|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for CACNB1 |
 Gene summary |
| Gene information | Gene symbol | CACNB1 | Gene ID | 782 |
| Gene name | calcium voltage-gated channel auxiliary subunit beta 1 | |
| Synonyms | CAB1|CACNLB1|CCHLB1 | |
| Cytomap | 17q12 | |
| Type of gene | protein-coding | |
| Description | voltage-dependent L-type calcium channel subunit beta-1calcium channel voltage-dependent subunit beta 1calcium channel, L type, beta 1 polypeptidecalcium channel, voltage-dependent, beta 1 subunitdihydropyridine-sensitive L-type, calcium channel beta- | |
| Modification date | 20180523 | |
| UniProtAcc | Q02641 | |
| Context | PubMed: CACNB1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for CACNB1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for CACNB1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for CACNB1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_288799 | 17 | 37333669:37333788:37334236:37334332:37339965:37340117 | 37334236:37334332 | ENSG00000067191.11 | ENST00000394310.3,ENST00000344140.5,ENST00000539338.2,ENST00000394303.3 |
| exon_skip_288804 | 17 | 37340577:37340636:37341036:37341117:37342748:37342825 | 37341036:37341117 | ENSG00000067191.11 | ENST00000577582.1 |
| exon_skip_288810 | 17 | 37341036:37341117:37341383:37341403:37342748:37342825 | 37341383:37341403 | ENSG00000067191.11 | ENST00000394310.3,ENST00000539338.2,ENST00000394303.3 |
| exon_skip_288811 | 17 | 37341036:37341117:37342202:37342357:37342748:37342825 | 37342202:37342357 | ENSG00000067191.11 | ENST00000344140.5 |
| exon_skip_288813 | 17 | 37342794:37342825:37343045:37343182:37343731:37343854 | 37343045:37343182 | ENSG00000067191.11 | ENST00000394310.3,ENST00000536613.2,ENST00000344140.5,ENST00000539338.2,ENST00000394303.3,ENST00000492737.1,ENST00000582877.1 |
| exon_skip_288823 | 17 | 37348276:37348347:37349900:37350050:37351136:37351223 | 37349900:37350050 | ENSG00000067191.11 | ENST00000577926.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for CACNB1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_288799 | 17 | 37333669:37333788:37334236:37334332:37339965:37340117 | 37334236:37334332 | ENSG00000067191.11 | ENST00000394303.3,ENST00000539338.2,ENST00000394310.3,ENST00000344140.5 |
| exon_skip_288804 | 17 | 37340577:37340636:37341036:37341117:37342748:37342825 | 37341036:37341117 | ENSG00000067191.11 | ENST00000577582.1 |
| exon_skip_288810 | 17 | 37341036:37341117:37341383:37341403:37342748:37342825 | 37341383:37341403 | ENSG00000067191.11 | ENST00000394303.3,ENST00000539338.2,ENST00000394310.3 |
| exon_skip_288811 | 17 | 37341036:37341117:37342202:37342357:37342748:37342825 | 37342202:37342357 | ENSG00000067191.11 | ENST00000344140.5 |
| exon_skip_288813 | 17 | 37342794:37342825:37343045:37343182:37343731:37343854 | 37343045:37343182 | ENSG00000067191.11 | ENST00000394303.3,ENST00000539338.2,ENST00000394310.3,ENST00000344140.5,ENST00000536613.2,ENST00000492737.1,ENST00000582877.1 |
| exon_skip_288823 | 17 | 37348276:37348347:37349900:37350050:37351136:37351223 | 37349900:37350050 | ENSG00000067191.11 | ENST00000577926.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for CACNB1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394303 | 37341383 | 37341403 | Frame-shift |
| ENST00000394303 | 37343045 | 37343182 | Frame-shift |
| ENST00000394303 | 37334236 | 37334332 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000394303 | 37341383 | 37341403 | Frame-shift |
| ENST00000394303 | 37343045 | 37343182 | Frame-shift |
| ENST00000394303 | 37334236 | 37334332 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for CACNB1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000394303 | 3759 | 598 | 37334236 | 37334332 | 1259 | 1354 | 350 | 382 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000394303 | 3759 | 598 | 37334236 | 37334332 | 1259 | 1354 | 350 | 382 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q02641 | 350 | 382 | 1 | 598 | Chain | ID=PRO_0000144046;Note=Voltage-dependent L-type calcium channel subunit beta-1 |
| Q02641 | 350 | 382 | 381 | 381 | Sequence conflict | Note=P->H;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q02641 | 350 | 382 | 1 | 598 | Chain | ID=PRO_0000144046;Note=Voltage-dependent L-type calcium channel subunit beta-1 |
| Q02641 | 350 | 382 | 381 | 381 | Sequence conflict | Note=P->H;Ontology_term=ECO:0000305;evidence=ECO:0000305 |
Top |
SNVs in the skipped exons for CACNB1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_288804 | 37341037 | 37341117 | 37341059 | 37341059 | Frame_Shift_Del | C | - | p.G236fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_288804 | 37341037 | 37341117 | 37341100 | 37341100 | Frame_Shift_Del | G | - | p.P222fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_288804 | 37341037 | 37341117 | 37341100 | 37341100 | Frame_Shift_Del | G | - | p.P222fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_288811 | 37342203 | 37342357 | 37342261 | 37342261 | Frame_Shift_Del | C | - | p.S242fs |
| KIRP | TCGA-IZ-A6M9-01 | exon_skip_288804 | 37341037 | 37341117 | 37341119 | 37341119 | Splice_Site | T | A | . |
| KIRP | TCGA-IZ-A6M9-01 | exon_skip_288804 | 37341037 | 37341117 | 37341119 | 37341119 | Splice_Site | T | A | p.T217_splice |
| UCS | TCGA-N7-A4Y0-01 | exon_skip_288804 | 37341037 | 37341117 | 37341119 | 37341120 | Splice_Site | - | G | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| 786O_KIDNEY | 37334237 | 37334332 | 37334246 | 37334266 | In_Frame_Del | CTGTGCCAGCTTTTCCGAGGC | - | p.ASEKLAQ373del |
| SW1116_LARGE_INTESTINE | 37341037 | 37341117 | 37341105 | 37341105 | Missense_Mutation | G | A | p.P221S |
| CA922_UPPER_AERODIGESTIVE_TRACT | 37341037 | 37341117 | 37341109 | 37341109 | Missense_Mutation | A | T | p.H219Q |
| MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 37341037 | 37341117 | 37341111 | 37341111 | Missense_Mutation | G | T | p.H219N |
| SNU175_LARGE_INTESTINE | 37343046 | 37343182 | 37343151 | 37343151 | Missense_Mutation | A | G | p.L149P |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for CACNB1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CACNB1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CACNB1 |
Top |
RelatedDrugs for CACNB1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| Q02641 | DB00308 | Ibutilide | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved | |
| Q02641 | DB00381 | Amlodipine | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved | |
| Q02641 | DB00661 | Verapamil | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved | |
| Q02641 | DB00898 | Ethanol | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved | |
| Q02641 | DB04855 | Dronedarone | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved | |
| Q02641 | DB00393 | Nimodipine | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved|investigational | |
| Q02641 | DB00653 | Magnesium sulfate | Voltage-dependent L-type calcium channel subunit beta-1 | small molecule | approved|investigational|vet_approved |
Top |
RelatedDiseases for CACNB1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|