|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RTN1 |
 Gene summary |
| Gene information | Gene symbol | RTN1 | Gene ID | 6252 |
| Gene name | reticulon 1 | |
| Synonyms | NSP | |
| Cytomap | 14q23.1 | |
| Type of gene | protein-coding | |
| Description | reticulon-1neuroendocrine-specific protein | |
| Modification date | 20180522 | |
| UniProtAcc | Q16799 | |
| Context | PubMed: RTN1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for RTN1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RTN1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RTN1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_113706 | 14 | 60069782:60069841:60069929:60069976:60070569:60070639 | 60069929:60069976 | ENSG00000139970.12 | ENST00000432103.2,ENST00000395090.1,ENST00000557422.1,ENST00000474911.1,ENST00000267484.5,ENST00000342503.4 |
| exon_skip_113708 | 14 | 60070569:60070639:60072085:60072224:60074002:60074210 | 60072085:60072224 | ENSG00000139970.12 | ENST00000432103.2,ENST00000395090.1,ENST00000474911.1,ENST00000267484.5,ENST00000342503.4 |
| exon_skip_113712 | 14 | 60074002:60074210:60076839:60076950:60097163:60097327 | 60076839:60076950 | ENSG00000139970.12 | ENST00000395090.1 |
| exon_skip_113719 | 14 | 60074002:60074210:60193636:60194386:60212425:60213199 | 60193636:60194386 | ENSG00000139970.12 | ENST00000267484.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RTN1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_113706 | 14 | 60069782:60069841:60069929:60069976:60070569:60070639 | 60069929:60069976 | ENSG00000139970.12 | ENST00000395090.1,ENST00000342503.4,ENST00000267484.5,ENST00000432103.2,ENST00000474911.1,ENST00000557422.1 |
| exon_skip_113708 | 14 | 60070569:60070639:60072085:60072224:60074002:60074210 | 60072085:60072224 | ENSG00000139970.12 | ENST00000395090.1,ENST00000342503.4,ENST00000267484.5,ENST00000432103.2,ENST00000474911.1 |
| exon_skip_113712 | 14 | 60074002:60074210:60076839:60076950:60097163:60097327 | 60076839:60076950 | ENSG00000139970.12 | ENST00000395090.1 |
| exon_skip_113719 | 14 | 60074002:60074210:60193636:60194386:60212425:60213199 | 60193636:60194386 | ENSG00000139970.12 | ENST00000267484.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RTN1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000267484 | 60069929 | 60069976 | Frame-shift |
| ENST00000267484 | 60072085 | 60072224 | Frame-shift |
| ENST00000267484 | 60193636 | 60194386 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000267484 | 60069929 | 60069976 | Frame-shift |
| ENST00000267484 | 60072085 | 60072224 | Frame-shift |
| ENST00000267484 | 60193636 | 60194386 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for RTN1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000267484 | 3452 | 776 | 60193636 | 60194386 | 1352 | 2101 | 338 | 588 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000267484 | 3452 | 776 | 60193636 | 60194386 | 1352 | 2101 | 338 | 588 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q16799 | 338 | 588 | 1 | 568 | Alternative sequence | ID=VSP_005645;Note=In isoform RTN1-C. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:15489334,ECO:0000303|PubMed:7685762;Dbxref=PMID:15489334,PMID:7685762 |
| Q16799 | 338 | 588 | 1 | 420 | Alternative sequence | ID=VSP_005644;Note=In isoform RTN1-B. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:7685762;Dbxref=PMID:7685762 |
| Q16799 | 338 | 588 | 569 | 588 | Alternative sequence | ID=VSP_005646;Note=In isoform RTN1-C. GPGPLGPGAPPPLLFLNKQK->MQATADSTKMDCVWSNWKSQ;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:15489334,ECO:0000303|PubMed:7685762;Dbxref=PMID:15489334,PMID:7685762 |
| Q16799 | 338 | 588 | 1 | 776 | Chain | ID=PRO_0000168158;Note=Reticulon-1 |
| Q16799 | 338 | 588 | 350 | 350 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q8K0T0 |
| Q16799 | 338 | 588 | 352 | 352 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q8K0T0 |
| Q16799 | 338 | 588 | 487 | 487 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18088087,ECO:0000244|PubMed:24275569;Dbxref=PMID:18088087,PMID:24275569 |
| Q16799 | 338 | 588 | 357 | 357 | Natural variant | ID=VAR_053631;Note=I->V;Dbxref=dbSNP:rs35707243 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q16799 | 338 | 588 | 1 | 568 | Alternative sequence | ID=VSP_005645;Note=In isoform RTN1-C. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:15489334,ECO:0000303|PubMed:7685762;Dbxref=PMID:15489334,PMID:7685762 |
| Q16799 | 338 | 588 | 1 | 420 | Alternative sequence | ID=VSP_005644;Note=In isoform RTN1-B. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:7685762;Dbxref=PMID:7685762 |
| Q16799 | 338 | 588 | 569 | 588 | Alternative sequence | ID=VSP_005646;Note=In isoform RTN1-C. GPGPLGPGAPPPLLFLNKQK->MQATADSTKMDCVWSNWKSQ;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303|PubMed:15489334,ECO:0000303|PubMed:7685762;Dbxref=PMID:15489334,PMID:7685762 |
| Q16799 | 338 | 588 | 1 | 776 | Chain | ID=PRO_0000168158;Note=Reticulon-1 |
| Q16799 | 338 | 588 | 350 | 350 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q8K0T0 |
| Q16799 | 338 | 588 | 352 | 352 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q8K0T0 |
| Q16799 | 338 | 588 | 487 | 487 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244,ECO:0000244;evidence=ECO:0000244|PubMed:18088087,ECO:0000244|PubMed:24275569;Dbxref=PMID:18088087,PMID:24275569 |
| Q16799 | 338 | 588 | 357 | 357 | Natural variant | ID=VAR_053631;Note=I->V;Dbxref=dbSNP:rs35707243 |
Top |
SNVs in the skipped exons for RTN1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LGG | TCGA-TQ-A8XE-01 | exon_skip_113706 | 60069930 | 60069976 | 60069953 | 60069957 | Frame_Shift_Del | GTAGA | - | p.TLP734fs |
| LGG | TCGA-TQ-A8XE-02 | exon_skip_113706 | 60069930 | 60069976 | 60069953 | 60069957 | Frame_Shift_Del | GTAGA | - | p.TLP734fs |
| STAD | TCGA-CG-5726-01 | exon_skip_113708 | 60072086 | 60072224 | 60072086 | 60072086 | Frame_Shift_Del | T | - | p.K704fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_113719 | 60193637 | 60194386 | 60193811 | 60193811 | Frame_Shift_Del | G | - | p.Q531fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_113719 | 60193637 | 60194386 | 60193811 | 60193811 | Frame_Shift_Del | G | - | p.Q531fs |
| LIHC | TCGA-O8-A75V-01 | exon_skip_113719 | 60193637 | 60194386 | 60194074 | 60194095 | Frame_Shift_Del | GAGGGCGGCGGGCCGCCCACGT | - | p.HVGGPPPS436fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_113719 | 60193637 | 60194386 | 60194308 | 60194308 | Frame_Shift_Del | C | - | p.G365fs |
| LUAD | TCGA-93-8067-01 | exon_skip_113708 | 60072086 | 60072224 | 60072181 | 60072181 | Nonsense_Mutation | G | A | p.Q673* |
| HNSC | TCGA-CV-7414-01 | exon_skip_113708 | 60072086 | 60072224 | 60072193 | 60072193 | Nonsense_Mutation | G | A | p.Q669* |
| ESCA | TCGA-IG-A8O2-01 | exon_skip_113719 | 60193637 | 60194386 | 60193766 | 60193766 | Nonsense_Mutation | C | A | p.E546* |
| ESCA | TCGA-IG-A8O2-01 | exon_skip_113719 | 60193637 | 60194386 | 60193766 | 60193766 | Nonsense_Mutation | C | A | p.E546X |
| LUAD | TCGA-50-5931-01 | exon_skip_113719 | 60193637 | 60194386 | 60193880 | 60193880 | Nonsense_Mutation | C | A | p.E508* |
| BLCA | TCGA-K4-A5RI-01 | exon_skip_113719 | 60193637 | 60194386 | 60194249 | 60194249 | Nonsense_Mutation | C | A | p.E385* |
| UCEC | TCGA-BS-A0UV-01 | exon_skip_113719 | 60193637 | 60194386 | 60194387 | 60194387 | Splice_Site | C | A | e3-1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| OVK18_OVARY | 60193637 | 60194386 | 60194207 | 60194207 | Frame_Shift_Del | G | - | p.L399fs |
| HUNS1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 60193637 | 60194386 | 60193945 | 60193950 | In_Frame_Del | TCCTGC | - | p.EQ484del |
| NCIH1436_LUNG | 60069930 | 60069976 | 60069947 | 60069947 | Missense_Mutation | C | A | p.V738L |
| NCIH1688_LUNG | 60072086 | 60072224 | 60072100 | 60072100 | Missense_Mutation | C | A | p.V700L |
| NCIH522_LUNG | 60072086 | 60072224 | 60072107 | 60072107 | Missense_Mutation | C | A | p.Q697H |
| BFTC905_URINARY_TRACT | 60072086 | 60072224 | 60072148 | 60072148 | Missense_Mutation | T | A | p.N684Y |
| CHLA15_AUTONOMIC_GANGLIA | 60193637 | 60194386 | 60193641 | 60193641 | Missense_Mutation | T | A | p.Q587H |
| SW1271_LUNG | 60193637 | 60194386 | 60193762 | 60193762 | Missense_Mutation | G | A | p.T547M |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 60193637 | 60194386 | 60193781 | 60193781 | Missense_Mutation | C | T | p.G541R |
| PC9_LUNG | 60193637 | 60194386 | 60193789 | 60193789 | Missense_Mutation | G | T | p.P538H |
| CORL95_LUNG | 60193637 | 60194386 | 60193825 | 60193825 | Missense_Mutation | G | T | p.P526H |
| CL40_LARGE_INTESTINE | 60193637 | 60194386 | 60193832 | 60193832 | Missense_Mutation | C | T | p.D524N |
| RCHACV_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 60193637 | 60194386 | 60193864 | 60193864 | Missense_Mutation | C | T | p.R513Q |
| HCT116_LARGE_INTESTINE | 60193637 | 60194386 | 60193873 | 60193873 | Missense_Mutation | G | A | p.A510V |
| CL34_LARGE_INTESTINE | 60193637 | 60194386 | 60193873 | 60193873 | Missense_Mutation | G | A | p.A510V |
| RL952_ENDOMETRIUM | 60193637 | 60194386 | 60193889 | 60193889 | Missense_Mutation | G | A | p.R505W |
| SISO_CERVIX | 60193637 | 60194386 | 60193898 | 60193898 | Missense_Mutation | T | C | p.T502A |
| TE4_OESOPHAGUS | 60193637 | 60194386 | 60193906 | 60193906 | Missense_Mutation | C | A | p.R499L |
| AM38_CENTRAL_NERVOUS_SYSTEM | 60193637 | 60194386 | 60193994 | 60193994 | Missense_Mutation | A | T | p.S470T |
| OC316_OVARY | 60193637 | 60194386 | 60194126 | 60194126 | Missense_Mutation | C | T | p.A426T |
| OC314_OVARY | 60193637 | 60194386 | 60194126 | 60194126 | Missense_Mutation | C | T | p.A426T |
| HCC1833_LUNG | 60193637 | 60194386 | 60194183 | 60194183 | Missense_Mutation | C | G | p.E407Q |
| HEC6_ENDOMETRIUM | 60193637 | 60194386 | 60194288 | 60194288 | Missense_Mutation | C | T | p.E372K |
| OACM51_OESOPHAGUS | 60193637 | 60194386 | 60194291 | 60194291 | Missense_Mutation | C | T | p.A371T |
| LC2AD_LUNG | 60193637 | 60194386 | 60194302 | 60194302 | Missense_Mutation | G | A | p.S367L |
| A673_BONE | 60193637 | 60194386 | 60194318 | 60194318 | Missense_Mutation | C | G | p.E362Q |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RTN1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RTN1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RTN1 |
Top |
RelatedDrugs for RTN1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RTN1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| RTN1 | C0151744 | Myocardial Ischemia | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|