ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for MAP2K4

Gene summary

Gene information	Gene symbol	MAP2K4
	Gene ID	6416
	Gene name	mitogen-activated protein kinase kinase 4
	Synonyms	JNKK\|JNKK1\|MAPKK4\|MEK4\|MKK4\|PRKMK4\|SAPKK-1\|SAPKK1\|SEK1\|SERK1\|SKK1
	Cytomap	17p12
	Type of gene	protein-coding
	Description	dual specificity mitogen-activated protein kinase kinase 4JNK-activated kinase 1JNK-activating kinase 1MAP kinase kinase 4MAPK/ERK kinase 4MAPKK 4MEK 4SAPK/ERK kinase 1c-Jun N-terminal kinase kinase 1stress-activated protein kinase kinase 1
	Modification date	20180523
	UniProtAcc	P45985
	Context	PubMed: MAP2K4 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for MAP2K4 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for MAP2K4

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for MAP2K4

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_149185	17	11924292:11924318:11935582:11935615:11958205:11958308	11935582:11935615	ENSG00000065559.10	ENST00000415385.3
exon_skip_149187	17	11924292:11924318:11958205:11958308:11998891:11999011	11958205:11958308	ENSG00000065559.10	ENST00000602375.1
exon_skip_149189	17	11924292:11924318:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000602686.1,ENST00000602811.1,ENST00000602537.1
exon_skip_149192	17	11924292:11924318:11998891:11999011:12013691:12013743	11998891:11999011	ENSG00000065559.10	ENST00000538465.3
exon_skip_149196	17	11958205:11958308:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000582897.1
exon_skip_149200	17	11958205:11958308:11998891:11999011:12011106:12011226	11998891:11999011	ENSG00000065559.10	ENST00000602375.1
exon_skip_149202	17	11973072:11973166:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000581941.1
exon_skip_149205	17	11984672:11984847:11998891:11999011:12011106:12011226	11998891:11999011	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000602811.1,ENST00000581941.1,ENST00000602537.1
exon_skip_149207	17	11998918:11999011:12011106:12011226:12013691:12013743	12011106:12011226	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000602375.1,ENST00000582377.1,ENST00000602811.1,ENST00000582183.1,ENST00000579089.1,ENST00000602305.1,ENST00000581941.1,ENST00000602537.1
exon_skip_149210	17	12028610:12028688:12032455:12032604:12043155:12043201	12032455:12032604	ENSG00000065559.10	ENST00000353533.5,ENST00000602686.1,ENST00000415385.3,ENST00000602375.1,ENST00000602811.1,ENST00000536413.2,ENST00000602305.1

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for MAP2K4

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_149185	17	11924292:11924318:11935582:11935615:11958205:11958308	11935582:11935615	ENSG00000065559.10	ENST00000415385.3
exon_skip_149187	17	11924292:11924318:11958205:11958308:11998891:11999011	11958205:11958308	ENSG00000065559.10	ENST00000602375.1
exon_skip_149189	17	11924292:11924318:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000602811.1,ENST00000602686.1,ENST00000602537.1
exon_skip_149192	17	11924292:11924318:11998891:11999011:12013691:12013743	11998891:11999011	ENSG00000065559.10	ENST00000538465.3
exon_skip_149196	17	11958205:11958308:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000582897.1
exon_skip_149200	17	11958205:11958308:11998891:11999011:12011106:12011226	11998891:11999011	ENSG00000065559.10	ENST00000602375.1
exon_skip_149202	17	11973072:11973166:11984672:11984847:11998891:11999011	11984672:11984847	ENSG00000065559.10	ENST00000581941.1
exon_skip_149205	17	11984672:11984847:11998891:11999011:12011106:12011226	11998891:11999011	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000602811.1,ENST00000602537.1,ENST00000581941.1
exon_skip_149207	17	11998918:11999011:12011106:12011226:12013691:12013743	12011106:12011226	ENSG00000065559.10	ENST00000353533.5,ENST00000582183.1,ENST00000415385.3,ENST00000602811.1,ENST00000602375.1,ENST00000602305.1,ENST00000602537.1,ENST00000581941.1,ENST00000579089.1,ENST00000582377.1
exon_skip_149210	17	12028610:12028688:12032455:12032604:12043155:12043201	12032455:12032604	ENSG00000065559.10	ENST00000353533.5,ENST00000415385.3,ENST00000602811.1,ENST00000602375.1,ENST00000602305.1,ENST00000602686.1,ENST00000536413.2

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for MAP2K4

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000353533	11984672	11984847	Frame-shift
ENST00000353533	12032455	12032604	Frame-shift
ENST00000353533	11998891	11999011	In-frame
ENST00000353533	12011106	12011226	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000353533	11984672	11984847	Frame-shift
ENST00000353533	12032455	12032604	Frame-shift
ENST00000353533	11998891	11999011	In-frame
ENST00000353533	12011106	12011226	In-frame

Top

Infer the effects of exon skipping event on protein functional features for MAP2K4

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000353533	3843	399	11998891	11999011	457	576	131	171
ENST00000353533	3843	399	12011106	12011226	577	696	171	211

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000353533	3843	399	11998891	11999011	457	576	131	171
ENST00000353533	3843	399	12011106	12011226	577	696	171	211

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P45985	131	171	127	134	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	164	169	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	171	178	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	131	131	Binding site	Note=ATP;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	131	171	2	399	Chain	ID=PRO_0000086381;Note=Dual specificity mitogen-activated protein kinase kinase 4
P45985	131	171	102	367	Domain	Note=Protein kinase;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	131	171	139	153	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	142	142	Natural variant	ID=VAR_040818;Note=In a lung squamous cell carcinoma sample%3B somatic mutation. Q->L;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17344846;Dbxref=PMID:17344846
P45985	131	171	154	154	Natural variant	ID=VAR_040819;Note=In a colorectal adenocarcinoma sample%3B somatic mutation. R->W;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17344846;Dbxref=PMID:17344846
P45985	171	211	171	178	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	182	184	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	2	399	Chain	ID=PRO_0000086381;Note=Dual specificity mitogen-activated protein kinase kinase 4
P45985	171	211	102	367	Domain	Note=Protein kinase;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	171	211	185	194	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	202	223	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	179	179	Sequence conflict	Note=E->G;Ontology_term=ECO:0000305;evidence=ECO:0000305

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P45985	131	171	127	134	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	164	169	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	171	178	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	131	131	Binding site	Note=ATP;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	131	171	2	399	Chain	ID=PRO_0000086381;Note=Dual specificity mitogen-activated protein kinase kinase 4
P45985	131	171	102	367	Domain	Note=Protein kinase;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	131	171	139	153	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	131	171	142	142	Natural variant	ID=VAR_040818;Note=In a lung squamous cell carcinoma sample%3B somatic mutation. Q->L;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17344846;Dbxref=PMID:17344846
P45985	131	171	154	154	Natural variant	ID=VAR_040819;Note=In a colorectal adenocarcinoma sample%3B somatic mutation. R->W;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17344846;Dbxref=PMID:17344846
P45985	171	211	171	178	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	182	184	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	2	399	Chain	ID=PRO_0000086381;Note=Dual specificity mitogen-activated protein kinase kinase 4
P45985	171	211	102	367	Domain	Note=Protein kinase;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00159
P45985	171	211	185	194	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	202	223	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3ALN
P45985	171	211	179	179	Sequence conflict	Note=E->G;Ontology_term=ECO:0000305;evidence=ECO:0000305

Top

SNVs in the skipped exons for MAP2K4

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

MAP2K4_COAD_exon_skip_149207_psi_boxplot.png
boxplot

MAP2K4_STAD_exon_skip_149207_psi_boxplot.png
boxplot

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984732	11984732	Frame_Shift_Del	A	-	p.Q104fs
BRCA	TCGA-E2-A156-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984840	11984856	Frame_Shift_Del	CAGTTAAAGTAGGTGAT	-	p.A129fs
LIHC	TCGA-G3-A25V-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998923	11998923	Frame_Shift_Del	A	-	p.Q142fs
LIHC	TCGA-G3-A25V-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998923	11998923	Frame_Shift_Del	A	-	p.Q153fs
STAD	TCGA-HF-7132-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998923	11998923	Frame_Shift_Del	A	-	p.Q142fs
STAD	TCGA-F1-6177-01	exon_skip_149207	12011107	12011226	12011155	12011155	Frame_Shift_Del	T	-	p.F188fs
STAD	TCGA-F1-6177-01	exon_skip_149207	12011107	12011226	12011155	12011155	Frame_Shift_Del	T	-	p.K187fs
UCEC	TCGA-D1-A16N-01	exon_skip_149207	12011107	12011226	12011162	12011184	Frame_Shift_Del	AATATGTATATAGTGTATTAGAT	-	p.K190fs
BRCA	TCGA-A2-A1G0-01	exon_skip_149210	12032456	12032604	12032516	12032517	Frame_Shift_Del	AC	-	p.Q319fs
LIHC	TCGA-DD-A1EG-01	exon_skip_149210	12032456	12032604	12032574	12032574	Frame_Shift_Del	C	-	p.S348fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_149210	12032456	12032604	12032574	12032574	Frame_Shift_Del	C	-	p.S348fs
BRCA	TCGA-E9-A1NI-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984789	11984790	Frame_Shift_Ins	-	T	p.Y113fs
UCS	TCGA-ND-A4WC-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998922	11998923	Frame_Shift_Ins	-	A	p.K153fs
UCS	TCGA-ND-A4WC-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998922	11998923	Frame_Shift_Ins	-	A	p.Q142fs
BRCA	TCGA-AN-A0XR-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998971	11998972	Frame_Shift_Ins	-	C	p.Y160fs
BRCA	TCGA-AO-A03T-01	exon_skip_149207	12011107	12011226	12011108	12011109	Frame_Shift_Ins	-	T	p.D173fs
BRCA	TCGA-AR-A1AU-01	exon_skip_149210	12032456	12032604	12032570	12032571	Frame_Shift_Ins	-	TC	p.S339fs
STAD	TCGA-BR-4362-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984731	11984731	Nonsense_Mutation	C	T	p.Q93*
STAD	TCGA-BR-4362-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984731	11984731	Nonsense_Mutation	C	T	p.Q93X
UCEC	TCGA-BS-A0UJ-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984782	11984782	Nonsense_Mutation	C	T	p.R110*
BRCA	TCGA-A8-A07Z-01	exon_skip_149192 exon_skip_149200 exon_skip_149205	11998892	11999011	11998993	11998993	Nonsense_Mutation	T	A	p.Y165*
COAD	TCGA-CA-6718-01	exon_skip_149207	12011107	12011226	12011200	12011200	Nonsense_Mutation	G	T	p.E203X
BRCA	TCGA-C8-A1HO-01	exon_skip_149207	12011107	12011226	12011212	12011212	Nonsense_Mutation	A	T	p.K207*
BRCA	TCGA-E2-A1IG-01	exon_skip_149210	12032456	12032604	12032459	12032459	Nonsense_Mutation	G	T	p.E299*
BRCA	TCGA-BH-A0W7-01	exon_skip_149210	12032456	12032604	12032510	12032510	Nonsense_Mutation	C	T	p.Q316*
LUAD	TCGA-50-6592-01	exon_skip_149210	12032456	12032604	12032561	12032561	Nonsense_Mutation	G	T	p.E344*
BRCA	TCGA-B6-A0IB-01	exon_skip_149187	11958206	11958308	11958309	11958310	Splice_Site	-	T	e2+1
BRCA	TCGA-AC-A23E-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984671	11984672	Splice_Site	AG	-	e3-1
BRCA	TCGA-E2-A1BC-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984671	11984672	Splice_Site	AG	-	e3-1
STAD	TCGA-HU-8245-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984671	11984671	Splice_Site	A	G	.
STAD	TCGA-HU-8245-01	exon_skip_149196 exon_skip_149189 exon_skip_149202	11984673	11984847	11984671	11984671	Splice_Site	A	G	p.I73_splice
BRCA	TCGA-B6-A0RH-01	exon_skip_149207	12011107	12011226	12011227	12011228	Splice_Site	-	T	e5+1

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-CA-6718-01
	Cancer type: COAD
	ESID: exon_skip_149207
	Skipped exon start: 12011107
	Skipped exon end: 12011226
	Mutation start: 12011200
	Mutation end: 12011200
	Mutation type: Nonsense_Mutation
	Reference seq: G
	Mutation seq: T
	AAchange: p.E203X
exon_skip_141986_COAD_TCGA-CA-6718-01.png
exon_skip_149207_COAD_TCGA-CA-6718-01.png
exon_skip_286384_COAD_TCGA-CA-6718-01.png
exon_skip_30232_COAD_TCGA-CA-6718-01.png
exon_skip_30235_COAD_TCGA-CA-6718-01.png
exon_skip_317435_COAD_TCGA-CA-6718-01.png
exon_skip_317461_COAD_TCGA-CA-6718-01.png
exon_skip_387073_COAD_TCGA-CA-6718-01.png
exon_skip_44936_COAD_TCGA-CA-6718-01.png
exon_skip_501551_COAD_TCGA-CA-6718-01.png
exon_skip_86037_COAD_TCGA-CA-6718-01.png
	Sample: TCGA-E2-A156-01
	Cancer type: BRCA
	ESID: exon_skip_149202
	Skipped exon start: 11984673
	Skipped exon end: 11984847
	Mutation start: 11984840
	Mutation end: 11984856
	Mutation type: Frame_Shift_Del
	Reference seq: CAGTTAAAGTAGGTGAT
	Mutation seq: -
	AAchange: p.A129fs
exon_skip_149196_BRCA_TCGA-E2-A156-01.png
	Sample: TCGA-B6-A0IB-01
	Cancer type: BRCA
	ESID: exon_skip_149187
	Skipped exon start: 11958206
	Skipped exon end: 11958308
	Mutation start: 11958309
	Mutation end: 11958310
	Mutation type: Splice_Site
	Reference seq: -
	Mutation seq: T
	AAchange: e2+1
exon_skip_149187_BRCA_TCGA-B6-A0IB-01.png
exon_skip_43714_BRCA_TCGA-B6-A0IB-01.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
ISHIKAWAHERAKLIO02ER_ENDOMETRIUM	11958206	11958308	11958296	11958296	Frame_Shift_Del	A	-	p.Q69fs
HEC59_ENDOMETRIUM	11958206	11958308	11958211	11958211	Missense_Mutation	C	T	p.R41C
SNU1040_LARGE_INTESTINE	11958206	11958308	11958212	11958212	Missense_Mutation	G	A	p.R41H
NCIH69_LUNG	11958206	11958308	11958290	11958290	Missense_Mutation	G	T	p.G67V
COV644_OVARY	11958206	11958308	11958306	11958306	Missense_Mutation	C	A	p.H72Q
IGR1_SKIN	11984673	11984847	11984693	11984693	Missense_Mutation	G	T	p.S80I
VMRCLCD_LUNG	11984673	11984847	11984800	11984800	Missense_Mutation	G	C	p.V116L
CW2_LARGE_INTESTINE	11984673	11984847	11984825	11984825	Missense_Mutation	G	A	p.S124N
LS411N_LARGE_INTESTINE	11998892	11999011	11998898	11998898	Missense_Mutation	C	T	p.R134W
HCC2998_LARGE_INTESTINE	11998892	11999011	11998898	11998898	Missense_Mutation	C	T	p.R134W
ISHIKAWAHERAKLIO02ER_ENDOMETRIUM	11998892	11999011	11998899	11998899	Missense_Mutation	G	A	p.R134Q
HCC2998_LARGE_INTESTINE	11998892	11999011	11998958	11998958	Missense_Mutation	C	T	p.R154W
HEC251_ENDOMETRIUM	11998892	11999011	11998990	11998990	Missense_Mutation	T	G	p.F164L
TUHR4TKB_KIDNEY	12011107	12011226	12011130	12011130	Missense_Mutation	A	C	p.E179D
MDAMB134VI_BREAST	12011107	12011226	12011144	12011144	Missense_Mutation	C	T	p.S184L
CROAP2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	12011107	12011226	12011200	12011200	Missense_Mutation	G	A	p.E203K
SW626_OVARY	12032456	12032604	12032491	12032491	Missense_Mutation	G	C	p.K309N
H2369_PLEURA	12032456	12032604	12032537	12032537	Missense_Mutation	C	G	p.P325A
MFE319_ENDOMETRIUM	12032456	12032604	12032538	12032538	Missense_Mutation	C	A	p.P325H
HCC1569_BREAST	12032456	12032604	12032577	12032577	Missense_Mutation	C	T	p.P338L
SNU738_CENTRAL_NERVOUS_SYSTEM	12032456	12032604	12032594	12032594	Missense_Mutation	G	T	p.V344F
SNU81_LARGE_INTESTINE	11984673	11984847	11984779	11984779	Nonsense_Mutation	G	T	p.G109*

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for MAP2K4

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MAP2K4

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MAP2K4

Top

RelatedDrugs for MAP2K4

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for MAP2K4

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for MAP2K4

Exon skipping events across known transcript of Ensembl for MAP2K4 from UCSC genome browser

Gene isoform structures and expression levels for MAP2K4

Exon skipping events with PSIs in TCGA for MAP2K4

Exon skipping events with PSIs in GTEx for MAP2K4

Open reading frame (ORF) annotation in the exon skipping event for MAP2K4

Infer the effects of exon skipping event on protein functional features for MAP2K4

SNVs in the skipped exons for MAP2K4

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for MAP2K4

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MAP2K4

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for MAP2K4

RelatedDrugs for MAP2K4

RelatedDiseases for MAP2K4