|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for SEMA3F |
 Gene summary |
| Gene information | Gene symbol | SEMA3F | Gene ID | 6405 |
| Gene name | semaphorin 3F | |
| Synonyms | SEMA-IV|SEMA4|SEMAK | |
| Cytomap | 3p21.31 | |
| Type of gene | protein-coding | |
| Description | semaphorin-3Fsema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3Fsema domain, immunoglobulin domain (Ig), short basic domain, secreted, 3Fsemaphorin III/Fsemaphorin IV | |
| Modification date | 20180523 | |
| UniProtAcc | Q13275 | |
| Context | PubMed: SEMA3F [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| SEMA3F | GO:0007411 | axon guidance | 15814794 |
Top |
Exon skipping events across known transcript of Ensembl for SEMA3F from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for SEMA3F |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for SEMA3F |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_374591 | 3 | 50192561:50192997:50197007:50197167:50211225:50211386 | 50197007:50197167 | ENSG00000001617.7 | ENST00000002829.3,ENST00000450338.1 |
| exon_skip_374595 | 3 | 50211733:50211783:50212528:50212621:50214200:50214294 | 50212528:50212621 | ENSG00000001617.7 | ENST00000002829.3 |
| exon_skip_374599 | 3 | 50212528:50212621:50214200:50214294:50219716:50219836 | 50214200:50214294 | ENSG00000001617.7 | ENST00000002829.3 |
| exon_skip_374605 | 3 | 50219716:50219836:50220076:50220216:50220336:50220451 | 50220076:50220216 | ENSG00000001617.7 | ENST00000413852.1,ENST00000002829.3,ENST00000434342.1,ENST00000450338.1 |
| exon_skip_374613 | 3 | 50220336:50220451:50220618:50220688:50220852:50220996 | 50220618:50220688 | ENSG00000001617.7 | ENST00000493743.1,ENST00000413852.1,ENST00000002829.3,ENST00000434342.1,ENST00000450338.1 |
| exon_skip_374615 | 3 | 50223098:50223140:50223321:50223479:50223713:50223781 | 50223321:50223479 | ENSG00000001617.7 | ENST00000413852.1,ENST00000002829.3,ENST00000434342.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for SEMA3F |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_374595 | 3 | 50211733:50211783:50212528:50212621:50214200:50214294 | 50212528:50212621 | ENSG00000001617.7 | ENST00000002829.3 |
| exon_skip_374599 | 3 | 50212528:50212621:50214200:50214294:50219716:50219836 | 50214200:50214294 | ENSG00000001617.7 | ENST00000002829.3 |
| exon_skip_374605 | 3 | 50219716:50219836:50220076:50220216:50220336:50220451 | 50220076:50220216 | ENSG00000001617.7 | ENST00000450338.1,ENST00000413852.1,ENST00000002829.3,ENST00000434342.1 |
| exon_skip_374613 | 3 | 50220336:50220451:50220618:50220688:50220852:50220996 | 50220618:50220688 | ENSG00000001617.7 | ENST00000450338.1,ENST00000413852.1,ENST00000002829.3,ENST00000434342.1,ENST00000493743.1 |
| exon_skip_374615 | 3 | 50223098:50223140:50223321:50223479:50223713:50223781 | 50223321:50223479 | ENSG00000001617.7 | ENST00000413852.1,ENST00000002829.3,ENST00000434342.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for SEMA3F |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000002829 | 50197007 | 50197167 | 5CDS-5UTR |
| ENST00000002829 | 50214200 | 50214294 | Frame-shift |
| ENST00000002829 | 50220076 | 50220216 | Frame-shift |
| ENST00000002829 | 50220618 | 50220688 | Frame-shift |
| ENST00000002829 | 50223321 | 50223479 | Frame-shift |
| ENST00000002829 | 50212528 | 50212621 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000002829 | 50214200 | 50214294 | Frame-shift |
| ENST00000002829 | 50220076 | 50220216 | Frame-shift |
| ENST00000002829 | 50220618 | 50220688 | Frame-shift |
| ENST00000002829 | 50223321 | 50223479 | Frame-shift |
| ENST00000002829 | 50212528 | 50212621 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for SEMA3F |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000002829 | 3819 | 785 | 50212528 | 50212621 | 941 | 1033 | 152 | 183 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000002829 | 3819 | 785 | 50212528 | 50212621 | 941 | 1033 | 152 | 183 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q13275 | 152 | 183 | 153 | 183 | Alternative sequence | ID=VSP_053417;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:8786119;Dbxref=PMID:8786119 |
| Q13275 | 152 | 183 | 19 | 785 | Chain | ID=PRO_0000032320;Note=Semaphorin-3F |
| Q13275 | 152 | 183 | 31 | 545 | Domain | Note=Sema;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00352 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q13275 | 152 | 183 | 153 | 183 | Alternative sequence | ID=VSP_053417;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:8786119;Dbxref=PMID:8786119 |
| Q13275 | 152 | 183 | 19 | 785 | Chain | ID=PRO_0000032320;Note=Semaphorin-3F |
| Q13275 | 152 | 183 | 31 | 545 | Domain | Note=Sema;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00352 |
Top |
SNVs in the skipped exons for SEMA3F |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
SEMA3F_HNSC_exon_skip_374595_psi_boxplot.png |
SEMA3F_PCPG_exon_skip_374595_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| PCPG | TCGA-QT-A5XJ-01 | exon_skip_374595 | 50212529 | 50212621 | 50212532 | 50212532 | Frame_Shift_Del | A | - | p.T154fs |
| HNSC | TCGA-CN-6010-01 | exon_skip_374595 | 50212529 | 50212621 | 50212549 | 50212549 | Frame_Shift_Del | T | - | p.T159fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_374599 | 50214201 | 50214294 | 50214267 | 50214267 | Frame_Shift_Del | A | - | p.K206fs |
| BLCA | TCGA-DK-AA75-01 | exon_skip_374615 | 50223322 | 50223479 | 50223330 | 50223355 | Frame_Shift_Del | CTACGTGGCGTCAGCCGTGGGTGTCA | - | p.YVASAVGVT533fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_374615 | 50223322 | 50223479 | 50223388 | 50223388 | Frame_Shift_Del | G | - | p.G552fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_374615 | 50223322 | 50223479 | 50223388 | 50223388 | Frame_Shift_Del | G | - | p.G552fs |
| LGG | TCGA-DU-6407-02 | exon_skip_374591 | 50197008 | 50197167 | 50197082 | 50197082 | Nonsense_Mutation | G | A | p.W9* |
| LUAD | TCGA-55-8511-01 | exon_skip_374591 | 50197008 | 50197167 | 50197159 | 50197159 | Nonsense_Mutation | C | A | p.S35* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-CN-6010-01 |
| Cancer type: HNSC | |
| ESID: exon_skip_374595 | |
| Skipped exon start: 50212529 | |
| Skipped exon end: 50212621 | |
| Mutation start: 50212549 | |
| Mutation end: 50212549 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: T | |
| Mutation seq: - | |
| AAchange: p.T159fs | |
exon_skip_374595_HNSC_TCGA-CN-6010-01.png | |
 | Sample: TCGA-QT-A5XJ-01 |
| Cancer type: PCPG | |
| ESID: exon_skip_374595 | |
| Skipped exon start: 50212529 | |
| Skipped exon end: 50212621 | |
| Mutation start: 50212532 | |
| Mutation end: 50212532 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: A | |
| Mutation seq: - | |
| AAchange: p.T154fs | |
exon_skip_374595_PCPG_TCGA-QT-A5XJ-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MPP89_PLEURA | 50197008 | 50197167 | 50197072 | 50197072 | Missense_Mutation | T | A | p.L6H |
| HOP62_LUNG | 50197008 | 50197167 | 50197152 | 50197152 | Missense_Mutation | C | T | p.R33W |
| LS123_LARGE_INTESTINE | 50212529 | 50212621 | 50212557 | 50212557 | Missense_Mutation | T | G | p.V162G |
| UMUC3_URINARY_TRACT | 50212529 | 50212621 | 50212587 | 50212587 | Missense_Mutation | G | T | p.G172V |
| TFK1_BILIARY_TRACT | 50214201 | 50214294 | 50214225 | 50214225 | Missense_Mutation | G | A | p.E192K |
| HS852T_SKIN | 50214201 | 50214294 | 50214225 | 50214225 | Missense_Mutation | G | A | p.E192K |
| TASK1_CENTRAL_NERVOUS_SYSTEM | 50214201 | 50214294 | 50214225 | 50214225 | Missense_Mutation | G | A | p.E192K |
| HEC6_ENDOMETRIUM | 50220077 | 50220216 | 50220116 | 50220116 | Missense_Mutation | C | A | p.A268E |
| NCIH1373_LUNG | 50220077 | 50220216 | 50220152 | 50220152 | Missense_Mutation | G | A | p.R280H |
| YD10B_UPPER_AERODIGESTIVE_TRACT | 50220077 | 50220216 | 50220161 | 50220161 | Missense_Mutation | C | T | p.S283L |
| JHOM1_OVARY | 50220077 | 50220216 | 50220166 | 50220166 | Missense_Mutation | G | A | p.E285K |
| HEC59_ENDOMETRIUM | 50220077 | 50220216 | 50220206 | 50220206 | Missense_Mutation | G | A | p.R298H |
| T98G_CENTRAL_NERVOUS_SYSTEM | 50223322 | 50223479 | 50223346 | 50223346 | Missense_Mutation | G | A | p.V538M |
| TGBC11TKB_STOMACH | 50223322 | 50223479 | 50223374 | 50223374 | Missense_Mutation | G | A | p.R547H |
| NO11_CENTRAL_NERVOUS_SYSTEM | 50223322 | 50223479 | 50223419 | 50223419 | Missense_Mutation | G | A | p.R562Q |
| MET2B | 50212529 | 50212621 | 50212621 | 50212621 | Splice_Site | G | C | p.Q183H |
| SNU175_LARGE_INTESTINE | 50220619 | 50220688 | 50220688 | 50220688 | Splice_Site | G | A | p.G363D |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for SEMA3F |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SEMA3F |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for SEMA3F |
Top |
RelatedDrugs for SEMA3F |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for SEMA3F |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| SEMA3F | C0014170 | Endometrial Neoplasms | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|