
| HNSC | TCGA-F7-A623-01 | exon_skip_129844 | 77471132 | 77474382 | 77472681 | 77472681 | Nonsense_Mutation | G | A | p.R530* |
| READ | TCGA-F5-6814-01 | exon_skip_129844 | 77471132 | 77474382 | 77472681 | 77472681 | Nonsense_Mutation | G | A | p.R530X |
| LUSC | TCGA-22-4593-01 | exon_skip_129844 | 77471132 | 77474382 | 77472963 | 77472963 | Nonsense_Mutation | C | A | p.E436* |
| STAD | TCGA-F1-6177-01 | exon_skip_129844 | 77471132 | 77474382 | 77473380 | 77473380 | Nonsense_Mutation | G | A | p.R297X |
| HNSC | TCGA-CV-7568-01 | exon_skip_129844 | 77471132 | 77474382 | 77473953 | 77473953 | Nonsense_Mutation | G | A | p.R106* |
| LUSC | TCGA-18-5595-01 | exon_skip_129844 | 77471132 | 77474382 | 77473983 | 77473983 | Nonsense_Mutation | C | A | p.E96* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-IN-8663-01 |
| Cancer type: STAD | |
| ESID: exon_skip_129842 | |
| Skipped exon start: 77425347 | |
| Skipped exon end: 77426092 | |
| Mutation start: 77425646 | |
| Mutation end: 77425647 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: C | |
| AAchange: p.P1260fs | |
exon_skip_129842_STAD_TCGA-IN-8663-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| HEC108_ENDOMETRIUM | 77471132 | 77474382 | 77471654 | 77471654 | Frame_Shift_Del | G | - | p.P873fs |
| RCCFG2_KIDNEY | 77471132 | 77474382 | 77471654 | 77471654 | Frame_Shift_Del | G | - | p.P873fs |
| GP2D_LARGE_INTESTINE | 77471132 | 77474382 | 77473301 | 77473301 | Frame_Shift_Del | T | - | p.N323fs |
| HEC151_ENDOMETRIUM | 77471132 | 77474382 | 77474065 | 77474065 | Frame_Shift_Del | T | - | p.K68fs |
| HEL9217_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473398 | 77473399 | Frame_Shift_Ins | - | T | p.W291fs |
| LS180_LARGE_INTESTINE | 77471132 | 77474382 | 77471473 | 77471475 | In_Frame_Del | GAA | - | p.F932del |
| PANC0813_PANCREAS | 77471132 | 77474382 | 77472047 | 77472049 | In_Frame_Del | GGC | - | p.740_741EP>D |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 77425347 | 77426092 | 77425363 | 77425363 | Missense_Mutation | T | C | p.N1354S |
| CCRFCEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77425347 | 77426092 | 77425402 | 77425402 | Missense_Mutation | G | A | p.A1341V |
| HEC1B_ENDOMETRIUM | 77425347 | 77426092 | 77425402 | 77425402 | Missense_Mutation | G | A | p.A1341V |
| MDAPCA2B_PROSTATE | 77425347 | 77426092 | 77425405 | 77425405 | Missense_Mutation | T | C | p.D1340G |
| HEC265_ENDOMETRIUM | 77425347 | 77426092 | 77425431 | 77425431 | Missense_Mutation | A | T | p.S1331R |
| SNUC5_LARGE_INTESTINE | 77425347 | 77426092 | 77425459 | 77425459 | Missense_Mutation | T | C | p.D1322G |
| BB30PBL_MATCHED_NORMAL_TISSUE | 77425347 | 77426092 | 77425489 | 77425489 | Missense_Mutation | C | T | p.G1312E |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77425347 | 77426092 | 77425556 | 77425556 | Missense_Mutation | T | G | p.I1290L |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77425347 | 77426092 | 77425581 | 77425581 | Missense_Mutation | C | G | p.E1281D |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 77425347 | 77426092 | 77425581 | 77425581 | Missense_Mutation | C | G | p.E1281D |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77425347 | 77426092 | 77425673 | 77425673 | Missense_Mutation | T | C | p.M1251V |
| HEC251_ENDOMETRIUM | 77425347 | 77426092 | 77425709 | 77425709 | Missense_Mutation | T | C | p.T1239A |
| NCIH322_LUNG | 77425347 | 77426092 | 77425742 | 77425742 | Missense_Mutation | C | T | p.V1228I |
| SNU81_LARGE_INTESTINE | 77425347 | 77426092 | 77425831 | 77425831 | Missense_Mutation | C | T | p.S1198N |
| PCI4B_UPPER_AERODIGESTIVE_TRACT | 77425347 | 77426092 | 77425949 | 77425949 | Missense_Mutation | T | A | p.M1159L |
| NB6_AUTONOMIC_GANGLIA | 77425347 | 77426092 | 77425973 | 77425973 | Missense_Mutation | T | G | p.T1151P |
| JHU011_UPPER_AERODIGESTIVE_TRACT | 77425347 | 77426092 | 77425994 | 77425994 | Missense_Mutation | C | A | p.A1144S |
| OACM51_OESOPHAGUS | 77425347 | 77426092 | 77426003 | 77426003 | Missense_Mutation | C | T | p.D1141N |
| CW2_LARGE_INTESTINE | 77425347 | 77426092 | 77426068 | 77426068 | Missense_Mutation | G | T | p.P1119H |
| COLO783_SKIN | 77450845 | 77451038 | 77450892 | 77450892 | Missense_Mutation | G | A | p.S1095L |
| CORL105_LUNG | 77450845 | 77451038 | 77450952 | 77450953 | Missense_Mutation | GA | TT | p.S1075K |
| CORL105_LUNG | 77450845 | 77451038 | 77450953 | 77450953 | Missense_Mutation | A | T | p.S1075T |
| KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77450845 | 77451038 | 77451001 | 77451001 | Missense_Mutation | G | A | p.R1059W |
| CP66MEL_SKIN | 77471132 | 77474382 | 77471165 | 77471165 | Missense_Mutation | G | A | p.S1035F |
| SW900_LUNG | 77471132 | 77474382 | 77471291 | 77471291 | Missense_Mutation | C | A | p.C993F |
| SNU1040_LARGE_INTESTINE | 77471132 | 77474382 | 77471297 | 77471297 | Missense_Mutation | T | C | p.Y991C |
| CCK81_LARGE_INTESTINE | 77471132 | 77474382 | 77471400 | 77471400 | Missense_Mutation | C | A | p.G957C |
| SISO_CERVIX | 77471132 | 77474382 | 77471408 | 77471408 | Missense_Mutation | C | T | p.G954D |
| GRST_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471408 | 77471408 | Missense_Mutation | C | T | p.G954D |
| HUH28_BILIARY_TRACT | 77471132 | 77474382 | 77471445 | 77471445 | Missense_Mutation | C | T | p.D942N |
| HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471472 | 77471472 | Missense_Mutation | G | A | p.R933C |
| SW1990_PANCREAS | 77471132 | 77474382 | 77471499 | 77471499 | Missense_Mutation | G | A | p.R924C |
| GP2D_LARGE_INTESTINE | 77471132 | 77474382 | 77471514 | 77471514 | Missense_Mutation | C | G | p.D919H |
| GP5D_LARGE_INTESTINE | 77471132 | 77474382 | 77471514 | 77471514 | Missense_Mutation | C | G | p.D919H |
| NCC021_KIDNEY | 77471132 | 77474382 | 77471546 | 77471546 | Missense_Mutation | A | G | p.V908A |
| A549_LUNG | 77471132 | 77474382 | 77471669 | 77471669 | Missense_Mutation | G | T | p.P867Q |
| MDAMB361_BREAST | 77471132 | 77474382 | 77471706 | 77471706 | Missense_Mutation | G | A | p.P855S |
| SKGT4_OESOPHAGUS | 77471132 | 77474382 | 77471787 | 77471787 | Missense_Mutation | C | T | p.E828K |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471822 | 77471822 | Missense_Mutation | C | A | p.R816L |
| HT115_LARGE_INTESTINE | 77471132 | 77474382 | 77471831 | 77471831 | Missense_Mutation | G | A | p.T813M |
| HUH28_BILIARY_TRACT | 77471132 | 77474382 | 77471925 | 77471925 | Missense_Mutation | C | T | p.E782K |
| HUH1_LIVER | 77471132 | 77474382 | 77472158 | 77472158 | Missense_Mutation | T | C | p.Q704R |
| MV411_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77472158 | 77472158 | Missense_Mutation | T | C | p.Q704R |
| RCC10RGB_KIDNEY | 77471132 | 77474382 | 77472158 | 77472158 | Missense_Mutation | T | C | p.Q704R |
| MFE319_ENDOMETRIUM | 77471132 | 77474382 | 77472314 | 77472314 | Missense_Mutation | G | A | p.S652L |
| LB831BLC_URINARY_TRACT | 77471132 | 77474382 | 77472436 | 77472436 | Missense_Mutation | A | T | p.H611Q |
| 639V_URINARY_TRACT | 77471132 | 77474382 | 77472462 | 77472462 | Missense_Mutation | T | A | p.M603L |
| GP2D_LARGE_INTESTINE | 77471132 | 77474382 | 77472473 | 77472473 | Missense_Mutation | T | C | p.N599S |
| GP5D_LARGE_INTESTINE | 77471132 | 77474382 | 77472473 | 77472473 | Missense_Mutation | T | C | p.N599S |
| CW2_LARGE_INTESTINE | 77471132 | 77474382 | 77472507 | 77472507 | Missense_Mutation | G | A | p.P588S |
| MEWO_SKIN | 77471132 | 77474382 | 77472588 | 77472588 | Missense_Mutation | G | A | p.P561S |
| NCIH1568_LUNG | 77471132 | 77474382 | 77472656 | 77472656 | Missense_Mutation | C | A | p.S538I |
| RERFLCAD2_LUNG | 77471132 | 77474382 | 77472694 | 77472694 | Missense_Mutation | T | G | p.K525N |
| NCIH2286_LUNG | 77471132 | 77474382 | 77472762 | 77472762 | Missense_Mutation | A | G | p.S503P |
| RERFLCAD2_LUNG | 77471132 | 77474382 | 77472881 | 77472881 | Missense_Mutation | C | T | p.R463Q |
| KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77472944 | 77472944 | Missense_Mutation | T | C | p.D442G |
| HUH28_BILIARY_TRACT | 77471132 | 77474382 | 77473119 | 77473119 | Missense_Mutation | C | T | p.E384K |
| DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473295 | 77473295 | Missense_Mutation | A | C | p.V325G |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 77471132 | 77474382 | 77473295 | 77473295 | Missense_Mutation | A | C | p.V325G |
| HS274T_BREAST | 77471132 | 77474382 | 77473337 | 77473337 | Missense_Mutation | T | C | p.D311G |
| RT112_URINARY_TRACT | 77471132 | 77474382 | 77473361 | 77473361 | Missense_Mutation | C | G | p.R303T |
| RT11284_URINARY_TRACT | 77471132 | 77474382 | 77473361 | 77473361 | Missense_Mutation | C | G | p.R303T |
| HEC251_ENDOMETRIUM | 77471132 | 77474382 | 77473398 | 77473398 | Missense_Mutation | A | G | p.W291R |
| CORL88_LUNG | 77471132 | 77474382 | 77473425 | 77473425 | Missense_Mutation | G | T | p.P282T |
| CW2_LARGE_INTESTINE | 77471132 | 77474382 | 77473434 | 77473434 | Missense_Mutation | T | C | p.T279A |
| MYM12_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473446 | 77473446 | Missense_Mutation | A | G | p.F275L |
| MERO95_LUNG | 77471132 | 77474382 | 77473458 | 77473458 | Missense_Mutation | G | A | p.R271C |
| MFE296_ENDOMETRIUM | 77471132 | 77474382 | 77473493 | 77473493 | Missense_Mutation | A | G | p.L259P |
| SNU738_CENTRAL_NERVOUS_SYSTEM | 77471132 | 77474382 | 77473503 | 77473503 | Missense_Mutation | C | T | p.D256N |
| KE39_STOMACH | 77471132 | 77474382 | 77473538 | 77473538 | Missense_Mutation | T | C | p.N244S |
| KM12_LARGE_INTESTINE | 77471132 | 77474382 | 77473655 | 77473655 | Missense_Mutation | T | C | p.Q205R |
| 639V_URINARY_TRACT | 77471132 | 77474382 | 77473655 | 77473655 | Missense_Mutation | T | C | p.Q205R |
| KNS62_LUNG | 77471132 | 77474382 | 77473670 | 77473670 | Missense_Mutation | C | A | p.G200V |
| NCIH2110_LUNG | 77471132 | 77474382 | 77473712 | 77473712 | Missense_Mutation | C | G | p.R186P |
| KU1919_URINARY_TRACT | 77471132 | 77474382 | 77473718 | 77473718 | Missense_Mutation | T | C | p.Y184C |
| SNU869_BILIARY_TRACT | 77471132 | 77474382 | 77473781 | 77473781 | Missense_Mutation | G | T | p.P163H |
| GP2D_LARGE_INTESTINE | 77471132 | 77474382 | 77473784 | 77473784 | Missense_Mutation | G | A | p.A162V |
| GP5D_LARGE_INTESTINE | 77471132 | 77474382 | 77473784 | 77473784 | Missense_Mutation | G | A | p.A162V |
| LS411N_LARGE_INTESTINE | 77471132 | 77474382 | 77473799 | 77473799 | Missense_Mutation | G | A | p.A157V |
| HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473805 | 77473805 | Missense_Mutation | T | C | p.E155G |
| SJSA1_BONE | 77471132 | 77474382 | 77473917 | 77473917 | Missense_Mutation | T | C | p.N118D |
| TALL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473995 | 77473995 | Missense_Mutation | G | C | p.Q92E |
| HUH6_LIVER | 77471132 | 77474382 | 77474057 | 77474057 | Missense_Mutation | A | G | p.I71T |
| HUH6CLONE5_LIVER | 77471132 | 77474382 | 77474057 | 77474057 | Missense_Mutation | A | G | p.I71T |
| COLO668_LUNG | 77425347 | 77426092 | 77426054 | 77426054 | Nonsense_Mutation | G | A | p.R1124* |
| CORL105_LUNG | 77450845 | 77451038 | 77450952 | 77450952 | Nonsense_Mutation | G | T | p.S1075* |
| CTV1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471193 | 77471193 | Nonsense_Mutation | G | A | p.Q1026* |
| SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471463 | 77471463 | Nonsense_Mutation | T | A | p.K936* |
| KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77471799 | 77471799 | Nonsense_Mutation | G | A | p.Q824* |
| TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473362 | 77473362 | Nonsense_Mutation | T | A | p.R303* |
| KM12_LARGE_INTESTINE | 77471132 | 77474382 | 77473380 | 77473380 | Nonsense_Mutation | G | A | p.R297* |
| HEC251_ENDOMETRIUM | 77471132 | 77474382 | 77473419 | 77473419 | Nonsense_Mutation | G | A | p.R284* |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 77471132 | 77474382 | 77473713 | 77473713 | Nonsense_Mutation | G | A | p.R186* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PEAK1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PEAK1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PEAK1 |
Top |
RelatedDrugs for PEAK1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for PEAK1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|